CN110420328A - SYT14 inhibitor is preparing the purposes in lung cancer therapy drug - Google Patents
SYT14 inhibitor is preparing the purposes in lung cancer therapy drug Download PDFInfo
- Publication number
- CN110420328A CN110420328A CN201910655340.0A CN201910655340A CN110420328A CN 110420328 A CN110420328 A CN 110420328A CN 201910655340 A CN201910655340 A CN 201910655340A CN 110420328 A CN110420328 A CN 110420328A
- Authority
- CN
- China
- Prior art keywords
- syt14
- lung cancer
- inhibitor
- cancer therapy
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Landscapes
- Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention belongs to biological medicine research fields, and in particular to a kind of purposes of SYT14 inhibitor.The present invention after extensive and in-depth study, has found that SYT14 can be used as lung cancer therapy target spot for the first time.SYT14 inhibitor can inhibit the multiplication rate of lung carcinoma cell, inhibit lung carcinoma cell transfer ability, promote Increase Apoptosis of Lung Cancer Cells, inhibit lung carcinoma cell invasion ability, to treat lung cancer, open up new direction for lung cancer therapy.
Description
Technical field
The invention belongs to biological medicine research fields, and in particular to SYT14 inhibitor is in preparing lung cancer therapy drug
Purposes.
Background technique
Primary bronchogenic carcinoma of lung (abbreviation lung cancer) is the highest malignant tumour of disease incidence in recent years, and on its disease incidence
Lifting speed is also in first of various tumours.Although the treatment means of lung cancer are maked rapid progress, 5 years survival rates only 14.1%,
60% patient is dead in 1 year after diagnosis.Chemotherapy is the primary treatments of lung cancer, and 90% or more lung cancer needs receiving
Treat treatment.Chemotherapy is divided into therapeutic chemotherapy and adjuvant chemotherapy.Chemotherapy need to be selected different according to cancerous lung tissue type difference
Chemotherapeutics and different chemotherapy regimens.Chemotherapy also has damage in addition to it can kill tumour cell, to human normal cell.Chemotherapy meeting
Inhibit medulla hematopoietic system, the mainly decline of leucocyte and blood platelet can be small using granulocyte colony stimulating factor and blood
Plate stimulating factor treating.Therefore, we there is an urgent need to find be directed to lung cancer viable therapeutic strategy.
Summary of the invention
In order to overcome the problems of in the prior art, the purpose of the present invention is to provide the new use of SYT14 inhibitor
On the way.
To achieve the goals above and other related purposes, the present invention adopts the following technical scheme:
The first aspect of the present invention provides the purposes that SYT14 inhibitor is used to prepare lung cancer therapy drug.
Further, the lung cancer therapy drug at least has one of following function:
Inhibit the multiplication rate of lung carcinoma cell, inhibits lung carcinoma cell transfer ability, promote Increase Apoptosis of Lung Cancer Cells, inhibit lung cancer
Cell invasion ability.
Further, the SYT14 inhibitor refers to the molecule for having inhibitory effect to SYT14.
Include but is not limited to inhibitory effect for SYT14: inhibiting SYT14 activity, or inhibit SYT14 genetic transcription
Or expression.
The SYT14 inhibitor can be siRNA, shRNA, antibody, small molecule compound.
As the embodiment of the present invention is enumerated, the SYT14 inhibitor can be siRNA or shRNA.The target of the siRNA
The target sequence of sequence or shRNA are as shown in SEQ ID NO:1.Specifically, are as follows: TGTGATATTGGAACCTTCT.
In one embodiment, the nucleotide sequence of the siRNA is as shown in SEQ ID NO:2.Specifically, are as follows:
UGUGAUAUUGGAACCUUCU。
In one embodiment, the nucleotide sequence of the shRNA is as shown in SEQ ID NO:3.Specifically, are as follows: CC
GGCCTGTGATATTGGAACCTTCTCTCGAGAGAAGGTTCCAATATCACAGGTTTTT。
The lung cancer therapy drug necessarily includes SYT14 inhibitor, and using SYT14 inhibitor as the effective of aforementioned function
Ingredient.
In the lung cancer therapy drug, it also may include it that the effective component for playing aforementioned function, which can be only SYT14 inhibitor,
He can play the molecule of aforementioned function.
Also that is, SYT14 inhibitor is one of sole active ingredient or effective component of the lung cancer therapy drug.
