CN112608998A

CN112608998A - Application of human MT-ND1 and related product

Info

Publication number: CN112608998A
Application number: CN202011503373.2A
Authority: CN
Inventors: 苏军; 徐祎春; 韩峻松; 周佳菁
Original assignee: SHANGHAI BIOCHIP CO Ltd
Current assignee: SHANGHAI BIOCHIP CO Ltd
Priority date: 2020-12-18
Filing date: 2020-12-18
Publication date: 2021-04-06

Abstract

The invention belongs to the field of biomedical research, and particularly relates to application of human MT-ND1 in preparation of a colorectal cancer treatment product or a colorectal cancer diagnosis product. The invention discovers for the first time that MT-ND1 can be used as a diagnostic marker for diagnosing colorectal cancer, discovers for the first time that the interference of the expression of MT-ND1 can reduce the colorectal cancer, and MT-ND1 can be used as a potential target site to be applied to the preparation of medicaments for treating the colorectal cancer. The MT-ND1 gene and the expression product thereof are used as markers for diagnosing the colorectal cancer, so that the diagnosis of the colorectal cancer is more accurate and rapid, and a new therapeutic target and a new therapeutic approach are provided for treating the colorectal cancer as a target gene for preparing medicaments for treating the colorectal cancer. The invention designs and synthesizes 6 pairs of siRNA aiming at MT-ND1 gene, and the 6 pairs of siRNA can effectively inhibit the expression of MT-ND1 gene; meanwhile, as RNAi technology is mature day by day, siRNA of MT-ND1 gene also provides feasible medicine for treating tumor including colorectal cancer.

Description

Application of human MT-ND1 and related product

Technical Field

The invention belongs to the field of biomedical research, and particularly relates to application of human MT-ND1 and a related product.

Background

Cancer is the second disease of global mortality, and both morbidity and mortality have a significantly rising trend in recent years. Among them, colorectal cancer (carcinosa of colon and recatum) incidence and fatality rate are second only to gastric cancer, esophageal cancer and primary liver cancer among digestive system malignancies. The generation and development of tumor are influenced by genetic factors, environmental factors and other factors, and is a complex pathophysiological process. In 1930, Warburg, a german scientist, suggested that tumor cells could utilize the glycolytic pathway rather than the mitochondrial tricarboxylic acid cycle and oxidative phosphorylation as the major energy source even in the presence of oxygen, a phenomenon known as the Warburg effect. Warburg further suggests that alterations in energy metabolism are closely related to the development and progression of tumors.

In recent years, clinical studies have shown that the abundance, integrity and mutation of mitochondrial DNA (mtDNA) are closely related to the development and progression of tumors, and the main mechanism of this is the alteration affecting energy metabolism of mitochondria. Mitochondrial NADH dehydrogenase subunit 1(mitochondrial NADH dehydrogenase-1, MT-ND1) is taken as a key factor and participates in the first step of oxidative phosphorylation of an electron transfer chain, and the change of the expression of MT-ND1 gene can cause the change of the components of the electron transfer chain, thereby influencing the normal electron flow, influencing the mitochondrial oxidative phosphorylation function and becoming an important effector molecule influencing the occurrence and development of tumors.

Small interfering RNAs (sirnas) are a 19-25 base double-stranded RNA that interferes with post-transcriptional degradation of mRNA of a specific gene expressing a nucleotide sequence complementary thereto, thereby preventing translation, validating gene function and drug targeting. The siRNA medicament enters clinical trials so far, and has the following advantages: the specificity is strong, and the specific gene fragment is targeted; the design is simple and convenient, and the method is almost suitable for all genes; the properties of molecular pharmacology, toxicology, drug metabolism and the like are relatively clear. Therefore, as RNAi pharmaceutical technology matures, siRNA has great potential as a drug.

There is no report on the use of MT-ND1 in the diagnosis or treatment of colorectal cancer.

Disclosure of Invention

In order to overcome the problems in the prior art, the invention aims to provide the application of the human MT-ND1 and a related product.

In order to achieve the above objects and other related objects, the present invention adopts the following technical solutions:

the first aspect of the invention provides the use of human MT-ND1 in the preparation of a product for the treatment of colorectal cancer.

In a second aspect, the invention provides the use of an inhibitor of MT-ND1 in the manufacture of a product having at least one of the following effects:

treating colorectal cancer;

decrease ATP synthesis.

In a third aspect, the present invention provides a nucleic acid molecule for reducing expression of MT-ND1 in a colorectal cancer cell, wherein the nucleic acid molecule is siRNA; the siRNA is selected from any one of MT-ND1-01, MT-ND1-02, MT-ND1-03, MT-ND1-04, MT-ND1-05 and MT-ND 1-06; wherein,

MT-ND1-01 comprises a sense strand sequence shown as SEQ ID NO.1 and an antisense strand sequence shown as SEQ ID NO. 2;

MT-ND1-02 comprises a sense strand sequence shown as SEQ ID NO.3 and an antisense strand sequence shown as SEQ ID NO. 4;

MT-ND1-03 comprises a sense strand sequence as shown in SEQ ID NO.5 and an antisense strand sequence as shown in SEQ ID NO. 6;

MT-ND1-04 comprises a sense strand sequence shown as SEQ ID NO.7 and an antisense strand sequence shown as SEQ ID NO. 8;

MT-ND1-05 comprises a sense strand sequence shown as SEQ ID NO.9 and an antisense strand sequence shown as SEQ ID NO. 10;

MT-ND1-06 comprises a sense strand sequence as shown in SEQ ID NO.11 and an antisense strand sequence as shown in SEQ ID NO. 12.

In a fourth aspect, the invention provides an MT-ND1 interfering nucleic acid construct comprising a gene fragment encoding the aforementioned nucleic acid molecule, capable of expressing said nucleic acid molecule.

The fifth aspect of the invention provides an MT-ND1 interfering virus, which is formed by virus packaging of the interfering nucleic acid construct with the help of virus packaging plasmids and cell lines.

In a sixth aspect, the present invention provides the use of the aforementioned nucleic acid molecule, or the aforementioned MT-ND1 interfering nucleic acid construct, or the aforementioned MT-ND1 interfering virus, wherein: is used for preparing a medicine for treating colorectal cancer or a kit for reducing the expression of MT-ND1 in colorectal cancer cells.

The seventh aspect of the present invention provides a composition for preventing or treating colorectal cancer, which comprises, as active ingredients: the aforementioned nucleic acid molecules; and/or, the aforementioned MT-ND1 interfering nucleic acid construct; and/or the aforementioned MT-ND1 interfering virus, and a pharmaceutically acceptable carrier, diluent or excipient.

The eighth aspect of the invention provides the application of the human MT-ND1 in preparing a colorectal cancer diagnosis product.

The ninth aspect of the invention provides the use of a substance which specifically recognizes MT-ND1 in the preparation of a colorectal cancer diagnostic product.

The tenth aspect of the invention provides a rectal cancer diagnostic kit, which comprises a substance specifically recognizing MT-ND1, wherein the substance specifically recognizing MT-ND1 is selected from a primer specifically amplifying MT-ND 1; the sequence of the primer for specifically amplifying the MT-ND1 is shown as SEQ ID NO.13 and SEQ ID NO. 14.

Compared with the prior art, the invention has the following beneficial effects:

the invention firstly discovers that MT-ND1 can be used as a novel diagnostic marker for distinguishing colorectal cancer and non-colorectal cancer, and MT-ND1 can be used as a potential target site to be applied to the preparation of medicaments for treating colorectal cancer. The MT-ND1 gene and the expression product thereof are used as markers for diagnosing the colorectal cancer, so that the diagnosis of the colorectal cancer is more accurate and rapid, and a new therapeutic target and a new therapeutic approach are provided for treating the colorectal cancer as a target gene for preparing medicaments for treating the colorectal cancer. The invention designs and synthesizes 6 pairs of siRNA aiming at MT-ND1 gene, and the 6 pairs of siRNA can effectively inhibit the expression of MT-ND1 gene; meanwhile, as RNAi technology is mature day by day, siRNA of MT-ND1 gene also provides feasible medicine for treating tumor including colorectal cancer.

Drawings

FIG. 1 detection of RNA expression level of MT-ND1 in colorectal cancer cells and normal intestinal epithelial cells.

FIG. 2siDirect version 2.0 siRNA was designed on-line.

FIG. 3DSIR design siRNA online.

FIG. 4Invitrogen RNAi Designer designs siRNA on-line.

FIG. 5-1 knockdown efficiency of siRNA on LoVo cells (bright field left, fluorescent field right).

FIG. 5-2 knockdown efficiency of siRNA on LoVo cells (histogram).

FIGS. 5-3 knockdown efficiency of siRNA on HT29 cells (bright field on left, fluorescent field on right).

FIGS. 5-4 knockdown efficiency of siRNA on HT29 cells (histogram).

FIG. 6-1 knockdown efficiency of siRNA on SW620 cells (bright field on left, fluorescent field on right).

FIG. 6-2 knockdown efficiency of siRNA on SW620 cells (histogram).

FIG. 7 specific knockdown of siRNA on LoVo cells.

FIG. 8-1 targeting of siRNA-6 knockdown MT-ND1 of LoVo cells, mitochondrial function was impaired and ATP synthesis decreased (left brightfield, right fluorescent field).

FIG. 8-2 targeting of siRNA-6 knockdown MT-ND1 of LoVo cells, mitochondrial function was impaired and ATP synthesis decreased (histogram).

In the drawings, the following are denoted by: p is < 0.001 compared with the control group.

Detailed Description

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts.

One embodiment of the invention provides the use of human MT-ND1 in the preparation of a product for the treatment of colorectal cancer.

The application of the human MT-ND1 in preparing the colorectal cancer treatment product specifically comprises the following steps: MT-ND1 is used as an action object, and the medicine or preparation is screened to find the medicine capable of inhibiting the expression of human MT-ND1 as a candidate medicine for treating colorectal cancer. The MT-ND1 interfering RNA (siRNA) is obtained by screening a human MT-ND1 serving as an action object and can be used as a medicine with the effect of inhibiting colorectal cancer. Besides, MT-ND1 can be used as an object of action, such as an antibody drug, a small molecule drug, or the like.

The colorectal cancer treatment product is a molecule capable of specifically inhibiting the transcription or translation of MT-ND1, or specifically inhibiting the expression or activity of MT-ND1 protein, so that the expression level of MT-ND1 in an organism is reduced, and the purpose of inhibiting colorectal cancer is achieved.

The colorectal cancer treatment product or colorectal cancer diagnosis product prepared by MT-ND1 can be, but is not limited to: nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, polypeptides, proteins, or interfering lentiviruses.

The nucleic acid may be, but is not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA), ribozymes, small interfering RNA produced by endoribonuclease III or short hairpin RNA (shRNA).

The colorectal cancer treatment product is administered in an amount sufficient to reduce transcription or translation of human MT-ND1, or to reduce expression or activity of human MT-ND1 protein. Such that expression of human MT-ND1 is reduced by at least 50%, 80%, 90%, 95% or 99%.

The method for treating the colorectal cancer mainly achieves the treatment purpose by reducing the expression level of the MT-ND1 of the human. Specifically, in treatment, a substance effective in reducing the expression level of human MT-ND1 is administered to a patient.

One embodiment of the invention is the use of an MT-ND1 inhibitor in the preparation of a product having at least one of the following effects:

treating colorectal cancer;

decrease ATP synthesis.

The MT-ND1 inhibitor is a molecule having an inhibitory effect on MT-ND 1. Having inhibitory effects on MT-ND1 include, but are not limited to: inhibit expression or activity of MT-ND 1.

The inhibition of MT-ND1 activity means a decrease in MT-ND1 activity. Preferably, the MT-ND1 activity is reduced by at least 10%, preferably by at least 30%, more preferably by at least 50%, even more preferably by at least 70%, and most preferably by at least 90% compared to the activity prior to inhibition.

The inhibition of the expression of MT-ND1 specifically can be the inhibition of the transcription or translation of MT-ND1, specifically can be the following: so that the gene of MT-ND1 is not transcribed, or the transcription activity of the gene of MT-ND1 is reduced, or the gene of MT-ND1 is not translated, or the translation level of the gene of MT-ND1 is reduced.

The regulation of gene expression of MT-ND1 can be performed by one skilled in the art using conventional methods, such as gene knock-out, homologous recombination, interfering RNA, etc.

The suppression of the gene expression of MT-ND1 can be verified by detecting the expression level by qRT-PCR.

Preferably, MT-ND1 expression is reduced by at least 10%, preferably by at least 30%, more preferably by at least 50%, more preferably by at least 70%, still more preferably by at least 90%, most preferably by no expression of MT-ND1 as compared to the wild type.

The product necessarily comprises the MT-ND1 inhibitor, and the MT-ND1 inhibitor is taken as an effective component of the above effects.

In the product, the effective component for playing the above functions can be only the MT-ND1 inhibitor, and other molecules for playing the above functions can also be contained.

That is, the MT-ND1 inhibitor is the only active ingredient or one of the active ingredients of the product.

The product may be a single component material or a multi-component material.

The form of the product is not particularly limited, and can be various substance forms such as solid, liquid, gel, semifluid, aerosol and the like.

The product is primarily directed to mammals. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human.

Such products include, but are not limited to, pharmaceuticals, nutraceuticals, foods, and the like.

The MT-ND1 inhibitor can be a nucleic acid molecule, an antibody or a small molecule compound.

The small molecule compound means a compound consisting of several or several tens of atoms and having a molecular mass of 1000 or less in the present invention.

As exemplified in the examples herein, the MT-ND1 inhibitor can be a nucleic acid molecule that reduces the expression of MT-ND1 in an organism. Specifically, it may be a double-stranded RNA or shRNA.

One embodiment of the invention is a method of treating colorectal cancer by administering to a subject an inhibitor of MT-ND 1.

The subject may be a mammal. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human.

The subject may be a patient suffering from colorectal cancer or an individual in whom treatment is desired for colorectal cancer.

The MT-ND1 inhibitor can be administered to a subject before, during, or after treatment for colorectal cancer.

One embodiment of the invention is a nucleic acid molecule for reducing expression of MT-ND1 in a colorectal cancer cell, wherein the nucleic acid molecule is siRNA; the siRNA is selected from any one of MT-ND1-01, MT-ND1-02, MT-ND1-03, MT-ND1-04, MT-ND1-05 and MT-ND 1-06; wherein,

In particular, the method comprises the following steps of,

MT-ND1-01：

the sense strand sequence SEQ ID NO.1 is 5'-CCAACCUCCUACUCCUCAUTT-3'

The antisense strand sequence SEQ ID NO.2 is 5'-AUGAGGAGUAGGAGGUUGGTT-3'

MT-ND1-02：

The sense strand sequence SEQ ID NO.3 is 5'-GGGUGAGCAUCAAACUCAATT-3'

The antisense strand sequence SEQ ID NO.4 is 5'-UUGAGUUUGAUGCUCACCCTT-3'

MT-ND1-03：

The sense strand sequence SEQ ID NO.5 is 5'-GCCAUCAUUCUACUAUCAATT-3'

The antisense strand sequence SEQ ID NO.6 is 5'-UUGAUAGUAGAAUGAUGGCTT-3'

MT-ND1-04：

The sense strand sequence SEQ ID NO.7 is 5'-GCUAUAUACAACUACGCAATT-3'

The antisense strand sequence SEQ ID NO.8 is 5'-UUGCGUAGUUGUAUAUAGCTT-3'

MT-ND1-05：

The sense strand sequence SEQ ID NO.9 is 5'-CAAACAUUAUUAUAAUAAATT-3'

The antisense strand sequence SEQ ID NO.10 is 5'-UUUAUUAUAAUAAUGUUUGTT-3'

MT-ND1-06：

The sense strand sequence SEQ ID NO.11 is 5'-CAUUCUACUAUCAACAUUATT-3'

The antisense chain sequence SEQ ID NO.12 is 5' -UAAUGUUGAUAGUAGAAUGTT-3.

Wherein, two hanging basic groups TT composed of deoxynucleosides for preventing in vivo RNA enzyme degradation and improving gene silencing efficiency are hung at the 3' end of the siRNA.

The 3 'end of each group of siRNA sequences is suspended with two dTdT, the structure is not complementary with the mRNA sequence, so that the 3' end of the sense strand is easier to melt, and meanwhile, the TT suspension can prevent RNase degradation and increase the stability in vivo, thereby greatly increasing the silencing efficiency of each group of siRNA.

Wherein, the siRNA contains a nucleotide sequence capable of hybridizing with MT-ND 1;

the siRNA comprises a sense strand and an antisense strand, the sense strand and the antisense strand are complementary to form an RNA dimer, and the sequence of the sense strand is identical to the target sequence in MT-ND 1.

sirnas are intermediates in the RNA interference pathway and are also essential factors. The siRNA is melted into a sense strand and an antisense strand under the action of intracellular RNA helicase, and then the antisense siRNA is combined with endonuclease, exonuclease, helicase and the like to form an RNA-induced silencing complex (RISC). RISC and exogenous gene expressed mRNA homologous region to carry on the specific binding, and RISC has nuclease function, cut mRNA in the binding site, the broken mRNA after cutting is degraded immediately, thus induce the host cell to target the degradation reaction of mRNA. The siRNA not only can guide RISC to cut homologous single-stranded mRNA, but also can be used as a primer to be combined with target RNA and synthesize more new dsRNA under the action of RNA polymerase, and the newly generated dsRNA is cut by Dicer to generate a large amount of siRNA, so that the RNA interference effect is amplified, and finally the target mRNA is completely degraded. The regulation mechanism of siRNA is to target and silence the expression of the corresponding gene through strict complementary pairing, and the siRNA has high specificity and simple synthesis, and becomes a mature technology.

The target sequence in the MT-ND1 is the fragment of MT-ND1 corresponding to the mRNA fragment recognized and silenced by the nucleic acid molecule when the nucleic acid molecule is used for specifically silencing the expression of MT-ND 1.

One embodiment of the invention is an MT-ND1 interfering nucleic acid construct comprising a gene segment encoding the aforementioned nucleic acid molecule capable of expressing the nucleic acid molecule.

The MT-ND1 interfering nucleic acid construct can be obtained by cloning a gene fragment encoding the human nucleic acid molecule into a known vector.

The MT-ND1 interfering nucleic acid construct is obtained by cloning a DNA fragment encoding the nucleic acid molecule into a known vector, and the MT-ND1 interfering nucleic acid construct is packaged into infectious virus particles through viruses, infects organisms, transcribes shRNA, and finally obtains the siRNA through steps of enzyme digestion processing and the like for specifically silencing expression of MT-ND 1.

Further, the MT-ND1 interfering nucleic acid construct vector further comprises a promoter sequence and/or a nucleotide sequence encoding a marker to be detected in an organism; preferably, the detectable label is Green Fluorescent Protein (GFP).

The MT-ND1siRNA can be used for inhibiting colorectal cancer, and further can be used as a medicine or preparation for treating the colorectal cancer. The MT-ND1 interfering nucleic acid construct can be used for preparing the MT-ND1 siRNA. When used as a medicament or formulation for treating colorectal cancer, a safe and effective amount of the nucleic acid molecule is administered to a mammal. The particular dosage will also take into account factors such as the route of administration, the health of the patient, etc., which are within the skill of the skilled practitioner.

One embodiment of the invention is an MT-ND1 interfering virus, which is formed by virus packaging of the MT-ND1 interfering nucleic acid construct under the assistance of virus packaging plasmids and cell lines. The virus can infect organisms and generate small interfering RNA aiming at MT-ND1, thereby inhibiting colorectal cancer. The MT-ND1 interfering virus can be used for preparing medicines for preventing or treating colorectal cancer.

One embodiment of the present invention is the use of the above-mentioned nucleic acid molecule, or the above-mentioned MT-ND1 interfering nucleic acid construct, or the above-mentioned MT-ND1 interfering virus, wherein: for the preparation of a medicament for the treatment of colorectal cancer, or for the preparation of a kit for reducing the expression of MT-ND1 in an organism.

Nucleic acid molecules that reduce expression of MT-ND1 in an organism can be utilized; and/or, an MT-ND1 interfering nucleic acid construct; and/or MT-ND1 interferes virus, and is used as an effective component for preparing a medicament for treating colorectal cancer. Generally, the medicament can comprise one or more pharmaceutically acceptable carriers or auxiliary materials besides the effective components according to the requirements of different dosage forms.

By "pharmaceutically acceptable" is meant that the molecular entities and compositions do not produce adverse, allergic, or other untoward reactions when properly administered to an animal or human.

The "pharmaceutically acceptable carrier or adjuvant" should be compatible with the active ingredient, i.e., capable of being blended therewith without substantially diminishing the effectiveness of the drug under ordinary circumstances. Specific examples of some substances that can serve as pharmaceutically acceptable carriers or adjuvants are sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium methylcellulose, ethylcellulose and methylcellulose; powdered gum tragacanth; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyhydric alcohols such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers, such as Tween; wetting agents, such as sodium lauryl sulfate; a colorant; a flavoring agent; tabletting agents, stabilizers; an antioxidant; a preservative; pyrogen-free water; isotonic saline solution; and phosphate buffer, and the like. These materials are used as needed to aid in the stability of the formulation or to aid in the enhancement of the activity or its bioavailability or to produce an acceptable mouthfeel or odor upon oral administration.

In the present invention, unless otherwise specified, the pharmaceutical dosage form is not particularly limited, and may be prepared into injection, oral liquid, tablet, capsule, dripping pill, spray, etc., and may be prepared by a conventional method. The choice of the pharmaceutical dosage form should be matched to the mode of administration.

The application of the drug for preventing or treating the colorectal cancer provides a method for treating the colorectal cancer, in particular a method for preventing or treating the colorectal cancer in a subject, which comprises the step of administering an effective dose of the drug to the subject.

Further, when the medicament is used for preventing or treating colorectal cancer in a subject, an effective dose of the medicament needs to be administered to the subject. Using this method, the colorectal cancer is inhibited. The subject of the method may be a human.

One embodiment of the present invention is a composition for preventing or treating colorectal cancer, which comprises the following effective substances:

the aforementioned nucleic acid molecules; and/or, the aforementioned MT-ND1 interfering nucleic acid construct; and/or the aforementioned MT-ND1 interfering virus, and a pharmaceutically acceptable carrier, diluent or excipient.

The composition may be a pharmaceutical composition.

When the composition is used for preventing or treating colorectal cancer in a subject, an effective dose of the composition needs to be administered to the subject.

The form of the composition is not particularly limited, and may be in the form of various substances such as solid, liquid, gel, semifluid, aerosol, etc.

The subject to which the composition is primarily directed is a mammal. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human.

One embodiment of the invention provides application of human MT-ND1 in preparing a colorectal cancer diagnosis product.

The MT-ND1 gene and the expression product thereof are used as markers for diagnosing the colorectal cancer, so that the diagnosis of the colorectal cancer is more accurate and rapid, and a new therapeutic target and a new therapeutic approach are provided for treating the colorectal cancer as a target gene for preparing medicaments for treating the colorectal cancer.

In the application, the diagnostic reagent for the colorectal cancer can be prepared particularly for the colorectal cancer, and the medicine and the method for treating the colorectal cancer can also be prepared.

Further, in the application of preparing a colorectal cancer diagnosis product, MT-ND1 is a biomarker.

The application of the human MT-ND1 in preparing the colorectal cancer diagnosis medicine specifically comprises the following steps: the expression product of MT-ND1 is used as a colorectal cancer diagnosis index to be applied to the preparation of colorectal cancer diagnosis medicines.

The expression level of MT-ND1 in serum exosomes of healthy people and colorectal cancer patients is detected by a western blot method. The research finds that: the expression level of MT-ND1 in serum exosomes of colorectal cancer patients is obviously higher than that of healthy people. Suggesting that the expression level of MT-ND1 may become a marker for colorectal cancer diagnosis.

The colorectal cancer diagnosis product is used for judging and diagnosing colorectal cancer.

The colorectal cancer diagnosis product comprises a substance specifically recognizing MT-ND 1.

In one embodiment, the substance that specifically recognizes MT-ND1 is selected from primers that specifically amplify MT-ND 1.

The sequence of the primer for specifically amplifying the MT-ND1 is shown as SEQ ID NO.13 and SEQ ID NO. 14.

It should be noted that the colorectal cancer diagnosis product is not limited to necessarily be in a liquid form.

One embodiment of the invention is the application of a substance specifically recognizing MT-ND1 in preparing a colorectal cancer diagnosis product.

Optionally, in one embodiment, the substance that specifically recognizes MT-ND1 is selected from primers that specifically amplify MT-ND 1.

One embodiment of the present invention is a colorectal cancer diagnosis kit including a substance that specifically recognizes MT-ND 1. The sequence of the primer for specifically amplifying the MT-ND1 is shown as SEQ ID NO.13 and SEQ ID NO. 14.

The invention aims to provide siRNA (small interfering RNA) capable of inhibiting the gene expression of MT-ND 1(mitochondrial NADH dehydrogenase subunit 1) by utilizing RNAi technology, and further provides clinical application of the siRNA.

One embodiment of the invention is a negative control sequence of siRNA for inhibiting MT-ND1 gene expression, wherein the negative control comprises a sense strand sequence shown as SEQ ID NO.15 and an antisense strand sequence shown as SEQ ID NO. 16.

In particular, the sense strand sequence SEQ ID NO.15 is 5'-UUCUCCGAACGAGUCACGUTT-3'

The antisense chain sequence SEQ ID NO.16 is 5' -ACGUGACUCGUUCGGAGAATT-3.

Example 1 MT-ND1 sequence lookup

The complete genome information of human mitochondria (Homo sapiens mitochondrin complete genome, NCBI Reference Sequence: NC-012920.1), the total length of mitochondrial genome (https:// www.ncbi.nlm.nih.gov/nucleotide/NC-012920.1) was found by NCBI (national Center for Biotechnology information) 16569bp, in which the total length of the coding Sequence of MTND1 was truncated 956bp (SEQ ID NO. 17).

MT-ND1 gene sequence (FASTA format):

>NC_012920.1:3307-4262Homo sapiens mitochondrion,complete genome

ATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCTCAACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTCAATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGCAGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACTAATAAGTGGCTCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCATCATGACCCTTGGCCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCTTCGACCTTGCCGAAGGGGAGTCCGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAGGCCCCTTCGCCCTATTCTTCATAGCCGAATACACAAACATTATTATAATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACTCTACACAACATATTTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCCTAGCATTACTTATATGATATGTCTCCATACCCATTACAATCTCCAGCATTCCCCCTCAAACCTA。(SEQ ID NO.17)

example 2 quantitative primer design of mitochondrial Gene MT-ND1 and Synthesis of internal reference 18sRNA

The coding sequence of human mitochondrial MT-ND1 and the 18sRNA sequence were searched by NCBI (national Center for Biotechnology information), primers for quantitative PCR (shown below) were designed using the NCBI platform, specificity was verified by detection, and the available sequence information was finally determined.

Human-18sRNA-F：CAGCCACCCGAGATTGAGCA(SEQ ID NO.18)

Human-18sRNA-R：TAGTAGCGACGGGCGGTGTG(SEQ ID NO.19)

MT-ND1-F1：TTCCTAATGCTTACCGAACGA(SEQ ID NO.13)

MT-ND1-R1：AGAAGAGCGATGGTGAGAGC(SEQ ID NO.14)

Example 3 expression of MT-ND1 in colorectal and normal intestinal epithelial cells

Two strains of human normal colon epithelial cells HCoEpic and FHC cells and colorectal cancer cell strains LoVo, HT29, SW620, HCT-8 and COLO205 are collected, whole cell RNA is extracted by a Trizol method, and cDNA is reversed for later use (reagent: Toyobo; Catalog number: FSQ-101). By real-time fluorescence quantification (instrument: ABI7500 reagent: Thermofisher; Catalog number:: 4368708),

the RNA expression level of MT-ND1 (shown in FIG. 1) in each cell strain was determined using primers shown in SEQ ID NO.13 and SEQ ID NO.14 (SEQ ID NO.18, SEQ ID NO.19 are internal controls). The experimental result shows that the expression level of MT-ND1 in the colorectal cancer cells is higher than that of normal cells.

Example 4 on-line siRNA design of MT-ND1

1) Inputting Fastsa sequence of MT-ND1 through an online design tool siDirect version 2.0(http:// sidirect2.rnai. jp /), automatically generating siRNA candidate sequence (as shown in figure 2) by the system, grading the system step by step, and judging and selecting the target sequence of siRNA by combining the position of the binding site of the candidate sequence. The tool limits the sequence length to 600bp, so that the target sequence needs to be divided into multiple segments or a partial sequence design of interest needs to be intercepted.

2) Inputting a Fasta sequence of MT-ND1 by an online design tool DSIR (Designer of Small interference RNA, http:// biodev.extra.cea.fr/DSIR. php), selecting a Score threshold of 90 and a siRNA length of 19nt, automatically generating siRNA candidate sequences (as shown in figure 3) by a system, grading the system step by step, and determining and selecting target sequences of the siRNA by combining the positions of the binding sites of the candidate sequences.

3) Invitrogen RNAi Designer by on-line design tool

(https://rnaidesigner.thermofisher.com/rnaiexpress/design.do) Inputting the Fasta sequence of MT-ND1, selecting Score threshold of 90 and siRNA length of 19nt, automatically generating siRNA candidate sequence by the system (as shown in figure 4), grading the system step by step, combining the position of the binding site of the candidate sequence, and judging and selecting the target sequence of siRNA.

4) And (3) combining the results of the three siRNA online design tools, selecting a candidate sequence with higher comprehensive score, and covering the candidate siRNA sequences at the upper, middle and lower three sections of the MT-ND1 sequence as much as possible, wherein the siRNA is biosynthesized and subjected to quality inspection by biology.

siRNA-1

Sence：CCAACCUCCUACUCCUCAUTT(SEQ ID NO.1)

Anti-sence：AUGAGGAGUAGGAGGUUGGTT(SEQ ID NO.2)

siRNA-2

Sence：GGGUGAGCAUCAAACUCAATT(SEQ ID NO.3)

Anti-sence：UUGAGUUUGAUGCUCACCCTT(SEQ ID NO.4)

siRNA-3

Sence：GCCAUCAUUCUACUAUCAATT(SEQ ID NO.5)

Anti-sence：UUGAUAGUAGAAUGAUGGCTT(SEQ ID NO.6)

siRNA-4

Sence：GCUAUAUACAACUACGCAATT(SEQ ID NO.7)

Anti-sence：UUGCGUAGUUGUAUAUAGCTT(SEQ ID NO.8)

siRNA-5

Sence：CAAACAUUAUUAUAAUAAATT(SEQ ID NO.9)

Anti-sence：UUUAUUAUAAUAAUGUUUGTT(SEQ ID NO10)

siRNA-6

Sence：CAUUCUACUAUCAACAUUATT(SEQ ID NO.11)

Anti-sence：UAAUGUUGAUAGUAGAAUGTT(SEQ ID NO.12)

Negative control

Sence：UUCUCCGAACGAGUCACGUTT(SEQ ID NO.20)

Anti-sence：ACGUGACUCGUUCGGAGAATT(SEQ ID NO.21)

Example 5 knockdown efficiency detection of target Gene MT-ND1 by siRNA

Two cells, LoVo and HT29, were selected separately, and 50 ten thousand cells/well were plated on a cell culture plate (6-well plate), and 24 hours later, a Lipo3000 transfection experiment (Lipofectamine) was performed^TM3000 transduction Reagent, Thermo, Catalog number: l3000001), dissolving siRNA with DEPC water to the storage concentration of 20uM, and subpackaging, freezing and storing. Culturing the cellsThe whole solution is changed into serum-free medium (2 mL/hole), 16 tubes of 1.5mLEP tubes are taken, 125 mu L of Opti-MEM is added into each tube, 8 tubes of the 16 tubes are added with 5 mu L P3000TM reagent, siRNA (NC, 1-6) and 2 mu g GFP plasmid are added and mixed evenly, 5 mu L lipofectamine (TM) 3000 reagent is added into the other 8 tubes to mix evenly, the Opti-MEM containing siRNA and GFP plasmid is added into the corresponding EP tube containing Lipo3000 after standing for 5min, the mixture is placed in a 37-degree incubator for 25min after mixing evenly and is evenly spread into each hole of a cell plate, the solution is changed for 4-6h, the cell transfection condition is observed after 48 h (as shown in figures 5-1 and 5-3, the cell GFP positive rate under fluorescence and bright field is compared, namely the total number of bright field cells and the number of fluorescence positive cells, the cell number or the fluorescence area ratio is counted, the LoVo cell positive rate is more than 70%, the successful transfection efficiency is shown, HT29 cell transfection efficiency is 40%, indicating successful transfection), RNA was extracted by the Trizol method, and cDNA was inverted for use (reagent: toyobo; catalog number: FSQ-101). The RNA expression level of MT-ND1 (shown in FIGS. 5-2 and 5-4) of each well cell was measured by real-time fluorescence quantification (instrument: ABI7500 reagent: Thermofisher; Catalog number:: 4368708). The experimental result shows that the designed siRNA can realize the knocking-down of genes coded by mitochondria, wherein the knocking-down efficiency of the siRNA-6 is the highest and can reach 44% (LoVo) and 35% (HT29) (compared with a control group, p is less than 0.001).

Example 6 suitability testing for Targeted knockdown of MT-ND1 by siRNA-6

SW620 cells were selected as the study subject, 50 ten thousand cells/well were plated on a cell culture plate (6-well plate), and 24 hours later, lipo3000 transfection experiments (Lipofectamine) were performed^TM3000 transduction Reagent, Thermo, Catalog number: l3000001), dissolving siRNA with DEPC water to the storage concentration of 20uM, and subpackaging, freezing and storing. Changing the culture solution of the cells into serum-free medium (2 mL/hole), taking 4 tubes of 1.5mLEP tubes, adding 125 μ L of Opti-MEM into each tube, taking 2 tubes of the two tubes, adding 5 μ L P3000TM reagent, adding siRNA, mixing, adding 5 μ L lipofectamine (TM) 3000 reagent into the other 2 tubes, mixing, standing for 5min, adding the Opti-MEM containing siRNA into the corresponding EP tube containing lipo3000, mixing, placing in a 37-degree incubator for 25min, uniformly spreading in each hole of a cell plate, changing the solution for 4-6h, and observing the cell transfection condition after 48 h (as shown in figure 6-1, for each hole, observing the cell transfection condition (as shown in figure 6-1)The GFP positive rate of the cells under the fluorescence and the bright field is compared, namely the total number of the bright field cells and the number of the fluorescence positive cells are compared, and the cell number or the fluorescence area ratio is counted; the SW620 cells showed over 70% GFP positivity, indicating successful transfection), RNA was extracted by Trizol method, and cDNA was inverted for use (reagent: toyobo; catalog number: FSQ-101). The RNA expression level of MT-ND1 (shown in FIG. 6-2) of each well cell was measured by real-time fluorescence quantification (instrument: ABI7500 reagent: Thermofisher; Catalog number:: 4368708). The results of the experiments showed that siRNA-6 also had a high knockdown efficiency on SW620 cells of 43% (p < 0.001 compared to the control).

Example 7 specific detection of Targeted knockdown of MT-ND1 by siRNA-6

Using loVo cells as an example, the effect of siRNA-6 on mitochondrial encoded related genes was investigated. Cell culture plates (6-well plates) were plated at 50 million cells/well and 24h later, lipo3000 transfection experiments (Lipofectamine) were performed^TM3000 transduction Reagent, Thermo, Catalog number: l3000001), dissolving siRNA with DEPC water to the storage concentration of 20uM, and subpackaging, freezing and storing. The cell culture medium is completely changed to a serum-free medium (2 mL/well), 4 tubes of 1.5mLEP tubes are taken, 125 mu L of Opti-MEM is added into each tube, 2 tubes of the Opti-MEM are taken, 5 mu L P3000TM reagent is added into 2 tubes, siRNA is added into the tubes, the tubes are mixed, 5 mu L of lipofectamine (TM) 3000 reagent is added into the other 2 tubes, the tubes are mixed, after standing for 5min, the Opti-MEM containing siRNA is added into the corresponding EP tube containing lipo3000, the mixture is placed in a 37-degree incubator for 25min and is uniformly paved into each hole of a cell plate, the solution is changed for 4-6h, RNA is extracted by a Trizol method after 48 h, and cDNA is reversed for later use (reagent: Toyobo; Catalog number: FSQ-101). The RNA expression level of MT-ND1 (shown in FIG. 7) of each well cell was measured by real-time fluorescence quantification (instrument: ABI7500 reagent: Thermofisher; Catalog number:: 4368708). The experimental results show that siRNA-6 has high knocking efficiency on ND1, but has little knocking effect on other mitochondrion encoding genes of the family, and has high specificity (compared with a control group, p is less than 0.001).

Example 8 functional assay for Targeted knockdown of MT-ND1 by siRNA-6

In the case of LoVo cells, cell culture plates (6-well plates) were plated50 ten thousand cells/well, 24h later, lipo3000 transfection experiments (Lipofectamine)^TM3000 transduction Reagent, Thermo, Catalog number: l3000001), dissolving siRNA with DEPC water to the storage concentration of 20uM, and subpackaging, freezing and storing. The cell culture solution is completely changed into a serum-free culture medium (2 mL/hole), 4 tubes of 1.5mLEP tubes are taken, 125 mu L of Opti-MEM is added into each tube, 2 tubes of the Opti-MEM are taken, 5 mu L P3000TM reagent is added into 2 tubes of the Opti-MEM, siRNA is added into the tubes, the tubes are mixed, 5 mu L of lipofectamine TM3000 reagent is added into the tubes of the other tubes, the tubes are kept still for 5min, the Opti-MEM containing the siRNA is added into the corresponding EP tube containing lipo3000, the tubes are placed in a 37-degree incubator for 25min after being mixed, the tubes are uniformly paved into each hole of a cell plate, the solution is changed for 4 to 6 hours, and the cell transfection condition is observed after 48 hours (as shown in figure 8-1, the GFP positive rate of the cells under the fluorescence and the bright field is compared, namely the total number of the bright field cells and the number of the fluorescence positive cells, the cell number or the fluorescence. Cell lysis was collected and the supernatant was collected while measuring the Protein concentration (BCA Protein Quantification Kit, san Francisco, Catalog number: 20201ES76) and the amount of ATP produced (ATPLITE 1step Luminescence Assay System, PerkinElmer, Catalog number: 6016736). The experimental results are shown in FIG. 8-2, which shows that after the siRNA-6 knockdown the mitochondrial-encoded MT-ND1, the synthesis of ATP in cells is seriously influenced, indicating that the mitochondrial function is damaged and the metabolic pattern of tumors is changed (compared with the control group, p is less than 0.001).

While the invention has been described with respect to a preferred embodiment, it will be understood by those skilled in the art that the foregoing and other changes, omissions and deviations in the form and detail thereof may be made without departing from the scope of this invention. Those skilled in the art can make various changes, modifications and equivalent arrangements, which are equivalent to the embodiments of the present invention, without departing from the spirit and scope of the present invention, and which may be made by utilizing the techniques disclosed above; meanwhile, any changes, modifications and variations of the above-described embodiments, which are equivalent to those of the technical spirit of the present invention, are within the scope of the technical solution of the present invention.

Sequence listing

<110> Shanghai biochip Co., Ltd

Application of <120> human MT-ND1 and related product

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccaaccuccu acuccucaut t 21

<210> 2

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

augaggagua ggagguuggt t 21

<210> 3

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gggugagcau caaacucaat t 21

<210> 4

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

uugaguuuga ugcucaccct t 21

<210> 5

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gccaucauuc uacuaucaat t 21

<210> 6

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

uugauaguag aaugauggct t 21

<210> 7

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gcuauauaca acuacgcaat t 21

<210> 8

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

uugcguaguu guauauagct t 21

<210> 9

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

caaacauuau uauaauaaat t 21

<210> 10

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

uuuauuauaa uaauguuugt t 21

<210> 11

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cauucuacua ucaacauuat t 21

<210> 12

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

uaauguugau aguagaaugt t 21

<210> 13

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ttcctaatgc ttaccgaacg a 21

<210> 14

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

agaagagcga tggtgagagc 20

<210> 15

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

uucuccgaac gagucacgut t 21

<210> 16

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

acgugacucg uucggagaat t 21

<210> 17

<211> 956

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

atacccatgg ccaacctcct actcctcatt gtacccattc taatcgcaat ggcattccta 60

atgcttaccg aacgaaaaat tctaggctat atacaactac gcaaaggccc caacgttgta 120

ggcccctacg ggctactaca acccttcgct gacgccataa aactcttcac caaagagccc 180

ctaaaacccg ccacatctac catcaccctc tacatcaccg ccccgacctt agctctcacc 240

atcgctcttc tactatgaac ccccctcccc atacccaacc ccctggtcaa cctcaaccta 300

ggcctcctat ttattctagc cacctctagc ctagccgttt actcaatcct ctgatcaggg 360

tgagcatcaa actcaaacta cgccctgatc ggcgcactgc gagcagtagc ccaaacaatc 420

tcatatgaag tcaccctagc catcattcta ctatcaacat tactaataag tggctccttt 480

aacctctcca cccttatcac aacacaagaa cacctctgat tactcctgcc atcatgaccc 540

ttggccataa tatgatttat ctccacacta gcagagacca accgaacccc cttcgacctt 600

gccgaagggg agtccgaact agtctcaggc ttcaacatcg aatacgccgc aggccccttc 660

gccctattct tcatagccga atacacaaac attattataa taaacaccct caccactaca 720

atcttcctag gaacaacata tgacgcactc tcccctgaac tctacacaac atattttgtc 780

accaagaccc tacttctaac ctccctgttc ttatgaattc gaacagcata cccccgattc 840

cgctacgacc aactcataca cctcctatga aaaaacttcc taccactcac cctagcatta 900

cttatatgat atgtctccat acccattaca atctccagca ttccccctca aaccta 956

<210> 18

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

cagccacccg agattgagca 20

<210> 19

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

tagtagcgac gggcggtgtg 20

<210> 20

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

uucuccgaac gagucacgut t 21

<210> 21

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

acgugacucg uucggagaat t 21

Claims

1. Use of human MT-ND1 in the preparation of a product for the treatment of colorectal cancer.

Use of an MT-ND1 inhibitor for the preparation of a product having at least one of the following effects:

treating colorectal cancer;

decrease ATP synthesis.

3. Use according to claim 2, further comprising one or more of the following features:

1) the MT-ND1 inhibitor is a molecule having an inhibitory effect on MT-ND 1;

2) the MT-ND1 inhibitor is the only effective component or one of the effective components of the product;

3) the MT-ND1 inhibitor is selected from siRNA, an antibody or a small molecule compound.

4. The use according to claim 3, wherein the siRNA is selected from any one of MT-ND1-01, MT-ND1-02, MT-ND1-03, MT-ND1-04, MT-ND1-05 and MT-ND 1-06; wherein,

5. A nucleic acid molecule that reduces expression of MT-ND1 in a colorectal cancer cell, wherein the nucleic acid molecule is a siRNA; the siRNA is selected from any one of MT-ND1-01, MT-ND1-02, MT-ND1-03, MT-ND1-04, MT-ND1-05 and MT-ND 1-06; wherein,

6. The nucleic acid molecule of claim 5, wherein said siRNA has two dangling bases TT consisting of deoxynucleosides pendant from the 3' end for preventing degradation by RNAses in vivo and increasing gene silencing efficiency.

7. An MT-ND1 interfering nucleic acid construct comprising a gene fragment encoding the nucleic acid molecule of claim 5 or 6, capable of expressing said nucleic acid molecule.

8. An MT-ND1 interference virus, which is prepared by virus packaging of the interference nucleic acid construct of claim 7 with the aid of virus packaging plasmid and cell line.

9. The nucleic acid molecule of claim 5 or 6, or the MT-ND1 interfering nucleic acid construct of claim 7, or the use of the MT-ND1 interfering virus of claim 8, for: is used for preparing a medicine for treating colorectal cancer or a kit for reducing the expression of MT-ND1 in colorectal cancer cells.

10. A product for treating colorectal cancer, which contains effective substances of:

the nucleic acid molecule of claim 5 or 6; and/or, the MT-ND1 interfering nucleic acid construct of claim 7; and/or, the MT-ND1 interfering virus of claim 8, and a pharmaceutically acceptable carrier, diluent or excipient.

11. Use of human MT-ND1 in preparing colorectal cancer diagnosis product.

12. The use according to claim 11, further comprising one or more of the following features:

a. in the application of preparing a colorectal cancer diagnosis product, MT-ND1 is a biomarker;

b. the colorectal cancer diagnosis product is used for judging and diagnosing colorectal cancer;

c. the colorectal cancer diagnosis product comprises a substance specifically recognizing MT-ND 1.

13. The use according to claim 12, wherein in feature c, the substance which specifically recognizes MT-ND1 is selected from the group consisting of a primer which specifically amplifies MT-ND 1; the sequence of the primer for specifically amplifying the MT-ND1 is shown as SEQ ID NO.13 and SEQ ID NO. 14.

14. Use of a substance specifically recognizing MT-ND1 in the preparation of a colorectal cancer diagnostic product.

15. The use according to claim 14, wherein the substance specifically recognizing MT-ND1 is selected from the group consisting of a primer specifically amplifying MT-ND 1; the sequence of the primer for specifically amplifying the MT-ND1 is shown as SEQ ID NO.13 and SEQ ID NO. 14.

16. A rectal cancer diagnostic kit, which comprises a substance specifically recognizing MT-ND1, wherein the substance specifically recognizing MT-ND1 is selected from a primer specifically amplifying MT-ND 1; the sequence of the primer for specifically amplifying the MT-ND1 is shown as SEQ ID NO.13 and SEQ ID NO. 14.