CN103623427A - Applications of human USP14 gene and related medicines - Google Patents
Applications of human USP14 gene and related medicines Download PDFInfo
- Publication number
- CN103623427A CN103623427A CN201210313795.2A CN201210313795A CN103623427A CN 103623427 A CN103623427 A CN 103623427A CN 201210313795 A CN201210313795 A CN 201210313795A CN 103623427 A CN103623427 A CN 103623427A
- Authority
- CN
- China
- Prior art keywords
- usp14
- gene
- usp14 gene
- plko
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses applications of human USP14 gene and related medicines, discloses applications of human USP14 gene in tumor treatment, tumor diagnosis and medicine preparation, further constructs human USP14 gene small interfering RNAs, human USP14 gene interfering nucleic acid constructs and human USP14 gene interfering slow viruses and discloses applications thereof. The provided siRNAs or the constructs containing the siRNA sequence and the slow viruses can inhibit the expression of the human USP14 gene specifically, especially the slow viruses, can infect target cells efficiently, inhibit the expression of the USP14 gene in the target cells efficiently, further inhibit the growth of the tumor cells, promote the apoptosis of the tumor cells, and have an important meaning in tumor treatment.
Description
Technical field
The present invention relates to biological technical field, relate more specifically to purposes and the related drugs thereof of people USP14 gene.
Background technology
Go ubiquitination enzyme to mainly contain two large classes, comprise ubiquitin c-terminus hydrolytic enzyme (ubiquitin C-terminal hydrolases, UCH) and ubiquitin-specific processive enzyme (ubiquitin-specific processing proteases, UBP or USP).Go ubiquitination regulatory enzyme to regulate intracellular a series of biochemical reactions; the Growth and Differentiation that comprises cell; tumor forms; cell cycle regulating; (the Ramakrishna S such as transcriptional activation and signal transduction; Suresh B, Baek KH.The role of deubiquitinating enzymes in apoptosis.Cell Mol Life Sci 2011; 68:15-26.Grillari J; Grillari-Voglauer R, Jansen-D ü rr P.Post-translational modification of cellular proteins by ubiquitin and ubiquitin-like molecules:role in cellular senescence and aging.Adv Exp Med Biol 2010; 694:172-196.).
USP14 (Ubiquitin-specific protease 14), also referred to as tRNA guanine glycosyl transferase (tRNA-guanine transglycosylase, TGT) subunit (USP14/TGT60kD) of a 60KD, belong to ubiquitin-specific processive enzyme family, be positioned at human chromosomal 18p11 region (Deshpande KL, Seubert PH, Tillman DM, Farkas WR and Katze JR:Cloning and characterization of cDNA encoding the rabbit tRNA-guanine transglycosylase 60-kilodalton subunit.Arch Biochem Biophys 326:1-7, 1996.).Studies have found that, USP14 has expression in leukaemia and colorectal cancer cells, induces after these cell differentiations, and the expression of USP14 can decline.（Ishiwata S,Katayama J,Shindo H,Ozawa Y,Itoh K and Mizugaki M:Increased expression of queuosine synthesizing enzyme,tRNA-guanine transglycosylase,and queuosine levels in tRNA of leukemic cells.J Biochem 129:13-17,2001.Ishiwata S,Ozawa Y,Katayama J,et al:Elevated expression level of 60-kDa subunit of tRNA-guanine transglycosylase in colon cancer.Cancer Lett 212:113-119,2004.）。The people such as Shinhi find by the method for SABC, in normal large intestine epithelium cell, almost can't detect the expression of USP14, but, in 99 routine patients with colorectal cancer, there is the high expressed that USP14 can be detected in 18 routine patients' Colorectal Carcinoma, and its expression increases (Shenji S along with the increase of pathology grade, Naito Z, ISHIWATA S, et al.Ubiquitin-specific protease 14 expression in colorectal canceris associated with liver and lymph node metastases.Oncology Reports.2006, 15:539-543.).Also studies have found that in addition; USP14 presents high expressed in intrahepatic cholangiocarcinoma tissue samples; and only have very weak expression (Chuensumran U in normal sample; Saelee P; Punyarit P, et al.Ubiquitin-specific Protease 14 Expression Associated with IntrahepaticCholangiocarcinoma Cell Differentiation.Asian Pacific J Cancer Prev.2011; 11:775-779.).More than research prompting, USP14 may participate in generation and the development of colorectal cancer and cancer of biliary duct, is expected to become a new target spot of colorectal cancer and cancer of biliary duct therapy of tumor.
RNA disturbs (RNA interference, RNAi) with the short double-stranded RNA (dsRNA) that nucleotide forms, to carry out PTGS.It can block the expression of specific gene in body efficiently, specifically, cause its degraded, thereby cause the silence of specific gene in organism, making cell show the disappearance of certain gene phenotype, is emerging in recent years a kind of conventional research gene function, the laboratory technique of searching methods for the treatment of diseases.Research shows; length is that the double-stranded RNA of 21-23nt can transcribed and the specific RNAi(Tuschl of the causing T of post-transcriptional level; Zamore PD; Sharp PA, Bartel DP.RNAi:double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23nucleotideintervals.Cell 2000; 101:25-33.).Though tumor patient is through chemotherapy, radiotherapy and Comprehensive Treatment, five year survival rate is still very low, if tumor invasion is intervened with the relevant gene of progress, can open up new way for the treatment of tumor.In recent years, RNAi has become the available strategy of the gene therapy of tumor.The expression that utilizes RNAi technology can suppress the antioncogene, Cell cycle-related genes, anti-apoptosis-related genes etc. of proto-oncogene, sudden change suppresses tumor progression (Uprichard, Susan L.The therapeutic potential of RNA interference.FEBS Letters 2005; 579:5996-6007.).
In order to further investigate the regulatory function of USP14 in tumor occurs, the present invention chooses pulmonary carcinoma and breast cancer cell model, take RNAi as means research USP14 is in pulmonary carcinoma and breast carcinoma generation and developing effect.
Summary of the invention
The object of the invention is to open and people USP14(Ubiquitin-specific protease 14) Therapeutic Method and the medicine of gene-correlation, the RNA of take interference (RNAi) is as means research USP14 gene is in the survival of tumor cell and the effect in apoptotic process.
First aspect present invention, take RNA interference as means, having studied USP14 gene occurs and developing effect in tumor, a kind of method that suppresses or reduce growth of tumour cell, propagation, differentiation and/or survival is disclosed, the method comprises: to tumor cell, use a kind of transcribing or translating of USP14 gene that can specificity suppress, or can suppress the expression of USP14 albumen or the molecule of activity by specificity, with this, come growth, propagation, differentiation and/or the survival of inhibition tumor cell.
Described tumor cell is selected from the tumor cell that its growth is relevant with the expression of USP14 albumen or activity.Preferably, described tumor cell is selected from the arbitrary of pulmonary carcinoma, breast carcinoma.
In the method for described inhibition or reduction growth of tumour cell, propagation, differentiation and/or survival, the amount of application of described molecule is enough to reduce transcribing or translating of USP14 gene, or enough reduces expression or the active dosage of USP14 albumen.Further, the expression of described USP14 gene is at least lowered 50%, 80%, 90%, 95% or 99%.
Described molecule can be selected from but be not limited to: nucleic acid molecules, carbohydrate, lipid, micromolecule chemical drugs, antibody medicine, polypeptide, albumen or interference slow virus.
Described nucleic acid includes but not limited to: siRNA (esiRNA) prepared by antisense oligonucleotide, double-stranded RNA (dsRNA), ribozyme, endoribonuclease III or short hairpin RNA (shRNA).
The information sequence of the promoter sequence that described double-stranded RNA, ribozyme, esiRNA or shRNA contain USP14 gene or USP14 gene.
Further, described double-stranded RNA is siRNA (siRNA).Described siRNA comprises the first chain and the second chain, the complementary common formation RNA dimer of described the first chain and described the second chain, and in the sequence of described the first chain and USP14 gene, 15-27 continuous nucleotide sequence is basic identical.The coded mRNA fragment of described small molecules interference RNA energy specific binding target sequence, and the expression of the reticent people USP14 of specificity gene.
Further, the first chain-ordering of described siRNA and the target sequence in USP14 gene are basic identical.Preferably, the target sequence in described USP14 gene contains the arbitrary sequence in SEQ ID NO:1-5.
When the target sequence in described USP14 gene is the reticent USP14 gene expression of described small molecules interference RNA specificity, with the fragment in the corresponding USP14 gene of mRNA fragment of the described complementary combination of small molecules interference RNA.
Preferably, described USP14 gene source is in people.
First aspect present invention also discloses a kind of people USP14 gene of separation at preparation or screening anti-tumor medicine, or the purposes in preparing diagnosing tumor medicine.
Further, described tumor is selected from the arbitrary of pulmonary carcinoma, breast carcinoma.
Described by separated USP14 gene for the preparation of or screening anti-tumor medicine comprise the content of two aspects: one, using USP14 gene as medicine or preparation for the action target of tumor cell, be applied to prepare anti-tumor medicine or preparation; Its two, using USP14 gene as medicine or preparation for the action target of tumor cell, be applied to screen anti-tumor medicine or preparation.
Described using USP14 gene as medicine or preparation is applied to prepare anti-tumor medicine for the action target of tumor cell or preparation specifically refers to: the target using USP14 gene as RNA interference effect, develop medicine or preparation for tumor cell, thereby can reduce the expression of USP14 gene in tumor cell.
Described using USP14 gene as medicine or preparation is applied to screen anti-tumor medicine for the action target of tumor cell or preparation specifically refers to: using USP14 gene as effective object, medicine or preparation are screened, using to find and can suppress or promote the medicine of people USP14 gene expression as oncotherapy drug candidate.USP14 gene small molecules interference RNA (siRNA) be take people USP14 gene as effective object screening obtains as described in the present invention, can be used as having the medicine of inhibition tumor cell proliferation function.In addition, such as antibody drug, small-molecule drug etc. also can be using USP14 gene and albumen thereof as effective object.
Described by USP14 gene for the preparation of diagnosing tumor medicine, refer to the preparation that is applied to diagnosing tumor medicine using USP14 gene expression product as a diagnosing tumor index.
Described anti-tumor medicine is for suppressing transcribing or translating of USP14 gene by specificity, or can suppress the expression of USP14 albumen or the molecule of activity by specificity, thereby the expression of USP14 gene in reduction tumor cell, reaches the object of propagation, growth, differentiation and/or the survival of inhibition tumor cell.
Described anti-tumor medicine or the diagnosing tumor medicine obtaining by separated USP14 gene preparation or screening includes but not limited to: nucleic acid molecules, carbohydrate, lipid, micromolecule chemical drugs, antibody medicine, polypeptide, albumen or interference slow virus.
Described nucleic acid includes but not limited to: siRNA (esiRNA) prepared by antisense oligonucleotide, double-stranded RNA (dsRNA), ribozyme, endoribonuclease III or short hairpin RNA (shRNA).
The amount of application of described anti-tumor medicine is enough to reduce transcribing or translating of people USP14 gene, or enough reduces expression or the active dosage of people USP14 albumen.So that the expression of people USP14 gene is at least lowered 50%, 80%, 90%, 95% or 99%.
Adopting the method for aforementioned anti-tumor medicine treatment tumor, is mainly by reducing the propagation of the expression inhibition tumor cell of people USP14 gene, to reach the object for the treatment of.Concrete, during treatment, can effectively reduce the administering substances of people USP14 gene expression dose in patient.
Second aspect present invention discloses a kind of separated nucleic acid molecules that reduces USP14 gene expression in tumor cell, and described nucleic acid molecules comprises:
A) double-stranded RNA, in described double-stranded RNA, containing can be under stringent condition and the nucleotide sequence of USP14 gene recombination; Or
B) shRNA, in described shRNA, containing can be under stringent condition and the nucleotide sequence of USP14 gene recombination.
Further, described double-stranded RNA comprises the first chain and the second chain, the complementary common formation RNA dimer of described the first chain and described the second chain, and in the sequence of described the first chain and USP14 gene, 15-27 continuous nucleotide sequence is basic identical.Preferably, in the sequence of described the first chain and USP14 gene, 19-23 continuous nucleotide sequence is basic identical; Better, in the sequence of described the first chain and USP14 gene, 19,20 or 21 continuous nucleotide sequences are basic identical.
Further, described double-stranded RNA comprises the first chain and the second chain, the complementary common formation RNA dimer of described the first chain and described the second chain, and the target sequence in the sequence of described the first chain and USP14 gene is basic identical.
Further, described shRNA comprises positive-sense strand fragment and antisense strand fragment, and the loop-stem structure that connects described positive-sense strand fragment and antisense strand fragment, the sequence of described positive-sense strand fragment and described antisense strand fragment is complementary, and in the sequence of described positive-sense strand fragment and USP14 gene, 15-27 continuous nucleotide sequence is basic identical.Described shRNA can become siRNA (siRNA) and then play the effect of endogenous USP14 gene expression in the reticent tumor cell of specificity after processing.
Further, described shRNA comprises positive-sense strand fragment and antisense strand fragment, and the loop-stem structure that connects described positive-sense strand fragment and antisense strand fragment, the sequence of described positive-sense strand fragment and described antisense strand fragment is complementary, and the target sequence in the sequence of described positive-sense strand fragment and USP14 gene is basic identical.
Target sequence in the first chain of described double-stranded RNA or the positive-sense strand fragment of described shRNA and USP14 gene is basic identical, when the target sequence of described USP14 gene is siRNA for the reticent USP14 gene expression of specificity, by the fragment in the corresponding USP14 gene of mRNA fragment of described siRNA identification silence.
Preferably, arbitrary sequence that the target sequence in described USP14 gene contains SEQ IDNO:1-5.
Further, described USP14 gene source is in people.
The length of described double-stranded RNA the first chain and the second chain is 15-27 nucleotide; Preferably, length is 19-23 nucleotide; Best, length is 19,20 or 21 nucleotide.
Further, described double-stranded RNA is siRNA (siRNA).Further, the sequence of described siRNA the first chain, as shown in SEQ ID NO:17, is specially 5 '-CGCAGAGUUGAAAUAAUGGAA-3 '.
SiRNA shown in SEQ ID NO:17 for take the sequence shown in SEQ ID NO:3 be RNA disturb target sequence design, for a chain of the siRNA of people USP14 gene, another chain i.e. sequence and the complementation of the first chain-ordering of the second chain, and this siRNA can play the effect of endogenous USP14 gene expression in the reticent tumor cell of specificity.
Further, the sequence of the loop-stem structure of described shRNA can be selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU and CCACACC.
Further, the sequence of described shRNA, as shown in SEQ ID NO:18, is specially: 5 '-CGCAGAGUUGAAAUAAUGGAAUUCAAGAGAUUCCAUUAUUUCAACUCUGCG-3 '.
ShRNA can become siRNA after enzyme action processing, and then plays the effect of endogenous people USP14 gene expression in the reticent tumor cell of specificity.
The interference slow virus carrier of genetic fragment of shRNA of the present invention of encoding contains arbitrary sequence and the complementary series thereof in SEQ ID NO:1-5.
Third aspect present invention, discloses a kind of USP14 gene interfere RNA construct, and the genetic fragment of the shRNA in the nucleic acid molecules that contains the separation of the present invention of encoding, can express described shRNA
Described people USP14 gene interfere RNA construct can be the gene fragment clone of the aforementioned people USP14 gene shRNA of coding to be entered to known carrier obtain.Further, described USP14 gene interfere RNA construct is that USP14 gene disturbs slow virus carrier.
It is the DNA fragmentation of the aforementioned USP14 gene shRNA of coding to be cloned into known carrier obtain that USP14 gene of the present invention disturbs slow virus carrier, described known carrier mostly is slow virus carrier, described USP14 gene disturbs slow virus carrier to become after infectious virion through virus packing, infected tumor's cell, and then transcribe out shRNA of the present invention, by steps such as enzyme action processing, finally obtain described siRNA, for the expression of the reticent USP14 gene of specificity.
Further, described USP14 gene disturbs slow virus carrier also to contain the nucleotide sequence of label that can be detected in promoter sequence and/or codes for tumor cell; Preferably, described label that can be detected is as green fluorescent protein (GFP).
Further, described slow virus carrier can be selected from: pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, arbitrary in pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
The embodiment of the present invention has specifically been enumerated and take the people USP14 gene that pGCSIL-GFP is vector construction and disturb slow virus carrier, called after pGCSIL-GFP-USP14-siRNA.
The nucleic acid molecules of separation of the present invention can be used for the medicine of preparation prevention or treatment tumor, and described tumor is pulmonary carcinoma or breast carcinoma.
USP14 gene siRNA of the present invention can be used for the propagation of inhibition tumor cell, further can be as medicine or the preparation for the treatment of tumor.USP14 gene disturbs slow virus carrier to can be used for preparing described USP14 gene siRNA.When the medicine as treatment tumor or preparation, be that the described nucleic acid molecules of safe and effective amount is applied to mammal.Concrete dosage also should be considered the factors such as route of administration, patient health situation, and these are all within skilled practitioners skill.
Fourth aspect present invention, discloses a kind of USP14 gene and has disturbed slow virus, by aforementioned USP14 gene, disturbs slow virus carrier under slow virus packaging plasmid, cell line auxiliary, through virus packing, forms.This slow virus can also produce the small molecules interference RNA for USP14 gene by infected tumor's cell, thereby suppresses the propagation of pulmonary carcinoma or breast cancer tumour cell.This USP14 gene disturbs slow virus to can be used for the medicine of preparation prevention or treatment tumor.
Fifth aspect present invention, disclose a kind of for preventing or treat the pharmaceutical composition of tumor, the nucleic acid molecules that its active substance contains aforesaid separation, USP14 gene interfere RNA construct, and/or USP14 gene disturbs slow virus.
Further, described pharmaceutical composition contains double-stranded RNA described in 1～99wt%, shRNA, USP14 gene interfere RNA construct or USP14 gene and disturbs slow virus, and pharmaceutically acceptable carrier, diluent or excipient.
In preparation during these compositionss, conventionally by active component and mixed with excipients, or with excipient dilution, wrap in can capsule or the carrier that exists of medicine bag form in.When excipient plays diluent, do the used time, it can be that solid, semisolid or fluent material are as the medium of excipient, carrier or active component.Therefore, compositions can be tablet, pill, powder, solution, syrup, sterilizing injecting solution etc.The example of suitable excipient comprises: lactose, glucose, sucrose, sorbitol, mannitol, starch, microcrystalline Cellulose, polyvinylpyrrolidone, cellulose, water, etc.Preparation also can comprise: wetting agent, emulsifying agent, antiseptic (as methyl hydroxybenzoate and propyl ester), sweeting agent etc.
The invention also discloses the application of described pharmaceutical composition in arbitrary anti-tumor medicine of preparation treatment pulmonary carcinoma, breast carcinoma.
The treatment that is applied as tumor of this pharmaceutical composition provides a kind of method, is specially a kind of method of prevention or treatment target in-vivo tumour, comprises the described pharmaceutical composition of effective dose is applied in object.Further, described tumor is selected from pulmonary carcinoma or breast carcinoma.
When described pharmaceutical composition is used for prevention or treatment target in-vivo tumour, the described pharmaceutical composition of effective dose need to be applied in object.Adopt the method, the growth of described tumor, propagation, recurrence and/or shift suppressed.Further, at least 10% of the growth of described tumor, propagation, recurrence and/or transfer, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% part is suppressed.
Sixth aspect present invention, a kind of test kit for reducing the USP14 gene expression in tumor cell is disclosed, described test kit comprises: be present in the nucleic acid molecules of the described separation in container, and USP14 gene interfere RNA construct, and/or described USP14 gene disturbs slow virus.
In sum, the present invention has designed 5 RNAi target sequences for people USP14 gene, build corresponding USP14RNAi carrier, wherein the RNAi carrier pGCSIL-GFP-USP14-siRNA of coded sequence SEQ ID NO:3 can significantly lower USP14 gene in the expression of mRNA level and protein level.Use slow virus (lentivirus, be abbreviated as Lv) as genetic manipulation instrument, carry RNAi carrier pGCSIL-GFP-USP14-siRNA and can the RNAi sequence for USP14 gene efficiently be imported to people's pulmonary carcinoma H1299 cell and MCF-7 Breast Cancer Cell targeting, reduce the expression of USP14 gene, significantly suppress the multiplication capacity of above-mentioned tumor cell.Therefore the USP14 gene silencing of lentivirus mediated is the potential clinical non-operative treatment mode of malignant tumor.
SiRNA provided by the invention or the nucleic acid construct that comprises this siRNA sequence, slow virus can specificity suppress the expression of people USP14 gene, especially slow virus, can efficiently infect target cell, suppress expeditiously the expression of USP14 gene in target cell, and then the growth of inhibition tumor cell, promote apoptosis of tumor cells, significant in oncotherapy.
Accompanying drawing explanation
Fig. 1: pGCSIL-GFP plasmid DNA collection of illustrative plates
Fig. 2: USP14-RNAi slow virus was infected people's pulmonary carcinoma H1299 cell and MCF-7 Breast Cancer Cell after 5 days, and the expression of USP14 mRNA significantly reduces
Fig. 3: USP14-RNAi slow virus was infected people's pulmonary carcinoma H1299 cell after 5 days, caused cell inhibitory effect
Fig. 4: USP14-RNAi slow virus was infected MCF-7 Human Breast Cancer Cells after 5 days, caused cell inhibitory effect
The specific embodiment
The present invention relates to one group of small molecules interference RNA for people USP14 gene (siRNA) sequence, rna interference vector and RNA and disturbed slow virus.Choose people USP14 mRNA coding region sequence as the target site of siRNA, according to the preferred 15-27 of 10-30(continuous in target site, more preferably 19-23) individual base sequence design siRNA target sequence.By gene clone, the nucleic acid construct of the above-mentioned siRNA of construction expression, the slow virus of the above-mentioned siRNA of packaging expression.Cell experiment proves, above-mentioned siRNA sequence can the reticent human tumor cells of specificity in the expression of endogenous USP14 gene.
Inventor finds, adopts after the expression of the USP14 gene of transferring person under RNAi method the propagation of inhibition tumor cell effectively, and this achievement in research shows that USP14 gene is proto-oncogene, can be used as the target spot of oncotherapy.Inventor is further synthetic and tested the multiple siRNA for USP14 gene, filter out the expression that can effectively suppress USP14 and then the siRNA that suppresses people's pulmonary carcinoma H1299 cell and proliferation of MCF-7 cells and growth, completed on this basis the present invention.
The invention provides siRNA (siRNA) sequence of a series of interference people USP14 genes, built can specificity reticent USP14 gene expression slow virus.The present invention studies discovery, for siRNA and the RNAi slow virus of people USP14 gene design, stablizes the expression of also lowering specifically USP14 gene, and effectively suppresses the propagation of human tumor cells.The present invention shows that USP14 gene can promote growth of tumour cell, is expected to become the target spot of early diagnosis of tumor and treatment.And, by the expression of the reticent USP14 gene of RNAi mode, can be used as the effective means that suppresses tumor development.
Mentality of designing of the present invention is:
The present invention screens by the following method and obtains a kind of people USP14 gene RNAi slow virus: from Genbank, transfer people USP14 gene order; Prediction siRNA site; The synthetic effective siRNA sequence for USP14 gene, two ends are containing the double-stranded DNA Oligo of restriction enzyme site cohesive end; After slow virus carrier double digestion, be connected the RNAi plasmid of construction expression USP14 gene siRNA sequence with double-stranded DNA Oligo; RNAi plasmid and slow virus are packed to assistant carrier (Packing Mix， Sigma-aldrich company) the cotransfection HEKC 293T needing, produce recombinant slow virus granule, can make the slow virus of efficient reticent USP14 gene.
Based on said method, the invention provides 5 Effective target sites (specifically as shown in SEQ ID NO:1-5) that disturb USP14 gene, built the slow virus of special interference people USP14 gene.
The present invention simultaneously also discloses a kind of people USP14 gene RNAi slow virus (USP14-RNAi) and preparation and application thereof.
This research is found, utilizes the RNAi method of lentivirus mediated, after reducing the expression of USP14 gene in tumor cell, and the effective propagation of inhibition tumor cell.This research shows, USP14 gene is a proto-oncogene, can promote tumor cell proliferation, in occurring and develop, tumor there is important biological function, USP14 gene can be the target of oncotherapy, and the USP14 gene specific silence of lentivirus mediated can be used as a kind of new tool of oncotherapy.
Below in conjunction with embodiment, further set forth the present invention.Should be understood that embodiment is only for the present invention is described, but not limit the scope of the invention.In embodiment, the experimental technique of unreceipted actual conditions and the reagent of undeclared formula are according to normal condition, as works such as ［ U.S. ］ Sambrook.J; Huang Peitang etc. translate.Molecular cloning test guide, the third edition.Beijing: the condition of the condition described in Science Press 2002 or manufacturer's suggestion is carried out or configures.
1. screening is for the effective siRNA target spot of people USP14 gene
From Genbank, transfer USP14(NM_005151) gene information; Utilize the design software Genechem design of Shanghai JiKai Gene Chemical Technology Co., Ltd for the effective siRNA target spot of USP14 gene.In coded sequence (CDS) region of USP14 gene, every the sequence of 21 bases of an initial acquisition of base, table 1 has been listed wherein 5 effective siRNA target sequences for USP14 gene.
Table 1 targeting is in the siRNA target sequence of people USP14 gene
| SEQ ID NO | | Initiation site | |
| 1 | CCCAAGATTCAGCAGTCAGAT | 2030 | |
| 2 | CCTTGGTAACACTTGTTACAT | 543 | |
| 3 | CGCAGAGTTGAAATAATGGAA | 1663 | |
| 4 | GCAGCCAAATACAAGTGACAA | 1368 | |
| 5 | GCAGCCCTTAGAGATTTGTTT | 676 |
2. the preparation of slow virus carrier
Double-stranded DNA Oligo sequence (table 2) for the synthetic two ends of siRNA target spot (the SEQ ID NO:3 of take is example) containing Age I and EcoR I restriction enzyme site cohesive end; (Shanghai JiKai Gene Chemical Technology Co., Ltd provides, and Fig. 1), makes its linearisation, and agarose gel electrophoresis is identified endonuclease bamhi with Age I and EcoR I restricted enzyme, to act on pGCSIL-GFP carrier.
Table 2 two ends are containing the double-stranded DNA Oligo of Age I and EcoR I restriction enzyme site cohesive end
| 5’ | Neck | Ring | Neck | 3’ | SEQ | ||
| Positive-sense strand | CCGG | CGCAGAGTTGAAATAATGGAA | TTCAAGAGA | TTCCATTATTTCAACTCTGCG | TTTTTG | 6 | |
| Antisense strand | AATTCAAAAA | | TCTCTTGAA | TTCCATTATTTCAACTCTGCG | 7 |
By T4 DNA ligase, by double digestion linearisation, (enzyme action system is as shown in table 4,37 ℃, reaction 1h) the carrier DNA double-stranded DNA Oligo good with purification is connected, and in suitable buffer system (linked system is as shown in table 5), in 16 ℃ of connections, spends the night, and reclaims and connects product.By connecting product, transform fresh competent escherichia coli cell (conversion operation reference: molecular cloning experiment guide second edition 55-56 page) prepared by calcium chloride.
At connection converted product, grow bacterium clone surface and be stained with, be dissolved in 10 μ l LB culture medium, mix and get 1 μ l as template; The upstream and downstream of RNAi sequence in slow virus carrier, design universal PC R primer (forward primer sequence: 5 '-CCTATTTCCCATGATTCCTTCATA-3 ' (SEQ ID NO:10); Downstream primer sequence: 5 '-GTAATACGGTTATCCACGCG-3 ' (SEQ ID NO:11), carries out PCR identification experiment (PCR reaction system is as table 6-1, and reaction condition is as table 6-2).PCR is identified to positive clone checks order and compare of analysis, compare the carrier that correct clone is the expression RNAi for SEQ ID NO:3 target sequence successfully constructing, called after pGCSIL-GFP-USP14-siRNA.
Build pGCSIL-GFP-Scr-siRNA negative control plasmid, negative control siRNA target sequence is 5 '-TTCTCCGAACGTGTCACGT-3 ' (SEQ ID NO:12).While building pGCSIL-GFP-Scr-siRNA negative control plasmid, double-stranded DNA Oligo sequence (table 3) for the synthetic two ends of Scr siRNA target spot containing Age I and EcoR I restriction enzyme site cohesive end, all the other construction methods, authentication method and condition be same pGCSIL-GFP-USP14-siRNA all.
Table 3 two ends are containing the double-stranded DNA Oligo of Age I and EcoR I restriction enzyme site cohesive end
| 5’ | Neck | Ring | Neck | 3’ | SEQ | |
| Positive-sense strand | CCGG | TTCTCCGAACGTGTCACGT | TTCAAGAGA | ACGTGACACGTTCGGAGAA | TTTTTG | 8 |
| Antisense strand | AATTCAAAAA | TTCTCCGAACGTGTCACGT | TCTCTTGAA | ACGTGACACGTTCGGAGAA | 9 |
By T4 DNA ligase by double digestion linearisation (enzyme action system is as shown in table 4,37 ℃, reaction 1h) carrier
Table 4 pGCSIL-GFP plasmid enzyme restriction reaction system
| Reagent | Volume (μ l) |
| PGCSIL-GFP plasmid (1 μ g/ μ l) | 2.0 |
| 10×buffer | 5.0 |
| 100×BSA | 0.5 |
| Age I(10U/μl) | 1.0 |
| EcoR I(10U/μl) | 1.0 |
| dd H 2O | 40.5 |
| Total | 50.0 |
Table 5 carrier DNA and double-stranded double-stranded DNA Oligo coupled reaction system
| Reagent | Positive control (μ l) | From connecting contrast (μ l) | Connection group (μ l) |
| Linearizing carrier DNA (100ng/ μ l) | 1.0 | 1.0 | 1.0 |
| The double-stranded DNA Oligo (100ng/ μ l) of annealing | 1.0 | - | 1.0 |
| 10 * T4 phage DNA ligase buffer | 1.0 | 1.0 | 1.0 |
| T4 phage DNA ligase | 1.0 | 1.0 | 1.0 |
| dd H 2O | 16.0 | 17.0 | 16.0 |
| Total | 20.0 | 20.0 | 20.0 |
Table 6-1PCR reaction system
| Reagent | Volume (μ l) |
| 10×buffer | 2.0 |
| dNTPs(2.5mM) | 0.8 |
| Forward primer | 0.4 |
| Downstream primer | 0.4 |
| Taq polymerase | 0.2 |
| Template | 1.0 |
| ddH 2O | 15.2 |
| Total | 20.0 |
Table 6-2PCR reaction system program setting
3. pack USP14-siRNA slow virus
The DNA that extracts RNAi plasmid pGCSIL-GFP-USP14-siRNA with the plasmid extraction test kit of Qiagen company, is mixed with 100ng/ μ l storage liquid.24h before transfection, with the HEKC 293T cell of trypsinization exponential phase, take that containing the DMEM complete medium of 10% hyclone, to adjust cell density be 1.5 * 10
5cell/ml, is inoculated in 6 orifice plates, and 37 ℃, 5%CO
2in incubator, cultivate.When reaching 70%-80%, cell density can be used for transfection.2h before transfection, the original culture medium of sucking-off, adds the complete medium that 1.5ml is fresh.According to the explanation of the MISSION Lentiviral Packaging Mix test kit of Sigma-aldrich company, in a sterilizing centrifuge tube, add Packing Mix(PVM) 20 μ l, PEI 12 μ l, serum-free DMEM culture medium 400 μ l, get the plasmid DNA of the above-mentioned extracting of 20 μ l, add to above-mentioned PVM/PEI/DMEM mixed liquor.Above-mentioned transfection mixture is at room temperature hatched to 15min, be transferred in the culture medium of HEKC 293T cell, 37 ℃, 5%CO
2in incubator, cultivate 16h.Discard the culture medium that contains transfection mixture, PBS solution washing, adds complete medium 2ml, continues to cultivate 48h.
Collecting cell supernatant, Centricon Plus-20 centrifugal ultrafiltration device (Millipore) purification and concentrated slow virus, step is as follows: (1) 4 ℃, the centrifugal 10min of 4000g, removes cell debris; (2) 0.45 μ m filter filtering supernatant are in 40ml ultracentrifugation pipe; (3) 4000g is centrifugal, and 10-15min, to the concentrated volume of the virus needing; (4) after centrifugal end, filter cup and filtered solution collection cups are below separated, filter cup is tipped upside down on sample collection cup, centrifugal 2min centrifugal force is no more than 1000g; (5) Centrifuge Cup is removed from sample collection cup, in sample collection cup, be viral concentrated solution.By after viral concentrated solution subpackage in-80 degrees Celsius of preservations.The sequence of siRNA the first chain containing in virus concentrated solution is as shown in SEQ ID NO:17.The packaging process of contrast slow virus, with USP14-siRNA slow virus, only replaces pGCSIL-GFP-USP14-siRNA carrier with pGCSIL-GFP-Scr-siRNA carrier.
People's pulmonary carcinoma H1299 cell and MCF-7 Breast Cancer Cell in exponential phase carry out trypsinization, and (cell number is about 5 * 10 to make cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to cell fusion degree and reach approximately 30%.According to infecting plural number (MOI, H1299:10, MCF-7:20) value, add the virus of embodiment 1 preparation of Sq, after cultivation 24h, change culture medium, until time of infection, reach after 5 days collecting cell.According to the Trizol operating instruction of Invitrogen company, extracted total RNA.According to the M-MLV operating instruction of Promega company, RNA reverse transcription is obtained to cDNA(reverse transcription reaction system in Table 7,42 ℃ of reaction 1h, then in 70 ℃ of water-baths, water-bath 10min makes reverse transcriptase inactivation).
Adopt TP800 type Real time PCR instrument (TAKARA) to carry out real-time quantitative detection.The primer of USP14 gene is as follows: forward primer 5 '-ATGCCGCTCTACTCCGTTAC-3 ' (SEQ ID NO:13) and downstream primer 5 '-TGGCTGAGGGTTCTTCTGG-3 ' (SEQ ID NO:14).Take house-keeping gene GAPDH as internal reference, and primer sequence is as follows: forward primer 5 '-TGACTTCAACAGCGACACCCA-3 ' (SEQ ID NO:15) and downstream primer 5 '-CACCCTGTTGCTGTAGCCAAA-3 ' (SEQ ID NO:16).Press the proportional arrangement reaction system in table 8.
Table 7 reverse transcription reaction system
| Reagent | Volume (μ l) |
| 5×RT buffer | 4.0 |
| 10mM dNTPs | 2.0 |
| RNasin | 0.5 |
| M-MLV-RTase | 1.0 |
| DEPC H 2O | 3.5 |
| Total | 11.0 |
Table 8Real-time PCR reaction system
| Reagent | Volume (μ l) |
| SYBR premix ex taq: | 10.0 |
| Forward primer (2.5 μ M): | 0.5 |
| Downstream primer (2.5 μ M): | 0.5 |
| cDNA | 1.0 |
| ddH 2O | 8.0 |
| Total | 20.0 |
Setting program is two-step method Real-time PCR: 95 ℃ of denaturations, 15s; 95 ℃ of each step degeneration afterwards, 5s; Annealing is extended 60 ℃, 30s; Carry out altogether 45 circulations.In the extension stage, read light absorption value at every turn.After PCR finishes, 95 ℃ of degeneration 1min, are then cooled to 55 ℃, make the abundant combination of DNA double chain.Since 55 ℃ to 95 ℃, each step increases by 0.5 ℃, keeps 4s, reads light absorption value simultaneously, makes melting curve.Adopt 2
-Δ Δ Ctanalytic process is calculated the gene expression abundance that has infected USP14 mRNA.Infect the cell of contrast virus (Lv-Scr-siRNA) in contrast.Experimental result (Fig. 2) shows, in people's pulmonary carcinoma H1299 cell and MCF-7 Breast Cancer Cell, the expression of USP14 mRNA has lowered 96.2% and 58.2%.
People's pulmonary carcinoma H1299 cell and MCF-7 Breast Cancer Cell in exponential phase carry out trypsinization, and (cell number is about 5 * 10 to make cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to cell fusion degree and reach approximately 30%.According to infecting plural number (MOI, H1299:20, MCF-7:20), add the virus of Sq, after cultivation 24h, change culture medium, until time of infection, reach after 5 days, collect each experimental group cell in exponential phase.The resuspended one-tenth cell suspension (2 * 10 of complete medium
4/ ml), with cell density, be about 2000/hole, inoculate 96 orifice plates.Every group 5 multiple hole ，Mei hole 100 μ l.Complete after plate, put 37 ℃, 5%CO
2incubator is cultivated.From bed board, second day starts, and detect and read plate once every day with Cellomics instrument (Thermo Fisher), and continuous detecting is read plate 5 days.By adjusting the input parameter of Cellomics arrayscan, calculate exactly the quantity of the cell with green fluorescence in each scanning orifice plate, data are added up to drawing, draw cell proliferation curve (result is as Figure 3-Figure 4).Result shows, slow virus is infected each tumor of group after cells in vitro is cultivated 5 days, and growth rate significantly slows down, far below the growth rate of matched group tumor cell, vigor cell number has declined respectively 98.1% and 84.8%, shows that USP14 gene silencing causes tumor cell proliferation ability suppressed.
The above; it is only preferred embodiment of the present invention; not to any formal and substantial restriction of the present invention; should be understood that; for those skilled in the art; do not departing under the prerequisite of the inventive method, also can make some improvement and supplement, these improvement and supplement and also should be considered as protection scope of the present invention.All those skilled in the art, without departing from the spirit and scope of the present invention, a little change of making when utilizing disclosed above technology contents, the equivalent variations of modifying and developing, be equivalent embodiment of the present invention; Meanwhile, the change of any equivalent variations that all foundations essence technology of the present invention is done above-described embodiment, modification and differentiation, all still belong in the scope of technical scheme of the present invention.
Claims (13)
1. the separated people USP14 gene purposes in arbitrary anti-tumor medicine of preparation or screening pulmonary carcinoma, breast carcinoma.
2. a separated nucleic acid molecules that reduces USP14 gene expression in tumor cell, described nucleic acid molecules comprises:
A) double-stranded RNA, in described double-stranded RNA, containing can be under stringent condition and the nucleotide sequence of USP14 gene recombination; Or
B) shRNA, in described shRNA, containing can be under stringent condition and the nucleotide sequence of USP14 gene recombination.
3. the nucleic acid molecules of separation as claimed in claim 2, it is characterized in that, described double-stranded RNA comprises the first chain and the second chain, the complementary common formation RNA dimer of described the first chain and described the second chain, and the target sequence in the sequence of described the first chain and USP14 gene is basic identical; Described shRNA comprises positive-sense strand fragment and antisense strand fragment, and the loop-stem structure that connects described positive-sense strand fragment and antisense strand fragment, the sequence of described positive-sense strand fragment and described antisense strand fragment is complementary, and the target sequence in the sequence of described positive-sense strand fragment and USP14 gene is basic identical.
4. the nucleic acid molecules of separation as described in claim 2 or 3, is characterized in that, the target sequence of described USP14 gene contains arbitrary sequence in SEQ ID NO:1-5.
5. the nucleic acid molecules of separation as described in claim 2 or 3, is characterized in that, described double-stranded RNA is siRNA, and the sequence of this siRNA the first chain is as shown in SEQ ID NO:17.
6. the nucleic acid molecules of separation as described in claim 2 or 3, is characterized in that, the sequence of described shRNA is as shown in SEQ ID NO:18.
7. a USP14 gene interfere RNA construct, the genetic fragment that contains the shRNA in nucleic acid molecules separated described in the arbitrary claim of coding claim 2-6, can express described shRNA.
8. USP14 gene interfere RNA construct as claimed in claim 7, is characterized in that, described USP14 gene interfere RNA construct is for disturbing slow virus carrier.
9. USP14 gene interfere RNA construct as claimed in claim 8, is characterized in that, described interference slow virus carrier obtains after the gene fragment clone of the described shRNA of coding is entered to slow virus carrier, and described slow virus carrier is selected from:
pLKO.1-puro、pLKO.1-CMV-tGFP、pLKO.1-puro-CMV-tGFP、pLKO.1-CMV-Neo、
pLKO.1-Neo、pLKO.1-Neo-CMV-tGFP、pLKO.1-puro-CMV-TagCFP、
pLKO.1-puro-CMV-TagYFP、pLKO.1-puro-CMV-TagRFP、pLKO.1-puro-CMV-TagFP635、
pLKO.1-puro-UbC-TurboGFP、pLKO.1-puro-UbC-TagFP635、pLKO-puro-IPTG-1xLacO、
pLKO-puro-IPTG-3xLacO、pLP1、pLP2、pLP/VSV-G、pENTR/U6、
pLenti6/BLOCK-iT-DEST、pLenti6-GW/U6-laminshrna、pcDNA1.2/V5-GW/lacZ、
Arbitrary in pLenti6.2/N-Lumio/V5-DEST, pGCSIL-GFP or pLenti6.2/N-Lumio/V5-GW/lacZ.
10. USP14 gene disturbs a slow virus, by disturbing slow virus carrier described in the arbitrary claim of claim 8-9 under slow virus packaging plasmid, cell line auxiliary, through virus packing, forms.
11. 1 kinds for preventing or treat the pharmaceutical composition of tumor, its active substance contains the separated nucleic acid molecules described in the arbitrary claim of claim 2-6, USP14 gene interfere RNA construct described in the arbitrary claim of claim 7-9, and/or USP14 gene claimed in claim 10 disturbs slow virus.
The application of pharmaceutical composition in the anti-tumor medicine of preparation treatment pulmonary carcinoma or breast carcinoma described in 12. claim 11.
13. 1 kinds of test kits for reducing USP14 gene expression in tumor cell, it is characterized in that, described test kit comprises: be present in container, separated nucleic acid molecules described in the arbitrary claim of claim 2-6, USP14 gene interfere RNA construct described in the arbitrary claim of claim 7-9, and/or USP14 gene claimed in claim 10 disturbs slow virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210313795.2A CN103623427B (en) | 2012-08-29 | 2012-08-29 | The purposes and its related drugs of people's USP14 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210313795.2A CN103623427B (en) | 2012-08-29 | 2012-08-29 | The purposes and its related drugs of people's USP14 gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103623427A true CN103623427A (en) | 2014-03-12 |
| CN103623427B CN103623427B (en) | 2019-03-26 |
Family
ID=50205105
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210313795.2A Active CN103623427B (en) | 2012-08-29 | 2012-08-29 | The purposes and its related drugs of people's USP14 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103623427B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108396020A (en) * | 2018-02-02 | 2018-08-14 | 武汉大学 | Application of the D357A or S207/225A mutant of USP2a in inhibiting metastases |
| CN112063718A (en) * | 2020-09-18 | 2020-12-11 | 中国医科大学 | Application of USP14 in diagnosis, prognosis and treatment of liver cancer |
-
2012
- 2012-08-29 CN CN201210313795.2A patent/CN103623427B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| JM FRAILE等: "Deubiquitinases in cancer: new functions and therapeutic options", 《ONCOGENE》 * |
| PÁDRAIG D’ARCY 等: "Proteasome deubiquitinases as novel targets for cancer therapy", 《THE INTERNATIONAL JOURNAL OF BIOCHEMISTRY》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108396020A (en) * | 2018-02-02 | 2018-08-14 | 武汉大学 | Application of the D357A or S207/225A mutant of USP2a in inhibiting metastases |
| CN108396020B (en) * | 2018-02-02 | 2020-10-13 | 武汉大学 | Application of D357A or S207/225A mutant of USP2a in inhibiting tumor metastasis |
| CN112063718A (en) * | 2020-09-18 | 2020-12-11 | 中国医科大学 | Application of USP14 in diagnosis, prognosis and treatment of liver cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103623427B (en) | 2019-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104225617B (en) | The purposes and its related drugs of people's AURKA gene therapy tumours | |
| CN103173529B (en) | Associated use of human NLK (Neuroleukin) gene and associated medicines | |
| CN105586391A (en) | Application of human GTPBP4 gene and related drugs of human GTPBP4 gene | |
| CN104894223B (en) | The purposes and its related drugs of people's COPB2 gene | |
| CN103305596B (en) | The purposes and its related drugs of people's RNF138 genes | |
| CN103656674A (en) | Use of human eIF5B gene and related drug thereof | |
| CN103623427B (en) | The purposes and its related drugs of people's USP14 gene | |
| CN105779576A (en) | Use of human TNFRSF12A gene and related drugs | |
| CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
| CN103667430B (en) | A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene | |
| CN102533982B (en) | The novelty teabag of people KLF8 gene in oncotherapy | |
| CN103157115B (en) | The purposes of people RHBDD1 gene and related drugs thereof | |
| CN103667422A (en) | Use and related medicament of human CUL4B gene | |
| CN104928353A (en) | Applications of human DGKZ gene and related drugs thereof | |
| CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
| CN103667424A (en) | Usage of human EIF3H gene and related medicaments | |
| CN104894224A (en) | Use and related drugs of human CKIP1 gene | |
| CN103623426B (en) | The purposes and its related drugs of people's PPP5C gene | |
| CN104225619A (en) | Application of human ILK gene in curing tumors and related drugs | |
| CN103667431B (en) | A kind of purposes and its related drugs of people CCCH types zinc finger protein expressing gene | |
| CN104225618B (en) | Application of human NLK gene and EGFR gene in curing tumors and related drugs | |
| CN103667423B (en) | The purposes and its related drugs of people's IFITM3 genes | |
| CN103421887B (en) | The purposes and its related drugs of CIT gene | |
| CN107779453A (en) | The purposes and its related drugs of people's TRIP13 genes | |
| CN105803056A (en) | Application of human IARS2 gene and related medicines thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee after: Shanghai Jikai gene Medical Technology Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee before: SHANGHAI GENECHEM Co.,Ltd. |