The lung cancer therapy drug can be single composition substance, also can be multi-component compound.
The form of the lung cancer therapy drug, can be each for solid, liquid, gel, semi-fluid, aerosol etc. without specifically limited
Kind material form.
The Remedies for lung cancer object mainly for object be mammal, such as rodent, primate.
The second aspect of the present invention provides a kind of method for treating lung cancer, to apply SYT14 inhibitor to object.
The object can be the lung carcinoma cell of mammal or mammal.The mammal is preferably Rodentia
Animal, artiodactylous animals, Perissodactyla animal, Lagomorph, primate etc..The primate is preferably monkey, ape
Or people.The lung carcinoma cell can be Isolated-lung cancer cell.
The object can be the individual of the lung cancer of the patient or Waiting treatment that suffer from lung cancer.Or the object is lung
The in vitro lung carcinoma cell of the individual of cancer patient or Waiting treatment lung cancer.
The SYT14 inhibitor can be applied before, during and after receiving lung cancer therapy to object.
The third aspect of the present invention provides a kind of lung cancer therapy drug, the SYT14 inhibitor including effective dose.
Further, the SYT14 inhibitor refers to the molecule for having inhibitory effect to SYT14.
Include but is not limited to inhibitory effect for SYT14: inhibiting SYT14 activity, or inhibit SYT14 genetic transcription
Or expression.
The SYT14 inhibitor can be siRNA, shRNA, antibody, small molecule compound.
As the embodiment of the present invention is enumerated, the SYT14 inhibitor can be siRNA or shRNA.The target of the siRNA
The target sequence of sequence or shRNA are as shown in SEQ ID NO:1.Specifically, are as follows: TGTGATATTGGAACCTTCT.
In one embodiment, the nucleotide sequence of the siRNA is as shown in SEQ ID NO:2.Specifically, are as follows:
UGUGAUAUUGGAACCUUCU。
In one embodiment, the nucleotide sequence of the shRNA is as shown in SEQ ID NO:3.Specifically, are as follows: CC
GGCCTGTGATATTGGAACCTTCTCTCGAGAGAAGGTTCCAATATCACAGGTTTTT。
The lung cancer therapy drug necessarily includes SYT14 inhibitor, and using SYT14 inhibitor as the effective of aforementioned function
Ingredient.
In the lung cancer therapy drug, it also may include it that the effective component for playing aforementioned function, which can be only SYT14 inhibitor,
He can play the molecule of aforementioned function.
Also that is, SYT14 inhibitor is one of sole active ingredient or effective component of the lung cancer therapy drug.
The lung cancer therapy drug can be single composition substance, also can be multi-component compound.
The form of the lung cancer therapy drug, can be each for solid, liquid, gel, semi-fluid, aerosol etc. without specifically limited
Kind material form.
The Remedies for lung cancer object mainly for object be mammal, such as rodent, primate.
Fourth aspect present invention, provides a kind of lung cancer combination therapy pharmaceutical composition, including a effective amount of SYT14 inhibitor and
Other at least one lung cancer therapy drugs.
The combination therapy pharmaceutical composition can be any one in following form:
One) independent preparation is respectively prepared in SYT14 inhibitor and other lung cancer therapy drugs, the dosage form of preparation can be identical
Or it is different, administration route also may be the same or different.
When other lung cancer therapy drugs are antibody, parenteral type is generally used.When other lung cancer therapy drugs are
When chemicals, form of medication can be relatively abundanter, and can be gastrointestinal administration can also be parenteral administration.It is general to recommend
For the known administration route administration of each chemicals.
Two) SYT14 inhibitor and other lung cancer therapy drugs are configured to compound preparation, by SYT14 inhibitor and its
When his lung cancer therapy drug is simultaneously applied simultaneously using the administration of identical administration route, the shape that the two is configured to compound preparation can be used
Formula.
The fifth aspect of the present invention provides a kind of method for treating lung cancer, inhibits to apply a effective amount of SYT14 to object
Agent and a effective amount of other lung cancer therapy drugs are applied to object and/or implement other lung cancer therapy means to object.
A effective amount of SYT14 inhibitor can concurrently or sequentially be given and other at least one a effective amount of lung cancer are controlled
Treat drug.
Be based on SYT14 present invention firstly discovers that lung cancer therapy target spot, other lung cancer other than with SYT14 inhibitor
In therapeutic agent drug combination, the effect of curative effect addition can be at least played, the therapeutic effect for lung cancer is further enhanced.
Other lung cancer therapy drugs include but is not limited to: antibody drug, chemicals or target medicinal etc..
The SYT14 inhibitor can be gastrointestinal administration or parenteral.Other described lung cancer therapy drugs can
To be gastrointestinal administration or parenteral.For antibody drug, parenteral is generally used.
The sixth aspect of the present invention, providing SYT14 inhibitor in preparation has any one of following or multinomial effect drug
In purposes: inhibit lung carcinoma cell multiplication rate, inhibit lung carcinoma cell transfer ability, promote Increase Apoptosis of Lung Cancer Cells, inhibit lung
Cancer cell invasion ability.
The seventh aspect of the present invention provides SYT14 and is preparing and screening the purposes in lung cancer therapy drug.
In a kind of embodiment, SYT14 is as action target.
In a kind of embodiment, the purposes is specifically referred to: using SYT14 as effective object, sieving to candidate substances
Choosing, to find SYT14 inhibitor, as potential lung cancer therapy drug.
In a kind of embodiment, the purposes is specifically referred to: can reduce lung cancer for SYT14 gene as action target screening
The double-stranded RNA of the expression of SYT14 gene or shRNA are as lung cancer therapy drug in cell.
In a kind of embodiment, the target sequence of the double-stranded RNA or shRNA are as shown in SEQ ID NO:1.
Compared with prior art, the invention has the following beneficial effects:
The present invention after extensive and in-depth study, has found that SYT14 can be used as lung cancer therapy target spot for the first time.SYT14 inhibits
Agent can inhibit the multiplication rate of lung carcinoma cell, inhibit lung carcinoma cell transfer ability, promote Increase Apoptosis of Lung Cancer Cells, inhibit lung carcinoma cell
Invasive ability opens up new direction to treat lung cancer for lung cancer therapy.
Detailed description of the invention
Fig. 1: qPCR detection mRNA level in-site target gene cuts down efficiency.
The abatement that the result that Fig. 2: Celigo cell automatically analyzes discloses SYT14 gene inhibits the proliferation of lung carcinoma cell.(cell
System is H1299 non-small cell lung cancer, is counted respectively to cell quantity within 1,2,3,4 and 5 day after virus infection)
Fig. 3: different time points acquisition experimental group and cellular control unit quantity after virus infection.
The comparison diagram that the variation multiple of Fig. 4: shSYT14 group and control group (shCtrl) cell quantity changes over time.(system
Count the cell number and the cell number ratio calculation of acquisition in first day according to different time points acquisition)
Fig. 5: Transwell experiment display SYT14 abatement influences the transfer ability of H1299 lung carcinoma cell.
Fig. 6: SYT14 processing group metastatic cells number and control group (shCtrl) metastatic cells number ratio Analysis result.
Fig. 7: Transwell experiment display SYT14 abatement influences the invasive ability of H1299 lung carcinoma cell.
Fig. 8: SYT14 processing group invasion cell number and control group (shCtrl) invasion cell number ratio Analysis result.
Fig. 9: the abatement of SYT14 gene is verified to H1299 proliferation of lung cancer cells by detection Caspase3/7 activity
It influences.
The mono- dye Faxian of Figure 10: Annexin V-APC shows that shSYT14 group is withered with control group (shCtrl) H1299 lung carcinoma cell
Die result.(typical case's peak figure when figure shows experimental group and control sample FCM analysis)
The mono- dye method detection shSYT14 group of Figure 11: Annexin V-APC and control group (shCtrl) Apoptosis ratio.
Figure 12: MTT experiment different time points test experience group and control group H1299 lung cancer after virus infection as the result is shown
Cell proliferative conditions.(comparison that microplate reader changes over time the absorptivity of the light of wavelength 490nm, OD490 are reflected herein
Has the quantity of great-hearted cell)
Figure 13: MTT experiment interpretation of result shSYT14 group and control group (shCtrl) competent cell ratio change over time
Comparison diagram.(the competent cell OD490 numerical value and first day competent cell acquired that statistical data is acquired according to different time points
OD490 inatheadearomatizationazone calculates)
In attached drawing,
Column diagram represents the average value tested three times, and error line indicates standard deviation (SD).
*, shCtrl are compared with target gene shRNA slow virus processing group, P < 0.01.
*, shCtrl is compared with target gene shRNA slow virus processing group, 0.01 < P < 0.05.
Specific embodiment
The present invention develops lung cancer gene-correlation information in TCGA database, and further consults lot of documents.Together
When combine the functional genes screening technique such as express spectra variance analysis, high-flux cell screening technique.Finally, possibility is successfully filtered out
The conversion of promotion lung cancer specific oncogenes SYT14, and the gene is not yet further opened in lung cancer field so far
Hair and research.
Then, the present invention confirms effect of the SYT14 gene in lung cancer generation from cell function angle.Pass through structure
Target gene shRNA slow virus is built, slow-virus transfection lung carcinoma cell is compared with transfection control vector slow virus, detection two
The expression of mRNA and protein level target gene in group lung cancer cell line；It is then carried out by cell function experiment thin
The detection such as born of the same parents' proliferation, apoptosis, cell cycle, shRNA group and control group compare as the result is shown, the suppression of shRNA group proliferation of lung cancer cells
Processing procedure degree is apparently higher than control group, and apoptosis rate increase degree is compared with control group height.
According to the studies above as a result, further exploring, exploitation is directed to the diagnoses and treatment new method of the gene, can suffer to lung cancer
The diagnoses and treatment of person provides more more options.
SYT14 inhibitor
Refer to the molecule that there is inhibitory effect for SYT14.Include but is not limited to inhibitory effect for SYT14: inhibiting
SYT14 activity, or inhibit SYT14 genetic transcription or expression.The SYT14 inhibitor include but is not limited to siRNA, shRNA,
Antibody, small molecule compound.
Inhibiting SYT14 activity is that SYT14 vigor is instigated to decline.Preferably, before compared to inhibiting, SYT14 vigor declines at least
10%, at least 30%, then good reduction at least 50% are preferably reduced, more preferably reduces at least 70%, optimal reduction is at least
90%.
Inhibit SYT14 genetic transcription or expression to refer to: transcribing the gene of SYT14 not, or reduces turn of the gene of SYT14
Record activity, or express that the gene of SYT14 not, or reduce the expression activity of the gene of SYT14.
Those skilled in the art can be used conventional method and the genetic transcription or expression of SYT14 be adjusted, such as gene
It knocks out, homologous recombination, RNA interfering etc..
The inhibition of genetic transcription or the expression of SYT14 can detect expression quantity verifying by PCR and Western Blot.
Preferably, compared with wild type, SYT14 genetic transcription or expression reduce at least 10%, preferably reduce at least
30%, then good reduction at least 50%, more preferably reduce at least 70%, and good reduction at least 90%, most preferably SYT14 gene
Absolutely not express.
Small molecule compound
Middle finger of the present invention is made of several or tens atoms, and molecular mass is in 1000 compounds below.
SYT14 inhibitor prepares drug
Lung cancer therapy drug is prepared by one of main active or main active of SYT14 inhibitor.In general, medicine
In object other than effective component, according to the needs of different dosage forms, will also include one or more pharmaceutically acceptable carriers or
Auxiliary material.
" pharmaceutically acceptable " refers to that they will not be produced when biomolecule ontology and composition suitably give animal or people
Raw unfavorable, allergy or other adverse reactions.
" pharmaceutically acceptable carrier or auxiliary material " should be compatible with SYT14 inhibitor, can it is blended without
The effect of pharmaceutical composition is greatly lowered under normal conditions.It can be used as some substances of pharmaceutically acceptable carrier or auxiliary material
Specific example be carbohydrate, such as lactose, dextrose and saccharose；Starch, such as cornstarch and potato starch；Cellulose and its derivative
Object, such as sodium carboxymethylcellulose pyce, ethyl cellulose and methylcellulose；Tragacanth powder；Malt；Gelatin；Talcum；Solid lubrication
Agent, such as stearic acid and magnesium stearate；Calcium sulfate；Vegetable oil, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and can
It can oil；Polyalcohol, such as propylene glycol, glycerol, D-sorbite, mannitol and polyethylene glycol；Alginic acid；Emulsifier, such as Tween；
Wetting agent, such as NaLS；Colorant；Flavoring agent；Tablet agent, stabilizer；Antioxidant；Preservative；Apirogen water；Deng
Seep salting liquid；With phosphate buffer etc..These substances are used to help the stability of formula as needed or help to improve work
Property or its biological effectiveness generate acceptable mouthfeel or smell in the case where oral.
In the present invention, unless stated otherwise, pharmaceutical dosage form is not particularly limited, and can be made into injection, oral solution, piece
The dosage forms such as agent, capsule, dripping pill, spray can be prepared by conventional method.The selection of pharmaceutical dosage form should be with administration mode phase
Match.
Combination therapy pharmaceutical composition and method of administration
The combination therapy pharmaceutical composition can be any one in following form:
One) independent preparation is respectively prepared in SYT14 inhibitor and other lung cancer therapy drugs, the dosage form of preparation can be identical
Or it is different, administration route also may be the same or different.In use, can several medicines use simultaneously, can also several medicines successively use.Successively
When administration, formerly still it should apply other drugs to body in body effective period with drug.
Two) SYT14 inhibitor and other lung cancer therapy drugs are configured to compound preparation, by SYT14 inhibitor and its
When his lung cancer therapy drug is simultaneously applied simultaneously using the administration of identical administration route, the shape that the two is configured to compound preparation can be used
Formula.
The common administrated method of antibody is intravenous injection, intravenous drip or arterial perfusion.Its usage and dosage can refer to existing
Technology.
The common administrated method of small molecule compound can be gastrointestinal administration either parenteral.siRNA,
ShRNA, antibody then generally use parenteral.Can be local administration can also be Formulations for systemic administration.
A effective amount of SYT14 inhibitor can concurrently or sequentially be given and other at least one a effective amount of lung cancer are controlled
Treat drug.
In use, a effective amount of SYT14 inhibitor and other a effective amount of lung cancer therapy drugs can be used simultaneously, it can also
A effective amount of SYT14 inhibitor and other a effective amount of lung cancer therapy drugs are successively used.When consecutive administration, should formerly it use
Drug still applies other drugs to organism in organism effective period.
Before further describing the specific embodiments of the present invention, it should be appreciated that protection scope of the present invention is not limited to down
State specific specific embodiment；It is also understood that term used in the embodiment of the present invention is specific specific in order to describe
Embodiment, rather than limiting the scope of protection of the present invention.The test method of actual conditions is not specified in the following example,
Usually according to normal condition, or according to condition proposed by each manufacturer.
When embodiment provides numberical range, it should be appreciated that except non-present invention is otherwise noted, two ends of each numberical range
Any one numerical value can be selected between point and two endpoints.Unless otherwise defined, the present invention used in all technologies and
Scientific term is identical as the normally understood meaning of those skilled in the art of the present technique.Except specific method, equipment used in embodiment,
Outside material, grasp and record of the invention according to those skilled in the art to the prior art can also be used and this
Any method, equipment and the material of the similar or equivalent prior art of method described in inventive embodiments, equipment, material come real
The existing present invention.
Unless otherwise stated, disclosed in this invention experimental method, detection method, preparation method be all made of this technology neck
Molecular biology, biochemistry, chromatin Structure and the analysis of domain routine, analytical chemistry, cell culture, recombinant DNA technology and
The routine techniques of related fields.
Embodiment 1
(1) experimental method
1, it is prepared for the interference slow virus of SYT14 gene
For SYT14 gene, specific target spot interference sequence is devised, is denoted as shSYT14 for the shRNA of SYT14, institute
The targeted target sequence of shSYT14 is stated as shown in SEQ ID NO:1, specifically: TGTGATATTGGAACCTTCT.ShSYT14 institute
The sequence of corresponding siRNA as shown in SEQ ID NO:2, specifically:
UGUGAUAUUGGAACCUUCU.The sequence of the sh SYT14 itself as shown in SEQ ID NO:3, specifically: C
CGGCCTGTGATATTGGAACCTTCTCTCGAGAGAAGGTTCCAATATCACAGGTTTTT.The target of negative control (shCtrl)
Sequence as shown in SEQ ID NO.4, specifically: TTCTCCGAACGTGTCACGT.
ShRNA interference sequence is designed according to target sequence, is constructed respectively into Hu6-MCS-CMV-EGFP plasmid vector, with
2.0 vector plasmid of 1.0 carrier of pHelper and pHelper, cotransfection 293T cell obtain unpurified in transfection 48-72h
Cell conditioned medium, and the slow virus that purifying concentration obtains high titre is carried out to supernatant.
2, RT-PCR testing goal clpp gene reduction rate
Design of primers is carried out for SYT14 gene.It extracts control group shCtrl and shSYT14 and interferes slow-virus infection group
Cell, extract RNA, reverse transcription acquisition cDNA are detected in H1299 cell using GAPDH as internal reference by RT-PCR respectively
The mRNA expression of SYT14.
3, Celigo cell counting detection cell growth
To H1299 cell carry out slow-virus infection 4 days after, passage be inoculated in 96 orifice plates, bed board for 24 hours after, pass through
Celigo instrument reads the cell of expression EGFP fluorescence and takes pictures, and handles difference in calculating orifice plate by software and organizes other cell number
Mesh draws the growth curve chart of cell, analyzes cell growth status after continuous detection 5 days.
4, Transwell cell migration invasion (cell-free epimatrix (ECM)) detection SYT14 subtractive cdna shifts cell
Influence
After carrying out slow-virus infection 4 days to H1299 cell, being inoculated in upper interior with 5000 cells/well density, (upper chamber is without blood
Clear culture medium, lower room 30%FBS culture medium), 37 DEG C of incubator cultures for a period of time, remove the small non-diverting cell in interior,
After Giemsa dyes 3-5 min, microscope is taken pictures.Group of cells ratio is counted, cell transfer case is analyzed.
5, Transwell cell migration invasion (containing ECM) detection SYT14 subtractive cdna is on transcellular influence
Cell-free epimatrix (ECM) Matrigel method in method reference 4, unique difference are to detect equipment and use to contain ECM
It is tested cell.
6, Caspase3/7 detects influence of the SYT14 subtractive cdna to apoptosis
It is passed on after being carried out slow-virus infection 3 days to H1299 cell, continues culture and detected for 2 days.With 10000 cells/wells
Density be added in 96 orifice plates.Then respectively be added the configured Caspase-Glo reaction solution of 100 ul, be placed on rocker machine with
Revolving speed jog 30 minutes of 300-500 rpm mix.Then it is incubated at room temperature 2 hours according to 18-22 DEG C of cell situation.Use instrument
Measurement signal strength simultaneously carries out data analysis.
7, FACS detects Apoptosis detection
After carrying out slow-virus infection 3 days to H1299 cell, bed board is passed on, after cell fusion degree up to after 85%, digestion is collected
Cell is added Annnexin V-APC dyeing processing, is detected using flow cytometer to cell, and uses guava
InCyte flow cytometry analysis software is analyzed.
8, MTT detects cell viability
After carrying out slow-virus infection 3 days to H1299 cell, passage inoculation is with 96 orifice plates, and bed board number is 2000, bed board
After for 24 hours, the MTT solution of 20 μ L 5mg/ml is added in 4h before culture terminates, and 100 μ L DMSO solutions are added after 4h, carries out microplate reader
Detection.
(2) experimental result
1, SYT14 subtractive cdna efficiency verification
After shRNA slow-virus infection 3 days, in experimental group H1299 cell SYT14 gene mRNA level in-site expression quantity by
To inhibition (Fig. 1).
2, the influence of SYT14 subtractive cdna cell proliferation
As in Figure 2-4, through shRNA slow-virus infection, cell is laid on 96 orifice plates.Celigo is continuously detected 5 days, and discovery is real
A group multiplication rate for H1299 cell is tested to be significantly inhibited.Show proliferative capacity significant phase of the SYT14 gene with H1299 cell
It closes.
3, SYT14 subtractive cdna is on transcellular influence
Transwell cell migration invasion (cell-free epimatrix (ECM) result as seen in figs. 5-6, shRNA slow virus sense
After contaminating for 24 hours, the transfer ability of experimental group H1299 cell is significantly inhibited.Show the transfer of SYT14 gene Yu H1299 cell
The significant correlation of ability.
Transwell cell migration invasion (containing ECM), result was as Figure 7-8, after shRNA slow-virus infection 32h, experiment
The invasive ability of group H1299 cell is significantly inhibited.Show that SYT14 gene is significant related to the invasive ability of H1299 cell.
4, influence of the SYT14 subtractive cdna to apoptosis
Caspase3/7 testing result detects after the 5th day as shown in figure 9, passage in shRNA slow-virus infection the 3rd day, tests
The H1299 cell caspase3/7 activity of group dramatically increases, and shows that SYT14 gene is significant related to the apoptosis of H1299 cell.
FACS testing result as shown in figs. 10-11, passed on after 3 days by shRNA slow-virus infection, detects within the 5th day, experimental group hair
The H1299 cell of raw apoptosis dramatically increases, and shows that SYT14 gene is significant related to the apoptosis of H1299 cell.
5, the influence of SYT14 subtractive cdna cell proliferation
As illustrated by figs. 12-13, after shRNA slow-virus infection 3 days, cell is laid on 96 orifice plates, and bed board number is 2000.Continuously
Detection 5 days, the multiplication rate of experimental group H1299 cell is significantly inhibited.Show the proliferation of SYT14 gene Yu H1299 cell
The significant correlation of ability.
In conclusion the present invention successfully filters out the specific cancer base SYT14 of possible promotion lung carcinoma cell conversion, and
Being tested by cell function confirms its function.
The above, only presently preferred embodiments of the present invention, not to the present invention in any form with substantial limitation,
It should be pointed out that under the premise of not departing from the method for the present invention, can also be made for those skilled in the art
Several improvement and supplement, these are improved and supplement also should be regarded as protection scope of the present invention.All those skilled in the art,
Without departing from the spirit and scope of the present invention, when made using disclosed above technology contents it is a little more
Dynamic, modification and the equivalent variations developed, are equivalent embodiment of the invention；Meanwhile all substantial technologicals pair according to the present invention
The variation, modification and evolution of any equivalent variations made by above-described embodiment, still fall within the range of technical solution of the present invention
It is interior.
Sequence table
<110>the first affiliated hospital, Bengbu Medical College
<120>SYT14 inhibitor is preparing the purposes in lung cancer therapy drug
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
tgtgatattg gaaccttct 19
<210> 2
<211> 19
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ugugauauug gaaccuucu 19
<210> 3
<211> 57
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ccggcctgtg atattggaac cttctctcga gagaaggttc caatatcaca ggttttt 57
<210> 4
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ttctccgaac gtgtcacgt 19
Claims (12)
1.SYT14 inhibitor is used to prepare the purposes of lung cancer therapy drug.
2. purposes according to claim 1, which is characterized in that the lung cancer therapy drug at least have following function it
One: inhibiting the multiplication rate of lung carcinoma cell, inhibit lung carcinoma cell transfer ability, promote Increase Apoptosis of Lung Cancer Cells, inhibit lung carcinoma cell
Invasive ability.
3. purposes according to claim 1 or 2, which is characterized in that the SYT14 inhibitor, which refers to, has suppression to SYT14
The molecule of effect processed.
4. purposes described in -3 any claims according to claim 1, which is characterized in that the SYT14 inhibitor is selected from
SiRNA, shRNA, antibody or small molecule compound.
5. purposes according to claim 4, which is characterized in that shRNA the or siRNA target sequence such as SEQ ID NO:1
It is shown.
6. purposes according to claim 4 or 5, which is characterized in that the nucleotide sequence of the siRNA such as SEQ ID NO:
Shown in 2, and/or, the nucleotide sequence of the shRNA is as shown in SEQ ID NO:3.
7. purposes according to any claim from 1 to 6, which is characterized in that the SYT14 inhibitor is described
One of the sole active ingredient of lung cancer therapy drug or effective component.
8. a kind of lung cancer therapy drug, the SYT14 inhibitor including effective dose.
9. lung cancer therapy drug according to claim 8, which is characterized in that the SYT14 inhibitor is that the lung cancer is controlled
Treat one of sole active ingredient or the effective component of drug.
10. a kind of lung cancer combination therapy pharmaceutical composition, including a effective amount of SYT14 inhibitor and other at least one lung cancer therapies
Drug.
11.SYT14 inhibitor has the purposes in any one of following or multinomial effect drug in preparation: inhibiting lung carcinoma cell
Multiplication rate inhibits lung carcinoma cell transfer ability, promotes Increase Apoptosis of Lung Cancer Cells, inhibits lung carcinoma cell invasion ability.
12.SYT14 is preparing and is screening the purposes in lung cancer therapy drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910655340.0A CN110420328B (en) | 2019-07-19 | 2019-07-19 | Application of SYT14 inhibitor in preparation of medicine for treating lung cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910655340.0A CN110420328B (en) | 2019-07-19 | 2019-07-19 | Application of SYT14 inhibitor in preparation of medicine for treating lung cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110420328A true CN110420328A (en) | 2019-11-08 |
| CN110420328B CN110420328B (en) | 2021-10-29 |
Family
ID=68411169
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910655340.0A Active CN110420328B (en) | 2019-07-19 | 2019-07-19 | Application of SYT14 inhibitor in preparation of medicine for treating lung cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110420328B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080108641A1 (en) * | 2006-02-08 | 2008-05-08 | Ajami Alfred M | Compounds for treating inflammatory disorders, demyelinating disdorders and cancers |
| CN101622349A (en) * | 2006-12-08 | 2010-01-06 | 奥斯瑞根公司 | miR-20 regulated genes and pathways as targets for therapeutic intervention |
| CN103080314A (en) * | 2010-09-30 | 2013-05-01 | 独立行政法人国立精神·神经医疗研究中心 | Inhibitor of expression of dominantly mutated gene |
-
2019
- 2019-07-19 CN CN201910655340.0A patent/CN110420328B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080108641A1 (en) * | 2006-02-08 | 2008-05-08 | Ajami Alfred M | Compounds for treating inflammatory disorders, demyelinating disdorders and cancers |
| CN101622349A (en) * | 2006-12-08 | 2010-01-06 | 奥斯瑞根公司 | miR-20 regulated genes and pathways as targets for therapeutic intervention |
| CN103080314A (en) * | 2010-09-30 | 2013-05-01 | 独立行政法人国立精神·神经医疗研究中心 | Inhibitor of expression of dominantly mutated gene |
Non-Patent Citations (1)
| Title |
|---|
| BIN SHENG等: "RNAi-mediated SYT14 knockdown inhibits the growth of human glioma cell", 《BRAIN RESEARCH BULLETIN》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110420328B (en) | 2021-10-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108179194A (en) | A kind of tumor cells marker circBIRC6 and its inhibitor and purposes | |
| CN107569488A (en) | Application and its medicine of the rutaecarpin in osteosporosis resistant medicament is prepared | |
| CN117257782A (en) | Application of melitracin in reversing Oritinib resistance | |
| CN108236722A (en) | Purposes of the IDNK inhibitor in cancer treatment drug is prepared | |
| CN110420328A (en) | SYT14 inhibitor is preparing the purposes in lung cancer therapy drug | |
| CN108743577A (en) | A kind of pharmaceutical composition of anti-tamoxifen drug resistance breast cancer | |
| CN108653737A (en) | Purposes of the MTHFD1L inhibitor in preparing Dendritic cell medicine | |
| CN114452391A (en) | Application of CDK16 as target in preparation of medicine for treating triple negative breast cancer | |
| CN109223801B (en) | Novel gastric cancer tumor stem cell killing agent and application thereof | |
| CN106075454A (en) | A kind of anti-tumor medicinal preparation combination | |
| CN112870193A (en) | Application of melatonin in preparation of medicine for treating HER2 positive breast cancer resistant to targeted medicine | |
| CN113332270A (en) | Application of all-trans retinoic acid and sorafenib in preparation of anti-leukemia drugs | |
| CN114209728B (en) | Wild chrysanthemum active site with function of regulating epigenetic expression balance and resisting liver cancer as well as preparation method and application thereof | |
| CN114404591B (en) | Application of CDK14 as target in preparation of medicine for treating triple negative breast cancer | |
| CN117427068A (en) | Use of a Ji Ruige in the treatment of oritinib-resistant lung adenocarcinoma | |
| CN107582525A (en) | TRIM31 inhibitor magnetic target drug bearing microspheres are preparing the application in suppressing PDAC multiplication capacity medicines | |
| CN102008493A (en) | Application of panaxadiol saponin in preparing medicines combined with glucocorticoid receptor | |
| CN108070589A (en) | Nucleic acid molecules CTL4HSH9, its preparation method and application | |
| CN108070588A (en) | Nucleic acid molecules CTL4HSH8, its preparation method and application | |
| CN108070591A (en) | Nucleic acid molecules CTL4HSH4, its preparation method and application | |
| CN108118052A (en) | Nucleic acid molecules CTL4HSH17, its preparation method and application | |
| CN116687904A (en) | Application of pleuromutilin antibiotics in preparing anti-tumor and drug for reversing molecular targeted therapy resistance | |
| CN108118053A (en) | Nucleic acid molecules CTL4HSH16, its preparation method and application | |
| CN104840463B (en) | A kind of pharmaceutical composition and detection method for promoting Increase Apoptosis of Lung Cancer Cells | |
| CN108096267A (en) | The purposes of miR-134 and its accelerating agent in clinical treatment of osteosarcoma drug is prepared |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |