CN111020036B - Application of human circ-STXBP5L and related product - Google Patents

Application of human circ-STXBP5L and related product Download PDF

Info

Publication number
CN111020036B
CN111020036B CN202010010359.2A CN202010010359A CN111020036B CN 111020036 B CN111020036 B CN 111020036B CN 202010010359 A CN202010010359 A CN 202010010359A CN 111020036 B CN111020036 B CN 111020036B
Authority
CN
China
Prior art keywords
circ
stxbp5l
lung cancer
small cell
cell lung
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010010359.2A
Other languages
Chinese (zh)
Other versions
CN111020036A (en
Inventor
张晨曦
吴晓渊
张斌
周莹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Brain Hospital
Original Assignee
Nanjing Brain Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Brain Hospital filed Critical Nanjing Brain Hospital
Priority to CN202010010359.2A priority Critical patent/CN111020036B/en
Publication of CN111020036A publication Critical patent/CN111020036A/en
Application granted granted Critical
Publication of CN111020036B publication Critical patent/CN111020036B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Abstract

The invention belongs to the field of biomedical research, and particularly relates to application of human circ-STXBP5L in preparation of a small cell lung cancer treatment product or a small cell lung cancer diagnosis product. The invention discovers for the first time that the circular RNA circ-STXBP5L can be used as a novel diagnosis marker for differentially diagnosing the small cell lung cancer and the non-small cell lung cancer, discovers for the first time that the interference on the expression of the circ-STXBP5L can reduce the proliferation of small cell lung cancer cell strains of cells, and the circ-STXBP5L can be used as a potential target site to be applied to the preparation of the medicine for treating the small cell lung cancer. The circ-STXBP5L gene and the expression product thereof are used as markers for diagnosing the small cell lung cancer, so that the small cell lung cancer can be diagnosed more accurately and quickly, and the gene serving as a target gene for preparing the medicine for treating the small cell lung cancer provides a new treatment target and a new treatment way for treating the small cell lung cancer.

Description

Application of human circ-STXBP5L and related product
Technical Field
The invention belongs to the field of biomedical research, and particularly relates to application of human circ-STXBP5L and a related product.
Background
Small cell lung cancer originates in the primary neuroendocrine cells in the lung, a highly lethal malignancy, accounting for 15-20% of the total number of lung cancer patients. It has different biological properties than non-small cell lung cancer, such as: the tumor cells have short doubling time and high growth fraction, and can generate wide metastasis in early stage. Although small cell lung cancer is sensitive to initial chemotherapy treatment, most patients inevitably relapse due to chemotherapy resistance, resulting in difficult follow-up treatment and poor prognosis. The average 5-year survival rate for small cell lung cancer is less than 7%, with most patients developing metastatic disease and dying within 12 months. Since small cell lung cancer is rarely treated by surgery, few specimens are available for study. Small cell lung cancer has been studied less than non-small cell lung cancer, and there has been no significant clinical progress in the treatment of small cell lung cancer in nearly 30 years. Therefore, further analyzing the molecular mechanism in the development process of small cell lung cancer, searching and identifying new diagnostic markers, and searching new targets for treating small cell lung cancer become urgent matters for preventing and treating small cell lung cancer.
There is no report on the use of circ-STXBP5L in the diagnosis or treatment of small cell lung cancer.
Disclosure of Invention
In order to overcome the problems in the prior art, the invention aims to provide the application of the human circ-STXBP5L and related products.
In order to achieve the above objects and other related objects, the present invention adopts the following technical solutions:
the first aspect of the invention provides an application of human circ-STXBP5L in preparing a small cell lung cancer treatment product or a small cell lung cancer diagnosis product.
The second aspect of the invention provides the application of a substance for specifically recognizing circ-STXBP5L in preparing a small cell lung cancer diagnosis product.
The third aspect of the invention provides a small cell lung cancer diagnostic kit, which comprises a substance for specifically recognizing circ-STXBP 5L.
In a fourth aspect, the invention provides the use of a circ-STXBP5L inhibitor in the manufacture of a product having at least one of the following effects: treating small cell lung cancer; inhibit the proliferation rate of small cell lung cancer cells.
In a fifth aspect, the present invention provides a nucleic acid molecule for reducing the expression of circ-STXBP5L in small cell lung cancer cells, said nucleic acid molecule comprising:
a. a double-stranded RNA containing a nucleotide sequence capable of hybridizing with the circ-STXBP 5L; or
shRNA containing a nucleotide sequence capable of hybridizing with the circ-STXBP 5L;
wherein the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand are complementary to form an RNA dimer, and the sequence of the first strand is substantially identical to the target sequence in the circ-STXBP 5L; the shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, wherein the sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the sense strand segment is basically identical to a target sequence in circ-STXBP 5L.
The sixth aspect of the invention provides a circ-STXBP5L interfering nucleic acid construct which contains a gene segment for coding shRNA in the nucleic acid molecule and can express the shRNA.
The seventh aspect of the invention provides a circ-STXBP5L interfering lentivirus, which is formed by virus packaging of the interfering nucleic acid construct under the assistance of a lentivirus packaging plasmid and a cell line.
In an eighth aspect, the present invention provides a use of the nucleic acid molecule, or the circ-STXBP5L interfering nucleic acid construct, or the circ-STXBP5L interfering lentivirus, wherein the use comprises: is used for preparing a medicament for preventing or treating the small cell lung cancer or a kit for reducing the expression of the circ-STXBP5L in the small cell lung cancer cells.
The ninth aspect of the present invention provides a composition for preventing or treating small cell lung cancer, which comprises the following effective substances: the aforementioned nucleic acid molecules; and/or, the aforementioned circ-STXBP5L interfering nucleic acid construct; and/or, the aforementioned circ-STXBP5L interfering lentivirus, and a pharmaceutically acceptable carrier, diluent or excipient.
Compared with the prior art, the invention has the following beneficial effects:
the invention discovers for the first time that the circular RNA circ-STXBP5L can be used as a novel diagnostic marker for differentially diagnosing the small cell lung cancer and the non-small cell lung cancer, and the circ-STXBP5L can be used as a potential target site to be applied to the preparation of the medicine for treating the small cell lung cancer. The circ-STXBP5L gene and the expression product thereof are used as markers for diagnosing the small cell lung cancer, so that the small cell lung cancer can be diagnosed more accurately and quickly, and the gene serving as a target gene for preparing the medicine for treating the small cell lung cancer provides a new treatment target and a new treatment way for treating the small cell lung cancer.
Drawings
FIG. 1 is a schematic diagram of the cyclization of circ-STXBP5L in the first embodiment of the present invention (E in FIG. 1 represents exon).
FIG. 2 is a diagram showing the sequencing peaks of the circ-STXBP5L cyclization site in the first embodiment of the present invention.
FIG. 3 is a bar graph showing the effect of RNase R on circ-STXBP5L, GAPDH and β -actin in accordance with the first embodiment of the present invention.
FIG. 4 is a graph comparing the results of detecting the expression of circ-STXBP5L in small cell carcinoma tissue by qRT-PCR in the first embodiment of the present invention (in FIG. 4, SCLC is small cell lung cancer (small cell lung cancer).
FIG. 5 is a comparison of the results of detecting the expression of circ-STXBP5L in non-small cell carcinoma tissues by qRT-PCR in the first embodiment of the present invention (NSCLC is non-small cell carcinoma (non-small cell cancer) in FIG. 5).
FIG. 6 is a comparison graph of circ-STXBP5L expression results in qRT-PCR detection of normal human bronchial epithelial cell lines, small cell lung cancer cell lines and non-small cell lung cancer cell lines in example II of the present invention.
FIG. 7 is a comparison chart of the results of the stable cell line NCI-H446-shcirc-STXBP5 constructed in the second embodiment of the invention for knocking down circ-STXBP 5L.
FIG. 8 is a schematic diagram of cell proliferation curves of a small cell lung cancer cell line H446 with circ-STXBP5L knocked down and a control cell line in the third embodiment of the present invention, wherein the abscissa is days and the ordinate is the 490nm absorbance value detected by an enzyme-labeling instrument.
In the drawings, there is shown in the drawings,
bar graphs represent the mean of three experiments and error bars represent Standard Deviation (SD).
Detailed Description
In recent years, circular RNA (circRNA) has been the latest research focus in the RNA field. circRNA is a newly discovered endogenous non-coding RNA (ncRNA). It is widely and variously present in various biological cells. Unlike linear RNA, circRNA is mainly produced from precursor RNA (pre-mRNA) by an alternative splicing process, in which a downstream 5 'splice donor site is ligated to an upstream 3' splice acceptor site and forms a closed continuous loop. This closed structure makes circRNA highly stable and not easily decomposed by RNA Ribonuclease R (RNase R). Meanwhile, the circRNA has an important regulation and control effect on the expression of genes, and can be used as a microRNA (miRNA) sponge to regulate the expression of miRNA target mRNA in a plurality of biological processes. In addition, circRNA has tissue specificity and developmental stage expression specificity. These features and recent studies have shown that circRNAs have great potential as new diagnostic markers and therapeutic targets for diseases. Research shows that the circRNAs are in expression disorder in various human cancers, including laryngeal squamous cell carcinoma, gastric cancer, liver cancer, colorectal cancer, pancreatic cancer, non-small cell lung cancer and the like. The circRNAs are proved to be a potential novel biomarker and are expected to be applied to early detection and screening of various cancers.
In the early stage, the invention selects cancer and tissues beside the cancer of 6 cases of small cell lung cancer patients, and screens circRNAs differentially expressed in the cancer and tissues beside the cancer by adopting a Next Generation Sequencing (NGS) technology. A total of 28701 different circRNA candidates were detected. We screened circRNAs that were consistently, i.e. co-upregulated or co-downregulated in all of the 6 cancer tissues relative to the paracancerous tissues. There were 35 circRNAs differentially expressed in cancer tissues (fold change >2.0 or <0.5, FDR-however <0.05). Of these, 5 circrnas were up-regulated and 30 circrnas were down-regulated. We selected 5 circrnas with elevated expression for re-validation and found one of the most significantly different circRNA-STXBP5L. The genomic localization of circ-STXBP5L is: chr3:121378716-121381532, corresponding linear gene is STXBP5L (NM _ 014980), and the circular sequence has 411 bases, including the 22 nd to 23 rd exons of the STXBP5L gene. The circRNA is circ-STXBP5L, which is a novel circular RNA discovered by RNA sequencing in the subject group of the applicant. At present, there is no report on the circRNA, and the biological role and clinical significance of the circRNA in small cell lung cancer are completely unknown. The cyclization of circ-STXBP5L is shown in FIGS. 1 and 2.
Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers.
When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, the invention may be practiced using any method, device, and material that is similar or equivalent to the methods, devices, and materials described in examples herein, in addition to those described in prior art practice and the description herein.
Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts.
One embodiment of the invention provides application of human circ-STXBP5L in preparation of a small cell lung cancer treatment product or a small cell lung cancer diagnosis product.
The application of the human circ-STXBP5L in preparing the small cell lung cancer treatment medicine specifically comprises the following steps: the circ-STXBP5L is taken as an action object, and the medicine or the preparation is screened to find the medicine which can inhibit the expression of the human circ-STXBP5L and is taken as a candidate medicine for treating the small cell lung cancer. The circ-STXBP5L small interfering RNA (siRNA) is obtained by screening a human circ-STXBP5L serving as an action object and can be used as a medicament with the effect of inhibiting the proliferation of small cell lung cancer cells. In addition, circ-STXBP5L can be used as an action target, such as an antibody drug, a small molecule drug, or the like.
Furthermore, in the application of preparing a small cell lung cancer diagnosis product, the circ-STXBP5L is a biomarker.
The application of the human circ-STXBP5L in preparing the small cell lung cancer diagnosis medicament specifically comprises the following steps: the circ-STXBP5L expression product is used as a small cell lung cancer diagnosis index to be applied to the preparation of small cell lung cancer diagnosis medicines.
The expression level of circ-STXBP5L in tumor tissue, normal tissue and normal tissue around tumor was detected by qRT-PCR method. The research finds that: the expression level of the circ-STXBP5L in the small cell lung cancer tissue is obviously higher than that of the normal tissue and the normal tissue around the tumor. Suggesting that the expression level of circ-STXBP5L may be a marker for tumor diagnosis.
The small cell lung cancer diagnostic product is used for judging and diagnosing small cell lung cancer or differentially diagnosing small cell lung cancer and non-small cell lung cancer.
The nucleotide sequence of the circ-STXBP5L is shown as SEQ ID NO:1 is shown. The method comprises the following specific steps:
ACCATGTAAATGGACACTGCACAAGTCCAACTTCTCAGAGTTGCAGTTCTGGAAAACGTCTTTCTAGTGCCGATGTTTCAAAAGTAAATCGCTGGGGTCCTGGAAGACCACCATTTCGAAAGGCCCAGTCAGCAGCCTGCATGGAGATTTCTTTACCAGTTACAACAGAAGAAAACCGAGAAAATTCCTATAATCGTTCTAGAAGCTCTAGTATCTCCAGTATTGACAAAGATTCTAAAGAAGCAATTACAGCACTATACTTCATGGACTCCTTTGCACGGAAAAATGACTCTACCATCTCTCCTTGTCTGTTCGTTGGAACCAGTCTGGGAATGGTGTTAATCATCTCCTTAAACCTACCATTAGCAGATGAACAAAGGTTTACAGAGCCAGTCATGGTATTGCCAAGTG。
the small cell lung cancer treatment drug is a molecule which can specifically inhibit the transcription or translation of circ-STXBP5L or can specifically inhibit the expression or activity of the protein of the circ-STXBP5L, so that the expression level of the circ-STXBP5L in the small cell lung cancer cell is reduced, and the purpose of inhibiting the proliferation, growth, differentiation and/or survival of the small cell lung cancer cell is achieved.
The small cell lung cancer treatment product or the small cell lung cancer diagnosis product prepared by the circ-STXBP5L can be, but is not limited to: nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, polypeptides, proteins, or interfering lentiviruses.
The nucleic acid may be, but is not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA), ribozymes, small interfering RNA produced by endoribonuclease III or short hairpin RNA (shRNA).
The amount of small cell lung cancer treatment product administered is a dose sufficient to reduce transcription or translation of human circ-STXBP5L, or to reduce expression or activity of human circ-STXBP5L protein. Such that the expression of human circ-STXBP5L is reduced by at least 50%, 80%, 90%, 95% or 99%.
The method for treating the small cell lung cancer mainly achieves the aim of treating by reducing the expression level of the human circ-STXBP5L and inhibiting the proliferation of the small cell lung cancer cells. In particular, in therapy, a substance effective to reduce the expression level of human circ-STXBP5L is administered to a patient.
The small cell lung cancer diagnostic product comprises a substance specifically recognizing circ-STXBP 5L.
The target sequence of the circ-STXBP5L is shown as SEQ ID NO:4, respectively.
The substance specifically recognizing the circ-STXBP5L can be selected from a primer pair for specifically amplifying the circ-STXBP 5L.
In one embodiment, the primer pair for specifically amplifying circ-STXBP5L comprises an upstream primer shown as SEQ ID NO. 2 and a downstream primer shown as SEQ ID NO. 3.
It should be noted that the small cell lung cancer diagnostic product is not limited to be necessarily in a liquid form.
One embodiment of the invention is an application of a substance for specifically identifying circ-STXBP5L in preparing a small cell lung cancer diagnosis product.
The target sequence of the circ-STXBP5L is shown as SEQ ID NO:4, respectively.
Optionally, the substance specifically recognizing the circ-STXBP5L is selected from a primer pair for specifically amplifying the circ-STXBP 5L.
In one embodiment, the primer pair for the specific amplification of circ-STXBP5L comprises an upstream primer shown as SEQ ID NO. 2 and a downstream primer shown as SEQ ID NO. 3.
The invention provides a small cell lung cancer diagnosis kit, which comprises a substance for specifically recognizing circ-STXBP 5L.
The target sequence of the circ-STXBP5L is shown as SEQ ID NO:4, respectively. The method comprises the following specific steps:
TTGCCAAGTGACCATGTAAAT。
optionally, the substance specifically recognizing the circ-STXBP5L is selected from a primer pair for specifically amplifying the circ-STXBP 5L.
In one embodiment, the primer pair for the specific amplification of circ-STXBP5L comprises an upstream primer shown as SEQ ID NO. 2 and a downstream primer shown as SEQ ID NO. 3.
One embodiment of the invention is the use of a circ-STXBP5L inhibitor in the preparation of a product having at least one of the following effects:
treating small cell lung cancer;
inhibit the proliferation rate of small cell lung cancer cells.
Refers to a molecule having an inhibitory effect on circ-STXBP 5L. Inhibitory effects on circ-STXBP5L include, but are not limited to: inhibiting the expression or activity of circ-STXBP 5L.
Inhibition of circ-STXBP5L activity refers to a decrease in the activity of circ-STXBP 5L. Preferably, the activity of circ-STXBP5L is reduced by at least 10%, preferably by at least 30%, more preferably by at least 50%, even more preferably by at least 70%, and most preferably by at least 90% compared to that before inhibition.
The inhibition of the expression of the circ-STXBP5L can specifically be the inhibition of the transcription or translation of the circ-STXBP5L, and specifically can refer to the following steps: causing the gene of circ-STXBP5L to be non-transcribed or reducing the transcriptional activity of the gene of circ-STXBP5L, or causing the gene of circ-STXBP5L to be non-translated or reducing the level of translation of the gene of circ-STXBP 5L.
The regulation of the gene expression of circ-STXBP5L can be performed by one skilled in the art using conventional methods, such as gene knock-out, homologous recombination, interfering RNA, etc.
The inhibition of the gene expression of circ-STXBP5L can be verified by detecting the expression amount by qRT-PCR.
Preferably, the expression of circ-STXBP5L is reduced by at least 10%, preferably by at least 30%, more preferably by at least 50%, more preferably by at least 70%, still more preferably by at least 90%, most preferably by no expression of circ-STXBP5L as compared to the wild type.
The product necessarily comprises a circ-STXBP5L inhibitor, and the circ-STXBP5L inhibitor is taken as an effective component of the effect.
In the product, the effective component for playing the above functions can be only a circ-STXBP5L inhibitor, and can also comprise other molecules capable of playing the above functions.
That is, the circ-STXBP5L inhibitor is the only active ingredient or one of the active ingredients of the product.
The product may be a single component material or a multi-component material.
The form of the product is not particularly limited, and can be various substance forms such as solid, liquid, gel, semifluid, aerosol and the like.
The product is primarily directed to mammals. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human.
Such products include, but are not limited to, pharmaceuticals, nutraceuticals, foods, and the like.
The circ-STXBP5L inhibitor can be a nucleic acid molecule, an antibody or a small molecule compound.
The small molecule compound means a compound consisting of several or several tens of atoms and having a molecular mass of 1000 or less in the present invention.
As exemplified in the examples herein, the circ-STXBP5L inhibitor can be a nucleic acid molecule that reduces the expression of circ-STXBP5L in small cell lung cancer cells. Specifically, it may be a double-stranded RNA or shRNA.
One embodiment of the invention is a method of treating small cell lung cancer by administering to a subject a circ-STXBP5L inhibitor.
The subject may be a mammal or a mammalian small cell lung cancer cell. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human. The small cell lung cancer cell can be an ex vivo small cell lung cancer cell.
The subject may be a patient suffering from small cell lung cancer or an individual in whom treatment is desired. Or the subject is a small cell lung cancer patient or an individual expected to treat small cell lung cancer.
The circ-STXBP5L inhibitor can be administered to a subject before, during, or after receiving treatment for small cell lung cancer.
One embodiment of the invention is a nucleic acid molecule comprising a double-stranded RNA or shRNA that reduces the expression of circ-STXBP5L in small cell lung cancer cells.
Wherein the double-stranded RNA contains a nucleotide sequence capable of hybridizing with the circ-STXBP 5L;
the shRNA contains a nucleotide sequence capable of hybridizing with the circ-STXBP 5L.
Further, the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand are complementary to form an RNA dimer, and the sequence of the first strand is substantially identical to the target sequence in circ-STXBP 5L.
The target sequence in the circ-STXBP5L is a fragment in the circ-STXBP5L corresponding to an mRNA fragment which is recognized and silenced by the nucleic acid molecule when the nucleic acid molecule is used for specifically silencing the expression of the circ-STXBP 5L.
Further, the target sequence of the shRNA or the double-stranded RNA is shown as SEQ ID NO:4, respectively.
Further, the double-stranded RNA is a small interfering RNA (siRNA).
The shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, wherein the sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the sense strand segment is basically identical to a target sequence in circ-STXBP 5L.
The shRNA can become small interfering RNA (siRNA) after enzyme digestion processing, and further plays a role in specifically silencing the expression of endogenous circ-STXBP5L in small cell lung cancer cells.
Further, the sequence of the stem-loop structure of the shRNA can be selected from any one of the following sequences: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, and CCACACC.
The target sequence of the shRNA is shown as SEQ ID NO:4, respectively.
As described in the embodiment of the invention, the shRNA is shcirc-STXBP5L, and the nucleotide sequence of the shRNA is shown as SEQ ID NO:6 and SEQ ID NO:7, specifically:
shcirc-STXBP5L forward oligonucleotide 5'-CCGGTTGCCAAGTGACCATGTAAATCTCGAGATTTACATGGTCACTTGGCAATTTTTG-3'. (SEQ ID NO: 6)
Reverse oligonucleotide:
5’-AATTCAAAAATTGCCAAGTGACCATGTAAATCTCGAGATTTACATGGTCACTTGGCAA-3’(SEQ ID NO：7)
one embodiment of the invention is a circ-STXBP5L interfering nucleic acid construct, which contains a gene segment for coding shRNA in the nucleic acid molecule and can express the shRNA.
The circ-STXBP5L interfering nucleic acid construct can be obtained by cloning a gene fragment encoding the human circ-STXBP5L shRNA into a known vector.
Further, the circ-STXBP5L interfering nucleic acid construct is a circ-STXBP5L interfering lentiviral vector.
The circ-STXBP5L interference lentiviral vector disclosed by the invention is obtained by cloning a DNA fragment for coding the circ-STXBP5LshRNA into a known vector, wherein the known vector is mostly a lentiviral vector, the circ-STXBP5L interference lentiviral vector is packaged into infectious viral particles through viruses, then small cell lung cancer cells are infected, the shRNA is transcribed, and the siRNA is finally obtained through the steps of enzyme digestion processing and the like and is used for specifically silencing the expression of the circ-STXBP 5L.
Further, the circ-STXBP5L interfering lentivirus vector also contains a promoter sequence and/or a nucleotide sequence coding for a marker which can be detected in the small cell lung cancer cell; preferably, the detectable label is a Green Fluorescent Protein (GFP).
Further, the lentiviral vector may be selected from the group consisting of: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635 pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti 6-GW/U6-laminsham, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, pGCSIL-GFP or pLenti 6.2/N-Lumio/V5-GW/lacZ.
The circ-STXBP5LsiRNA can be used for inhibiting the proliferation of small cell lung cancer cells and further can be used as a medicament or preparation for treating the small cell lung cancer. The circ-STXBP5L interfering lentiviral vector can be used to prepare the circ-STXBP5LsiRNA. When used as a medicament or formulation for treating small cell lung cancer, a safe and effective amount of the nucleic acid molecule is administered to a mammal. The particular dosage will also take into account factors such as the route of administration, the health of the patient, etc., which are within the skill of the skilled practitioner.
One embodiment of the invention is a circ-STXBP5L interfering lentivirus, which is formed by virus packaging of the circ-STXBP5L interfering nucleic acid construct under the assistance of lentivirus packaging plasmids and cell lines. The lentivirus can infect small cell lung cancer cells and generate small interfering RNA aiming at the circ-STXBP5L, thereby inhibiting the proliferation of the small cell lung cancer cells. The circ-STXBP5L interference lentivirus can be used for preparing a medicament for preventing or treating small cell lung cancer.
One embodiment of the present invention is the use of the nucleic acid molecule, or the circ-STXBP5L interfering nucleic acid construct, or the circ-STXBP5L interfering lentivirus, wherein the nucleic acid molecule comprises: is used for preparing a medicament for preventing or treating the small cell lung cancer or a kit for reducing the expression of the circ-STXBP5L in the small cell lung cancer cells.
Nucleic acid molecules that reduce the expression of circ-STXBP5L in small cell lung cancer cells can be utilized; and/or, a circ-STXBP5L interfering nucleic acid construct; and/or, the circ-STXBP5L interferes with the slow virus, and is used as an effective component to prepare a medicament for preventing or treating the small cell lung cancer. Generally, the medicament can comprise one or more pharmaceutically acceptable carriers or auxiliary materials besides the effective components according to the requirements of different dosage forms.
By "pharmaceutically acceptable" is meant that the molecular entities and compositions do not produce adverse, allergic, or other untoward reactions when properly administered to an animal or human.
The "pharmaceutically acceptable carrier or adjuvant" should be compatible with the active ingredient, i.e., capable of being blended therewith without substantially diminishing the effectiveness of the drug under ordinary circumstances. Specific examples of some substances that can serve as pharmaceutically acceptable carriers or adjuvants are sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium methylcellulose, ethylcellulose and methylcellulose; powdered gum tragacanth; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyols such as propylene glycol, glycerol, sorbitol, mannitol and polyethylene glycol; alginic acid; emulsifiers, such as Tween; wetting agents, such as sodium lauryl sulfate; a colorant; a flavoring agent; tabletting agents, stabilizers; an antioxidant; a preservative; pyrogen-free water; isotonic saline solution; and phosphate buffer, and the like. These materials are used as needed to aid in the stability of the formulation or to aid in the enhancement of the activity or its bioavailability or to produce an acceptable mouthfeel or odor upon oral administration.
In the present invention, unless otherwise specified, the pharmaceutical dosage form is not particularly limited, and may be prepared into injection, oral liquid, tablet, capsule, dripping pill, spray, etc., and may be prepared by a conventional method. The choice of the pharmaceutical dosage form should be matched to the mode of administration.
The application of the medicament for preventing or treating the small cell lung cancer provides a method for treating the small cell lung cancer, in particular to a method for preventing or treating the small cell lung cancer in a subject, which comprises the step of administering an effective dose of the medicament to the subject.
Further, when the drug is used for preventing or treating small cell lung cancer in a subject, an effective dose of the drug needs to be administered to the subject. Using this method, the growth, proliferation, recurrence and/or metastasis of the small cell lung cancer is inhibited. Further, at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% fraction of the growth, proliferation, recurrence and/or metastasis of the small cell lung cancer is inhibited.
The subject of the method may be a human.
One embodiment of the present invention is a composition for preventing or treating small cell lung cancer, which comprises the following effective substances:
the aforementioned nucleic acid molecule; and/or, the aforementioned circ-STXBP5L interfering nucleic acid construct; and/or, the aforementioned circ-STXBP5L interfering lentivirus, and a pharmaceutically acceptable carrier, diluent or excipient.
The composition may be a pharmaceutical composition.
When the composition is used for preventing or treating small cell lung cancer in a subject, an effective dose of the composition needs to be administered to the subject. Using this method, the growth, proliferation, recurrence and/or metastasis of the small cell lung cancer is inhibited. Further, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the growth, proliferation, recurrence, and/or metastasis of the small cell lung cancer is inhibited.
The form of the composition is not particularly limited, and may be in the form of various substances such as solid, liquid, gel, semifluid, aerosol, etc.
The subject to which the composition is primarily directed is a mammal. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human.
The research of the invention shows that the circ-STXBP5L is abnormally highly expressed in the small cell lung cancer, while the circ-STXBP5L expression is not detected in the control paracancer tissues of the small cell lung cancer, more interestingly, the circ-STXBP5L expression is not detected in the paracancer tissues of the non-small cell lung cancer, and only 6 of 43 tissues of the non-small cell lung cancer have extremely weak expression. This result suggests that the circular RNA circ-STXBP5L is likely to be a novel diagnostic marker for the differential diagnosis of small cell lung cancer and non-small cell lung cancer.
The invention detects normal human bronchial epithelial cell strains: HBE and BEAS-2B, small cell lung cancer cell line: NCI-H446 and NCI-H1688, non-small cell lung cancer cell lines: a549 H1975, H226 and SK-MES-1, and found that only the small cell lung cancer cell line NCI-H446 could detect the expression of circ-STXBP 5L.
The invention carries out in vitro cell functional research on the circ-STXBP5L gene, designs small molecule interference RNA which specially interferes with the expression of the circ-STXBP5L and does not influence the expression of the parent gene STXBP5L aiming at the cyclization site (target site: TTGCCAAGTGACCATGTAAAT (SEQ ID NO. 4)), and compared with a control cell strain, the small cell lung cancer cell strain for knocking down the circ-STXBP5L gene has obviously slower proliferation speed, therefore, the circ-STXBP5L can be used as a potential target site to be applied to the preparation of the medicine for treating the small cell lung cancer.
The circ-STXBP5L gene and the expression product thereof are used as markers for diagnosing the small cell lung cancer, so that the small cell lung cancer can be diagnosed more accurately and quickly, and the gene serving as a target gene for preparing the medicine for treating the small cell lung cancer provides a new treatment target and a new treatment way for treating the small cell lung cancer.
In the application, the diagnostic reagent for the small cell lung cancer can be prepared particularly for the small cell lung cancer, and the medicine and the method for treating the small cell lung cancer can also be prepared.
The first embodiment is as follows: qRT-PCR reaction detection of circ-STXBP5L gene expression in small cell lung cancer and non-small cell lung cancer tissues
Cancer tissue and tissue samples adjacent to normal cancer
In this example, 20 cases of small cell lung cancer and 43 cases of non-small cell lung cancer patients were used as study subjects, and cancer tissues and tissues beside normal cancer were collected, and 63 samples of lung cancer patients were collected from Nanjing brain Hospital (thoracic academy); the experimental contents were approved by the medical ethics committee of the brain hospital of Nanjing (thoracic area), and all the cases were informed and agreed by the patients.
RNA extraction
1) Tissue treatment:
taking about 10mg of tissue, adding 1ml of Trizol, and homogenizing by a homogenizer; standing for 5 minutes at room temperature; 12000g, centrifuging for 5 minutes and taking the supernatant.
2) Two-phase separation:
200ul of chloroform was added to the supernatant, vortexed for 15 seconds, and allowed to stand at room temperature for 3 minutes. Centrifugation at 12000g for 15 min at 4 ℃ gave a lysate which was seen to separate into three layers: the upper layer is RNA of water phase; the middle layer is DNA, lipid, etc.; the lower layer is cell residue, protein, polysaccharide, etc.
3) RNA precipitation:
transferring the water phase into a new centrifuge tube, adding isopropanol with the same volume as the water phase, uniformly mixing, standing for 10 minutes, centrifuging at 12000g at 4 ℃ for 10 minutes.
4) RNA cleaning:
the supernatant was decanted, 1ml of 75% (v/v) ethanol was added, the mixture was inverted upside down, the pellet was resuspended, and the RNA pellet was washed. Centrifuge at 12000g for 10 min at 4 ℃ and pour off the supernatant. Air-dry for about 15 minutes until the tube wall is free of liquid.
5) Re-solubilization of RNA pellet:
an appropriate volume of DEPC water was added to dissolve the RNA, followed by incubation at 60 ℃ for 10 minutes.
6) And (3) measuring the concentration:
2ul of the DNA fragment was taken out for quantification, and reverse transcription was performed based on the quantification result.
Reverse transcription of cDNA
1) Experimental System
Reaction system of RT-PCR:
Figure BDA0002356929620000121
the circular RNA primer is a reverse primer, and the primer sequence is shown as follows:
SEQ ID NO:2circ-STXBP5L-F GATGAACAAAGGTTTACAGAGCC
SEQ ID NO:3circ-STXBP5L-R CACTAGAAAGACGTTTTCCAGAA
the reverse transcription reaction was carried out according to the recipe in Table 1, the reaction procedure was as follows: 5 minutes at 25 ℃; 15 minutes at 50 ℃;5 minutes at 85 ℃.
qRT-PCR detection of the expression level of circ-STXBP5L
And (2) taking the cDNA extracted and reversely transcribed as a template, performing real-time fluorescence quantitative PCR amplification on the circ-STXBP5L and the beta-actin fragment of the internal reference gene by using the primer in the table 1, calculating the difference delta Ct between the Ct value of the circ-STXBP5L and the Ct value of the beta-actin gene of the internal reference, and quantitatively analyzing the expression level difference of the circ-STXBP5L in the small cell lung cancer tissue and the normal cancer adjacent tissue and the expression level difference of the non-small cell lung cancer tissue and the normal cancer adjacent tissue according to the delta Ct value.
The qRT-PCR reaction system is as follows:
reagent Amount of the composition used
AceQ Qpcr SYBR Green Master Mix 10μl
Primer-F(10μM) 0.4μl
Primer-F(10μM) 0.4μl
cDNA 2μl
Sterilization dH 2 O Make up 20ul
The reaction procedure is as follows: pre-denaturation at 95 ℃ for 20s5min; and (3) amplification reaction: denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 30s, and cycling for 40 times; drawing a dissolution curve: 95 ℃ for 15s,60 ℃ for 1min,95 ℃ for 15s.
Total RNA was digested by the addition of RNaseR at a ratio of 3U/ug, and the effect of RNaseR addition and non-addition on circ-STXBP5L, GAPDH and β -actin was examined by qRT-PCR, and the results are shown in FIG. 3, where RNaseR digestion confirmed that circ-STXBP5L was not sensitive to RNase. RNaseR is an RNase which can digest linear RNA but has no influence on circular RNA, total RNA is digested by RNaseR and then QPCR detection is carried out, and the result shows that the addition and non-addition of RNaseR have no obvious influence on the expression of circ-STXBP5L, but the expression of linear genes GAPDH and beta-actin is obviously reduced after the digestion by RNaseR.
The results of the detection of the expression levels of circ-STXBP5L and beta-actin in the small cell lung cancer and the corresponding cancer-adjacent tissues by qRT-PCR are shown in figure 4, and the results of the detection of the expression of the circ-STXBP5L in 20 pairs of clinical tissue samples of the small cell lung cancer show that the expression of the circ-STXBP5L is not detected in the normal cancer-adjacent tissues, but the expression of the circ-STXBP5L is increased in the cancer tissues.
The results of the detection of the expression levels of circ-STXBP5L and beta-actin in the non-small cell lung cancer and the corresponding paracancer tissues by qRT-PCR are shown in FIG. 5, and the detection of the expression of the circ-STXBP5L in 43 pairs of clinical tissue samples of the non-small cell lung cancer shows that the circ-STXBP5L has weak expression in 6 cancer tissues and the expression is not detected in the paracancer tissues.
The second embodiment: circ-STXBP5L interference lentivirus and stable cell line construction thereof
1. First, the expression of circ-STXBP5L in cell lines was examined
We detected circ-STXBP5L in normal human bronchial epithelial cell lines: HBE and BEAS-2B, small cell lung cancer cell line: NCI-H446 and NCI-H1688, non-small cell lung cancer cell lines: a549 H1975, H226 and SK-MES-1 showed circ-STXBP5L expression, and only the small cell lung cancer cell line NCI-H446 could detect the expression as shown in FIG. 6. Therefore, H446 cells were the subject of the next study.
2. Lentiviral vector construction
We constructed a circ-STXBP5L stably knockdown NCI-H446 cell line (shcirc-STXBP 5L) and a control NCI-H446 cell line (shCTL) using pLKO.1 lentiviral expression system; the target sequences of shcirc-STXBP5L and shCTL that we designed and used are as follows: TTGCCAAGTGACCATGTAAAT (SEQ ID NO: 4) and GCAAGCTGACCCTGAAGTTCAT (SEQ ID NO: 5).
The sequence of shcirc-STXBP5L is:
forward oligonucleotide:
5’-CCGGTTGCCAAGTGACCATGTAAATCTCGAGATTTACATGGTCACTTGGCAATTTTTG-3’(SEQ ID NO：6)
reverse oligonucleotide:
5’-AATTCAAAAATTGCCAAGTGACCATGTAAATCTCGAGATTTACATGGTCACTTGGCAA-3’(SEQ ID NO：7)
the sequence of shCTL is:
forward oligonucleotide:
5’-CCGGGCAAGCTGACCCTGAAGTTCATCTCGAGATGAACTTCAGGGTCAGCTTGCTTTTTG-3’(SEQ ID NO：8)
reverse oligonucleotide:
5’-AATTCAAAAAGCAAGCTGACCCTGAAGTTCATCTCGAGATGAACTTCAGGGTCAGCTTGC-3’(SEQ ID NO：9)
3. lentiviral packages
1) Trypsinizing 293FT cells in logarithmic growth phase, passaging to a 10cm cell culture dish, 37 ℃, 5% CO 2 The culture was carried out overnight in an incubator. The cell density can reach 70% -90% in the next day.
2) Each of the prepared DNA solutions (pLKO.1-shcirc-STXBP 5L vector 3.3. Mu.g, pCMV-dR8.2 dvpr vector 2.5. Mu.g, pCMV-VSVG vector 1. Mu.g) was added to a sterilized centrifuge tube, mixed with the corresponding volume of Opti-MEM, and adjusted to a total volume of 1.5mL.
4) The Lipofectamine 3000 reagent was gently shaken up, and 60. Mu.L of Lipofectamine 3000 reagent was mixed with 1.5mL of Opti-MEM in another tube and incubated for 5 minutes at room temperature.
5) The diluted DNA was mixed with the diluted Lipofectamine 3000, and the mixture was gently inverted and mixed.
6) After mixing, incubation was performed at room temperature for 5 minutes to form a transfection complex of DNA with dilution of Lipofectamine 3000.
7) Transferring the mixture of DNA and Lipofectamine 3000 to 293FT cell culture medium, mixing, and reacting at 37 deg.C and 5% CO 2 Culturing in an incubator.
3. Lentiviral collection and concentration
1) Cell supernatants of 293FT were collected 48 to 72 hours post transfection.
2) Cell debris was removed by centrifugation at 4000g for 10 min at 4 ℃.
3) The supernatant was filtered through a 0.45 μm filter into a 50mL centrifuge tube.
4) A sample of crude viral extract was added to the filter cup (up to 19 mL) and the lid was closed. The filter cups were inserted into the filtrate collection tubes and centrifuged at 5000g for 15 minutes at 4 ℃.
5) And after the centrifugation is finished, the virus concentrated solution is obtained in the filter cup.
6) The virus concentrated solution is subpackaged and stored in virus tubes, and can be stored at 4 ℃ for one week or stored at-80 ℃ for a long time.
4. Lentiviral infection of cells
1) Spreading appropriate amount of cells to be infected (to a density of about 20% on the next day) in six-well culture plate before virus infection, and adding CO at 37 deg.C and 5% 2 The culture was carried out overnight in an incubator.
2) The frozen virus is reconstituted for viral infection and, if necessary, diluted with complete medium to achieve a suitable infection factor. ("MOI =" "" virus titer × volume "/" numbers of cells ")
3) Remove the medium from the cell culture dish, add the virus with the composite corresponding infection coefficient to an EP tube containing 1ml of fresh complete medium, mix gently with a pipette and add to the cell culture dish. (the volume of the medium containing the virus should be controlled as low as possible in order to achieve optimal infection efficiency).
4) 12 hours later, the medium containing the virus was removed, replaced with fresh complete medium, and the cell culture was incubated at 37 ℃ with 5% CO 2 The culture was carried out overnight in an incubator.
5) After 48 hours of lentivirus infection, the complete medium was replaced with fresh medium and 2. Mu.g/ml Puromycin was added and cells stably expressing the gene of interest were selected.
5. Identification of Stable cell lines
Collecting cell extracted RNA, carrying out reverse transcription, carrying out qRT-PCR detection (the same as above), and detecting the knock-down efficiency of the circ-STXBP 5L. As a result, as shown in FIG. 7, the knock-down efficiency of circ-STXBP5L was about 62%.
Example three: determination of cell proliferation capacity of circ-STXBP5L gene knock-down on small cell lung cancer
1) Digesting the circ-STXBP5L stably knocked-down NCI-H446 cells and control cells into single cell suspension, counting, and adjusting the cell concentration to 4 × 10 4 One/ml, divided into 96-well plates, each well having 100. Mu.L, i.e., 4X 10 cells per well 3 And 9 wells were processed each.
2) After the cells adhere to the wall, MTS reagents are added at different time points (24 h, 48h and 72 h) respectively, and the proportion is 1:10, i.e.100. Mu.L of culture medium was added to 10. Mu.L of test medium.
3) After incubation for 1h at 37 ℃, the absorbance at 490nm is detected by an enzyme-linked immunosorbent assay.
FIG. 8 is a schematic diagram showing the cell growth curve after the specific knock-down of the circ-STXBP5L gene in NCI-H446, and it can be seen from FIG. 8 that the proliferation of small cell lung cancer cell lines is slowed down after the expression of the circ-STXBP5L is reduced.
The invention firstly designs a specific primer capable of amplifying the circular RNA, PCR amplifies the circular RNA of the STXBP5L gene, and verifies the accurate cyclization site of the circular RNAcir-STXBP 5L by a first-generation sequencing method. Next, RNaseR degradation experiment was carried out to confirm that the STXBP5L gene expresses a circular RNA molecule consisting of 411 nucleotides and having a closed circular structure. The nucleotide sequence of the circ-STXBP5L is shown as SEQ ID NO. 1.
Furthermore, the invention detects the expression difference of the circ-STXBP5L gene in the small cell lung cancer sample by adopting a fluorescent quantitative PCR method, and the result shows that the circ-STXBP5L gene is abnormally highly expressed in the small cell lung cancer tissue and cannot be detected in the tissue beside the cancer.
Then, the present invention detected the difference in the expression of the circ-STXBP5L gene in the non-small cell lung cancer sample by the fluorescent quantitative PCR method, and as a result, it was revealed that the circ-STXBP5L gene was not expressed in the para-carcinoma tissues, but extremely weakly expressed in a small amount (6/43 cases) of the non-small cell lung cancer tissues. Therefore, the tissue detection kit for detecting the gene expression change can be prepared to be used for diagnosing the small cell lung cancer and can be distinguished from the non-small cell lung cancer.
In addition, we performed in vitro studies of cellular function of the circ-STXBP5L gene. A H446 small-cell lung cancer cell line is infected by a lentivirus of a shRNA sequence specific to a circ-STXBP5L gene sequence to establish a cell line with the stably knocked-down gene. Compared with a control small cell lung cancer cell transfected with an empty vector, the small cell lung cancer cell transfected with the circ-STXBP5L gene shRNA lentivirus has the advantage that the proliferation speed is obviously reduced. Therefore, the circ-STXBP5L gene and the expression product thereof can be used as targets for preparing or screening the medicines for treating the small cell lung cancer.
While the invention has been described with respect to a preferred embodiment, it will be understood by those skilled in the art that the foregoing and other changes, omissions and deviations in the form and detail thereof may be made without departing from the scope of this invention. Those skilled in the art can make various changes, modifications and equivalent arrangements, which are equivalent to the embodiments of the present invention, without departing from the spirit and scope of the present invention, and which may be made by utilizing the techniques disclosed above; meanwhile, any changes, modifications and variations of the above-described embodiments, which are equivalent to those of the technical spirit of the present invention, are within the scope of the technical solution of the present invention.
Sequence listing
<110> Nanjing brain department Hospital
Application of <120> human circ-STXBP5L and related product
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 411
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
accatgtaaa tggacactgc acaagtccaa cttctcagag ttgcagttct ggaaaacgtc 60
tttctagtgc cgatgtttca aaagtaaatc gctggggtcc tggaagacca ccatttcgaa 120
aggcccagtc agcagcctgc atggagattt ctttaccagt tacaacagaa gaaaaccgag 180
aaaattccta taatcgttct agaagctcta gtatctccag tattgacaaa gattctaaag 240
aagcaattac agcactatac ttcatggact cctttgcacg gaaaaatgac tctaccatct 300
ctccttgtct gttcgttgga accagtctgg gaatggtgtt aatcatctcc ttaaacctac 360
cattagcaga tgaacaaagg tttacagagc cagtcatggt attgccaagt g 411
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gatgaacaaa ggtttacaga gcc 23
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cactagaaag acgttttcca gaa 23
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ttgccaagtg accatgtaaa t 21
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gcaagctgac cctgaagttc at 22
<210> 6
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ccggttgcca agtgaccatg taaatctcga gatttacatg gtcacttggc aatttttg 58
<210> 7
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
aattcaaaaa ttgccaagtg accatgtaaa tctcgagatt tacatggtca cttggcaa 58
<210> 8
<211> 60
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ccgggcaagc tgaccctgaa gttcatctcg agatgaactt cagggtcagc ttgctttttg 60
<210> 9
<211> 60
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
aattcaaaaa gcaagctgac cctgaagttc atctcgagat gaacttcagg gtcagcttgc 60

Claims (10)

1. The application of the substance for specifically recognizing the circ-STXBP5L in the preparation of the small cell lung cancer diagnosis product is characterized in that,
the nucleotide sequence of the circ-STXBP5L is shown as SEQ ID NO. 1.
2. Use according to claim 1, wherein the substance which specifically recognizes circ-STXBP5L is selected from a primer pair which specifically amplifies circ-STXBP 5L.
3. The use according to claim 2, wherein the primer pair for the specific amplification of circ-STXBP5L is an upstream primer shown as SEQ ID NO. 2 and a downstream primer shown as SEQ ID NO. 3.
4. A small cell lung cancer diagnostic kit comprises a substance which specifically recognizes circ-STXBP 5L;
the substance for specifically recognizing the circ-STXBP5L is selected from a primer pair for specifically amplifying the circ-STXBP 5L;
the primer pair for specifically amplifying circ-STXBP5L is an upstream primer shown as SEQ ID NO. 2 and a primer shown as SEQ ID NO. 2
A downstream primer represented by NO. 3;
the nucleotide sequence of the circ-STXBP5L is shown as SEQ ID NO. 1.
Use of a circ-STXBP5L inhibitor in the preparation of a product having at least one of the following effects:
treating small cell lung cancer;
inhibiting the proliferation rate of small cell lung cancer cells;
the circ-STXBP5L inhibitor is shRNA;
the shRNA target sequence is shown as SEQ ID NO:4 is shown in the specification;
the nucleotide sequence of the shRNA is shown as SEQ ID NO:6 and SEQ ID NO:7 is shown in the specification;
the nucleotide sequence of the circ-STXBP5L is shown as SEQ ID NO. 1.
6. A nucleic acid molecule for reducing the expression of circ-STXBP5L in small cell lung cancer cells, said nucleic acid molecule being:
shRNA which contains a nucleotide sequence capable of hybridizing with the circ-STXBP 5L;
the nucleotide sequence of the circ-STXBP5L is shown as SEQ ID NO. 1;
the shRNA target sequence is shown as SEQ ID NO:4 is shown in the specification;
the nucleotide sequence of the shRNA is shown as SEQ ID NO:6 and SEQ ID NO: shown in fig. 7.
7. A circ-STXBP5L interfering nucleic acid construct comprising a gene segment encoding the shRNA in the nucleic acid molecule of claim 6 capable of expressing said shRNA.
8. A circ-STXBP5L interfering lentivirus which is virally packaged from the interfering nucleic acid construct of claim 7 with the aid of a lentivirus packaging plasmid, a cell line.
9. The nucleic acid molecule of claim 6, or the circ-STXBP5L interfering nucleic acid construct of claim 7, or the use of the circ-STXBP5L interfering lentivirus of claim 8, being: is used for preparing a medicine for treating the small cell lung cancer or a kit for reducing the expression of the circ-STXBP5L in the small cell lung cancer cell.
10. A composition for treating small cell lung cancer, comprising as active ingredients:
the nucleic acid molecule of claim 6; and/or, the circ-STXBP5L interfering nucleic acid construct of claim 7; and/or, the circ-STXBP5L interfering lentivirus of claim 8, and a pharmaceutically acceptable carrier, diluent or excipient.
CN202010010359.2A 2020-01-06 2020-01-06 Application of human circ-STXBP5L and related product Active CN111020036B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010010359.2A CN111020036B (en) 2020-01-06 2020-01-06 Application of human circ-STXBP5L and related product

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010010359.2A CN111020036B (en) 2020-01-06 2020-01-06 Application of human circ-STXBP5L and related product

Publications (2)

Publication Number Publication Date
CN111020036A CN111020036A (en) 2020-04-17
CN111020036B true CN111020036B (en) 2023-03-28

Family

ID=70198491

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010010359.2A Active CN111020036B (en) 2020-01-06 2020-01-06 Application of human circ-STXBP5L and related product

Country Status (1)

Country Link
CN (1) CN111020036B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112608998A (en) * 2020-12-18 2021-04-06 上海生物芯片有限公司 Application of human MT-ND1 and related product

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018024033A1 (en) * 2016-08-05 2018-02-08 广州永诺生物科技有限公司 Cyclic rna circ-ccny and use thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170298347A1 (en) * 2016-02-03 2017-10-19 Beth Israel Deaconess Medical Center NOVEL FUSION-CIRCULAR RNAs AND USES THEREOF

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018024033A1 (en) * 2016-08-05 2018-02-08 广州永诺生物科技有限公司 Cyclic rna circ-ccny and use thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
has_circ_0121603;无;《circBase》;20150530;第1页 *

Also Published As

Publication number Publication date
CN111020036A (en) 2020-04-17

Similar Documents

Publication Publication Date Title
CN107267625B (en) Application of lncRNA as biomarker in liver cancer diagnosis and treatment
CN107586781B (en) Liver cancer marker lncRNA ENST00000620463.1 and application thereof
CN108004322B (en) Application of lncRNA in diagnosis and/or treatment of lung adenocarcinoma
EP2886122B1 (en) Agent for treating cancer
CN112933112B (en) Application of graphene oxide or regulating and controlling molecule thereof in preparation of medicine for promoting diabetic wound repair
CN111020036B (en) Application of human circ-STXBP5L and related product
CN111172290B (en) MiRNA for diagnosis and treatment of hepatocellular carcinoma
CN104878098A (en) Application and related drugs of human STIM1 gene
US9512425B2 (en) Inhibiting migration of cancer cells
CN107227362B (en) Gene related to liver cancer and application thereof
US20160244755A1 (en) Treating diseases associated with pgc1-alpha by modulating micrornas mir-130a and mir-130b
Long et al. Intergenic CircRNA Circ_0007379 Inhibits Colorectal Cancer Progression by Modulating miR-320a Biogenesis in a KSRP-Dependent Manner
CN110917357B (en) Application of human GSDMB gene and related product
CN110904104B (en) Application of human HIST1H2BK gene and related products
CN110643707B (en) ESCC (persistent resonant cell) -related lncRNA LLNLR-299G3.1 and application thereof
CN107184983B (en) Diagnosis and treatment target for lung adenocarcinoma
CN105861736B (en) Application of miRNA in endometrial cancer diagnosis and treatment
CN105617401B (en) Tumor radiation sensitization and radiation side effect weakening effects of miRNA, implementation method and application
CN113018440B (en) Application of miR-7977 as drug target for inhibiting high-sugar-induced apoptosis of Ad-MSCs
CN103623427A (en) Applications of human USP14 gene and related medicines
CN107723369B (en) Application of SETD1B protein and coding gene thereof in diagnosis and treatment of liver cancer
CN103667430A (en) Application and relevant medicament of nucleotide octamer binding protein expression gene
CN103667422A (en) Use and related medicament of human CUL4B gene
US20230407297A1 (en) Bioengineered wnt5a therapeutics for advanced cancers
CN109628592B (en) Thyroid cancer related marker and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant