CN110229826B

CN110229826B - Haynaldia villosa CEBiP1-V gene and protein coded by same and application thereof

Info

Publication number: CN110229826B
Application number: CN201910526659.3A
Authority: CN
Inventors: 王宗宽; 王秀娥; 樊安琪; 刘佳; 韦璐阳; 王雅嘉; 张鑫; 袁春霞; 王海燕; 肖进
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2019-06-18
Filing date: 2019-06-18
Publication date: 2021-10-19
Anticipated expiration: 2039-06-18
Also published as: CN110229826A

Abstract

The invention discloses a Haynaldia villosa CEBiP1-V gene, and a protein coded by the gene and application of the gene. The cDNA sequence of CEBiP1-V is SEQ ID NO.1 and the coded amino acid sequence is SEQ ID NO. 2. A CEBiP1-V gene overexpression vector pBI220-CEBiP1-V is transformed into a susceptible wheat variety Yangmai 158 by a single cell transient expression technology, and the result shows that transient overexpression CEBiP1-V can reduce the haustorium index of Yangmai 158. The expression level of CEBiP1-V in the over-expression CEBiP1-V transgenic plant is 9-65 times of that of Yangmai 158, and the transgenic plant shows high resistance level to wheat powdery mildew. Therefore, CEBiP1-V is expected to be used for genetic engineering breeding, and when the over-expression vector pBI220-CEBiP1-V is introduced into wheat varieties susceptible to powdery mildew, the powdery mildew resistance of wheat is expected to be improved.

Description

Haynaldia villosa CEBiP1-V gene and protein coded by same and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and discloses a haynaldia villosa CEBiP1-V gene, and a protein coded by the gene and application of the gene.

Background

Wheat powdery mildew is a wheat disease caused by obligate parasitic fungus erysiphe graminis DC f.sp.tritici, is one of three fungal diseases in wheat production in China, and seriously threatens the safe production of wheat. At present, the incidence area of wheat powdery mildew in China is maintained at about 1 hundred million mu, and 15 to 30 percent of yield loss is caused each year.

Plants form two active defense mechanisms to protect themselves from being infected by pathogenic bacteria, namely, immune response elicited by pathogen-associated molecular Patterns (PTI) and immune response elicited by Effector proteins (ETI). PTI mainly recognizes conserved and indispensable molecules in pathogenic bacteria, namely pathogenic bacteria-related Molecular Patterns (PAMPs), such as bacterial flagellins, bacterial elongation factors and chitin-triggered immune responses by plant Pattern Recognition Receptors (PRRs). The immune response triggered by the recognition of effector factors secreted by pathogenic bacteria by the R gene in the plant is called ETI. When pathogenic bacteria invade plants, the pattern recognition receptor on the surface of the plant cell recognizes the pathogen-related molecular pattern of the pathogenic bacteria, thereby triggering the plant basic defense. Pathogens either suppress PTI in plants by secreting effector factors, or use "self-camouflage" to evade host immune defenses [4] [5 ]. NBS-LRR type R genes in plant genomes can trigger ETI by recognizing specific effector factors and are accompanied with programmed cell necrosis, and currently cloned wheat powdery mildew resistance genes Pm2, Pm3, Pm8, Pm21 and Pm60 are NBS-LRR type R genes.

Plant PRRs are generally Receptor-Like protein Kinases (RLKs) and RLPs (Receptor Like proteins) that localize to cell membranes. A typical RLK will generally include an extracellular ligand binding domain, a transmembrane domain and an intracellular kinase domain, with RLP lacking the intracellular kinase domain. According to the extracellular domain of PRRs, there are currently 4 major classes of PRRs cloned: LRR, EGF-like, LysM and Lectin types. The pattern recognition receptor of chitin in plants often contains the LysM domain, and thus LysM-like genes may play an important role in the resistance to powdery mildew. The LysM domain, an ancient and ubiquitous domain, plays an extremely important role in plant and fungal interactions. LysM domain-containing proteins in plant cells recognize different kinds of ligand molecules containing N-acetylglucosamine structures, thus initiating specific defense responses of plants against pathogenic bacteria [9 ]. Chitin is a major component of the fungal cell wall, a very typical PAMP. In the previous research, the LysM gene in the plant body can specifically recognize chitin and trigger immune response.

In the long-term evolution and natural selection process of closely related species of cultivated wheat, a large number of beneficial genes with disease and pest resistance, stress resistance, high quality and the like are reserved and are important gene sources for improving common wheat varieties, so that the research and the utilization of disease resistance genes of the closely related species are important ways for improving the disease resistance of the wheat. Haynaldia villosa (Haynaldia villosa l.,2n ═ 2x ═ 14, genome VV,) is a diploid closely related species of common wheat, has excellent properties of high powdery mildew resistance, and is expected to obtain a functional gene for powdery mildew resistance.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide a LysM receptor protein gene CEBiP 1-V.

Another objective of the invention is to provide a overexpression vector of the gene.

The invention also aims to provide application of the gene and the overexpression vector.

The purpose of the invention can be realized by the following technical scheme:

CEBiP1-V (Chitin Elicitor Receptor Kinase 1) gene, derived from diploid dasypyrum villosum. The nucleotide sequence is SEQ ID NO. 1.

The amino acid sequence of the protein CEBiP1-V coded by the gene is SEQ ID NO. 2.

The super expression vector containing the CEBiP1-V gene of claim 1, preferably pBI220 as starting vector, is obtained by inserting the CEBiP1-V gene of claim 1 in the forward direction between BamHI and Stu I cleavage sites of pBI220 vector.

The overexpression vector of the CEBiP1-V gene is applied to wheat varieties resistant to powdery mildew.

Advantageous effects

The research aims to clone a LysM receptor protein gene CEBiP1-V related to powdery mildew resistance by analyzing the expression pattern of the Haynaldia villosa LysM receptor protein gene family. Single cell transient expression experiment shows that CEBiP1-V positively regulated wheat powdery mildew resistance is further converted into wheat Yangmai 158 as one kind of super expression vector pBI220-CEBiP1-V of CEBiP1-V gene by means of wheat gene gun genetic transformation technology to obtain transgenic positive plant.

Drawings

FIG. 1 qPCR analysis of CEBiP1-V in diploid P.villosum induced leaves

An X axis: 0h, 1h, 3h, 8h, 12h, 18h, 24h, 36h and 48h respectively represent different time periods when the leaves of the haynaldia villosa are induced by powdery mildew; y-axis: expression fold of CEBiP1-V gene before and after induction by powdery mildew in different samples.

FIG. 2 construction map of CEBiP1-V gene overexpression vector

FIG. 3 research on the anti-powdery mildew effect of CEBiP1-V by using the single cell overexpression technique

FIG. 4T of Yangmai 158 transformed by CEBiP1-V gene overexpression vector₁PCR molecular identification result of generation-positive transgenic plant

DL2000 in lane 1, Yangmai 158 in lane 2, and OE-CEBiP1-T in lanes 3-7 as positive transformed plants₀-12、OE-CEBiP1-T₀-17、OE-CEBiP1-T₀-31、OE-CEBiP1-T₀-50、OE-CEBiP1-T₀-74。

FIG. 5T of Yangmai 158 transformed with CEBiP1-V gene overexpression vector₁qPCR analysis result of generation-positive transgenic plant

An X axis: yangmai 158 and the 5 transgenic positive plants; y-axis: expression multiple of CEBiP1-V gene in transgenic plant relative to Yangmai 158.

FIG. 6T of Yangmai 158 transformed with CEBiP1-V gene overexpression vector₁In vitro identification of powdery mildew of generation-positive transgenic plant

Detailed Description

Example 1 cloning of the CEBiP1-V Gene and expression characteristics induced by powdery mildew

Homologous cloning primers P1(ATGCCGCTCCCGTCGCCGGC, SEQ ID NO.3) and P2(TCAAAGGAAGCATACCAAG, SEQ ID NO.4) are designed and cloned in cDNA induced by Erysiphe cichoracearum leaves to obtain a 1080bp sequence, and the sequence is shown as SEQ ID NO. 1. The sequence codes 359 amino acids, the sequence is shown in SEQ ID NO.2, and the gene is named as CEBiP 1-V.

The powdery mildew resistant haynaldia villosa seeds (reference: Qili, Chenpedu, etc., wheat powdery mildew new resistant source-gene Pm21, Proc. Subcr.Scorzonerae 1995, 21(3):257-262) are sowed in a culture dish for germination, and after exposure to the white, the seeds are transplanted into a pot (the periphery is isolated by a cylindrical transparent plastic sheet, and the top end is sealed by filter paper to form an environment without powdery mildew). And (3) when the seedlings are in a three-leaf stage, gently shaking fresh spores of Nanjing local mixed powdery mildew cultured on the susceptible variety Sumai III onto the seedlings of the Haynaldia villosa. The haynaldia villosa after inoculation with powdery mildew is continuously cultured at 16 ℃. Inoculating for 0h, 1h, 3h, 8h, 12h, 18h, 24h, 36h and 48h, sampling, and storing in a refrigerator at-70 deg.C for use. RNA of powdery mildew-induced leaf blades of dasypyrum villosum was extracted using TRIZOL (Invitrogen), and the first strand of reverse transcription was synthesized using AMV enzyme (Takara) to obtain a reverse transcription product.

The qPCR analysis of the gene in the sample induced by powdery mildew was carried out using specific primers P3(ATCGCCACCGCCAACAAGG, SEQ ID NO.5) and P4(GGAGCGGGACATCAAGAACCTG, SEQ ID NO.6) which specifically amplify CEBiP 1-V. The PCR reactions were amplified on a qPCR instrument (Roche Light Cycler 480, Roche). 20 μ l of PCR reaction system contained 2 μ l cDNA, 10. mu.l 2 XSSYBR EX Taq TM (Takara), 0.4. mu.l primers P1 (10. mu.M) and P2 (10. mu.M). The amplification parameters were: 5min at 95 ℃ and then 10s at 95 ℃, 30s at 60 ℃ and 15s at 72 ℃ for 41 cycles. After the reaction was completed, the relative expression amount was calculated: calculating the relative expression amount of the target gene at different time points after treatment relative to the untreated gene, i.e. 2, according to the obtained CT value^-△△CT. Wherein, Δ C_T＝(C_T.Target-C_T.Tublin)_Timex-(C_T.Target-C_T.Tublin)_{Time 0}. Time x indicates an arbitrary Time point, and Time 0 indicates an unprocessed point. The results show that: the expression level of the leaf of the haynaldia villosa is induced by powdery mildew for 18 hours and reaches the induction peak which is 31.3 times. The results of qPCR indicate that CEBiP1-V may positively regulate wheat powdery mildew resistance (fig. 1).

Example 2 construction of silencing vector for CEBiP1-V Gene overexpression vector

The CEBiP1-V gene cloning vector pMD18T-CEBiP1-V is used to specifically amplify the primer pair P5 (CG) of the CEBiP1-V geneGGATCCATGCCGCTCCCGTCGCC, SEQ ID NO.7) and P6 (GA)AGGCCTAAGGAAGCATACCAAG, SEQ ID NO.8) was subjected to PCR amplification, and the amplified fragment was collected. The amplified target fragment was inserted between the multiple cloning site BamHI and StuI behind the 35S promoter of vector pBI220 (ref: Jefferson RA, Kavanagh TA, Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatil gene fusion marker in highher plants. EMBO J.1987,6: 3901-. Thus, CEBiP1-V gene overexpression vector pBI220-CEBiP1-V (FIG. 2) was obtained.

Example 3 transfer of CEBiP1-V Gene overexpression vector into wheat leaves Using Single-cell transient expression technology

Single cell Transient expression technology is a reliable and rapid method for identifying gene function (ref: Schweizer, Pokorny et al. A Transient Assay System for the Functional analysis of feedback-Related Genes in Wheat Molecular Plant-Microbe interactions.1999,12: 647-. According to the research, a unicellular transient expression method is utilized, plasmid DNA is wrapped on the outer layer of metal particles, the metal particles are bombarded to epidermal cells of wheat leaves by means of a gene gun, and then the powdery mildew haustorium index of the bombarded GUS cells is counted to determine whether a target gene has a powdery mildew disease-resistant function.

The procedure for encapsulating carrier DNA with metal particles is as follows:

preparing tungsten powder: weighing 30mg of tungsten powder into a 1.5ml eppendorf tube, adding 1ml of 70% alcohol, whirling for 3-5min, and standing for 15min to completely precipitate the gold powder. The mixture was centrifuged at 12,000rpm for 1min and the supernatant was discarded. Add 1ml of ddH₂And O, vortex mixing, centrifuging and discarding the supernatant (repeating for 3 times). Finally, 500. mu.l of 50% glycerol is added, and the mixture is vortexed and mixed for later use.

Wrapping bullets: aspirate 5. mu.l of vortexed tungsten powder into a 1.5ml eppendorf tube and add 5. mu.l of plasmid DNA (the total amount should be 1. mu.g, e.g., ddH for larger plasmid concentration less than 5. mu.l₂O diluted to a concentration of 5. mu.l/1. mu.g). 50. mu.l of 2.5M CaCl was added dropwise to an eppendorf tube while vortexing₂Then 20. mu.l of 0.1M spermidine (now ready to use) was added and vortexed for 3 min.

After standing for 1min, the mixture was centrifuged for 2s, and the supernatant was discarded. Add 140. mu.l 70% ethanol, vortex well, centrifuge for 2s, and discard the supernatant. Then 140. mu.l of 100% ethanol was added, vortexed thoroughly, centrifuged for 2s, and the supernatant was discarded. Finally, 15 μ l of 100% ethanol was added and vortexed thoroughly to prepare the solution for use.

When GUS gene single transformation is carried out, plasmid DNA containing a GUS gene expression vector pAHC25 (reference: Christensen A H, Quail P H. ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker genes in monoclonal genes Research,1996,5:213-218) is wrapped with tungsten powder; when the CEBiP1-V gene overexpression vector pBI220-CEBiP1-V and GUS gene are co-transformed, plasmid DNA containing the CEBiP1-V gene overexpression vector pBI220-CEBiP1-V and plasmid DNA containing the GUS gene expression vector pAHC25 are mixed according to the proportion of 1:1 in molar concentration, and tungsten powder is wrapped. GUS gene and CEBiP1-V gene overexpression vector pBI220-CEBiP1-V are co-transformed, and Marker gene GUS transferred cells are also CEBiP1-V gene overexpression vector pBI220-CEBiP1-V transferred cells. Since the cells expressing the GUS gene appeared blue after GUS staining, the blue cells were used as the cells expressing CEBiP1-V gene in this study.

The gene gun bombardment program was as follows: the end parts of wheat seedling leaves with the length of about 6cm are cut off and are pasted on glass slides in parallel, and about 6 leaves are pasted on each glass slide. The particle gun used the PDS1000/He system, using a 1350psi rupturable membrane at 28inHg vacuum. After bombardment, the leaves are placed in a porcelain plate padded with wetting filter paper, a preservative film with small holes is covered, moisture preservation and ventilation are carried out, and after recovery culture is carried out for 4 hours at the temperature of 18-20 ℃, powdery mildew conidia are inoculated at high density. Inoculating for 48 hr, and adding GUS dye solution (formula: 0.1mol L Na)₂HPO₄/NaH₂PO₄Buffer (pH7.0) containing 10 mmole L EDTA, 5 mmole L potassium ferricyanide and potassium ferrocyanide, 0.1mg/ml X-Gluc, 0.1% Triton X-100, 20% methanol) was vacuum infiltrated for 10min, stained at 37 ℃ for 12h, then decolorized with 70% alcohol for 2 days until the leaves became white, and finally the powdery mildew spores were stained with 0.6% Coomassie Brilliant blue.

After powdery mildew invades epidermal cells of wheat leaves, fingers produced in the epidermal cells are called haustoria. Failure of haustoria to produce normally is an important indicator of leaf cell resistance to powdery mildew. Among GUS-expressing cells, the cells were stained blue with GUS staining solution and were easily identified under a microscope. After the GUS gene is transformed into cells, the ratio (%) of the cells formed by the haustorium to the GUS expressing cells interacting with Erysiphe cichoracearum is counted, which is the "haustorium index" (publicly known and used, Schweizer, Pokorny et al. A transformed Assay System for the Functional Assessment of fed-Related Genes in Wheat Molecular Plant-microorganism interactions.1999,12: 647-. The smaller the haustorium index, the stronger the disease resistance. The research utilizes the suction index as a measure index of disease resistance.

When GUS gene is transformed independently, the haustorium index in Yangmai 158 of powdery mildew-susceptible wheat variety is 62.58%; when GUS gene and CEBiP1-V gene overexpression vector pBI220-CEBiP1-V co-transform susceptible powdery mildew wheat variety Yangmai 158, the haustorium index of Yangmai 158 is remarkably reduced to 31.13% (figure 3). The result shows that transient overexpression of CEBiP1-V can obviously reduce the haustorium index, and CEBiP1-V has positive regulation and control effect on wheat powdery mildew resistance.

Example 4 Stable genetic transformation of CEBiP1-V Gene overexpression vector pBI220-CEBiP1-V and Gene function Studies

Genetic transformation method using gene gun mediation (transformation and functional identification of genes related to powdery mildew resistance of wheat/Haynaldia villosa [ D)]Nanjing university of agriculture, 2007) transforming pBI220-CEBiP1-V into young embryo callus of Yangmai 158, a susceptible variety. About 2500 Yangmai 158 young embryo callus tissues cultured for 7D in advance are picked, pretreatment is carried out on a hypertonic culture medium (MS + ABA0.5mg/L + casein hydrolysate 500mg/L +2, 4-D2mg/L + glucose 30g/L +0.4mol/L mannitol, pH5.8) for 6-8 h before bombardment, a CEBiP1-V gene overexpression vector pBI220-CEBiP1-V is transformed into Yangmai 158 callus tissues through a gene gun bombardment method, and the Yangmai 158 callus tissues are continuously cultured on the hypertonic culture medium for 16h after bombardment. The calli were then transferred to a selection medium containing herbicide (1/2MS + ABA0.5mg/L + Casein hydrolysate 500mg/L + IAA 0.5mg/L + sucrose 30g/L +4mg/L Bialaphos, pH5.8) and cultured for 4 weeks with selection. Then transferring the callus with resistance to a differentiation medium (1/2MS + L-glutamine lmmol/L + hydrolyzed casein 200mg/L + KT 1mg/L + IAA 0.5mg/L + sucrose 30g/L + agar 0.8%, pH5.8) for differentiation, transferring the callus to a rooting medium (1/2MS + IAA 0.5mg/L + sucrose 30g/L + agar 0.8%, pH5.8) when the differentiated bud grows to 2-4 cm, opening the tube and hardening the seedling for 1-2 d when the regenerated seedling grows to about 8cm and the root system is healthy, and finally washing off the culture medium residue carried by the root system and transplanting the callus into a pot to obtain 86 regenerated plants in total. Extracting genome DNA of all regeneration plants, carrying out PCR amplification on the transformed plants by using a gene intron-spanning internal primer P7(ATCCTCCTTTCTCGCATGCT, SEQ ID NO.9) and a rice intron sequence specific primer P8(CGCTGCAGTTCAAACACCTT, SEQ ID NO.10), and identifying positive transgenic plants. PCR procedure: 50-100ng/ul genome template, 10. mu.M P7 and P8 each 0.5. mu.l; 2.5. mu.l of 10 XBuffer; 2.5. mu.l of 2.5mM dNTP; 1.5. mu.l of 25mM Mg²⁺(ii) a Mu.l (5U/. mu.l) Taq polymerase (TaKaRa) and water was added to 25. mu.l. The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 3 min; 30 cycles of 94 ℃ for 30s, 55 ℃ for 45s, 72 ℃ for 30 s; extension at 72 ℃ for 10 min. The PCR product is detected by 8 percent polypropylene gel electrophoresis, wherein 5 plants can amplify a 253bp target band and are identified as positive plants and plantsSerial numbers are as follows in sequence: OE-CEBiP1-T₀-12、OE-CEBiP1-T₀-17、OE-CEBiP1-T₀-31、OE-CEBiP1-T₀-50、OE-CEBiP1-T₀-74 (fig. 4). RNA of the 5 positive plants is extracted, and qPCR is utilized to identify the expression condition of the CEBiP1-V gene in each positive plant. The results show that: OE-CEBiP1-T₀-12、OE-CEBiP1-T₀-17、OE-CEBiP1-T₀-31、OE-CEBiP1-T₀-50、OE-CEBiP1-T₀The expression level of CEBiP1-V of-74 transgenic positive plants is 9-65 times that of Yangmai 158 (FIG. 5).

The seedling stage powdery mildew resistance adopts powdery mildew mixed strains collected in the field of Jiangsu Nanjing area to perform PCR identification on all T₀And carrying out powdery mildew resistance identification on the generation positive plants and the isolated leaves of Yangmai 158. The identification standard of the powdery mildew resistance at the seedling stage adopts a grading standard of a 0-5 grade powdery mildew resistance reaction type, wherein the 0-1 grade is high resistance, the 2-3 grade is medium resistance, and the grade above 4-5 is susceptible. The resistance of the adult plant stage is characterized in that T0 generation positive plants and Yangmai 158 are inoculated in the field by powdery mildew mixed strains collected in the field of Jiangsu Nanjing area and the powdery mildew resistance identification is carried out. The identification standard of the powdery mildew resistance in the adult plant stage adopts a grading standard of a '0-9 grade' powdery mildew resistance reaction type, wherein 0-2 grade is high resistance, 3-4 grade is medium resistance, 5-6 grade is medium feeling, and more than 7-9 grade is high feeling. The seedling stage in vitro powdery mildew resistance identification and adult stage powdery mildew resistance results show that: yangmai 158 is highly sensitive in both seedling and adult stages, while OE-CEBiP1-T₀-12、OE-CEBiP1-T₀-17、OE-CEBiP1-T₀-31、OE-CEBiP1-T₀-50、OE-CEBiP1-T₀The resistance of the-74 transgenic positive line was significantly higher than that of Yangmai 158 (Table 1, FIG. 6).

TABLE 1

Sequence listing

<110> Nanjing university of agriculture

<120> a Haynaldia villosa CEBiP1-V gene and its coded protein and application

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1080

<212> DNA

<213> Haynaldia villosa

<400> 1

atgccgctcc cgtcgccggc cgcccgactg gccatccagg ccgccgccct cctcgtcctc 60

ctcaacctcg ccgccacggc cacggcggcc aacttcacct gcagcgcgcc gcggggcacc 120

acctgccgct ccgccatcgg ctaccgcgtg cccaacgcca ccacctacgg ggacctcctc 180

gcgcgcttca acaccaccac cctcgccggc ctcctcggcg ccaacgacct cccgcccgcc 240

acctccccca agaggcgcgt ccccgccaag gccaccgtcc gcatcccctt ccgctgcctc 300

tgcgccggca acggcgtcgg ccagtcggac cacgcgcccg tctacaccgt gcagccgcag 360

gacgggctgg acgccatcgc ccgcaactcc ttcgacgccg tcgtcaccta ccaggagatc 420

gccaccgcca acaaggtcgc cgacgtcaac ctcatcaccg tcggccagaa gctctggatc 480

ccgctgccct gcagctgcga ccccgtcggc ggcgccgacg tcttgcactt cacccacatc 540

gtcgacgccg gggagaccac ctccggcatc gccgccgcct tcggcgtcac cgaggacacg 600

ctcctcaagc tcaacaagat cgccgacccc aagaccctcc agaaggacca ggttcttgat 660

gtcccgctcc ctgtctgcag ctcatcaatc agcaacacct cagctgatca tgatctgcgc 720

ctctccaacg gcacctatgc gctcaccgcg caggactgca tccagtgccg ctgcagttca 780

aacaccttcc agctaaactg caccgcactg caaggaaaaa agggatgccc agcagtgccg 840

ccgtgccgcg aagggctcaa gcttggggac acaaacggca ccggttgcga ctcgactatg 900

tgcgcttaca ctggttattc caacagccct tcgctcggca tacataccac tcttttcaaa 960

aaccagaccg caccagcatg cgagaaagga ggatcttcga ggtcggtgtt cgccgggtcc 1020

atgtggagga tatctgccat ctccttccac atggtgttga tcttggtatg cttcctttga 1080

<210> 2

<211> 359

<212> PRT

<213> Haynaldia villosa (Haynaldia villosa)

<400> 2

Met Pro Leu Pro Ser Pro Ala Ala Arg Leu Ala Ile Gln Ala Ala Ala

1 5 10 15

Leu Leu Val Leu Leu Asn Leu Ala Ala Thr Ala Thr Ala Ala Asn Phe

20 25 30

Thr Cys Ser Ala Pro Arg Gly Thr Thr Cys Arg Ser Ala Ile Gly Tyr

35 40 45

Arg Val Pro Asn Ala Thr Thr Tyr Gly Asp Leu Leu Ala Arg Phe Asn

50 55 60

Thr Thr Thr Leu Ala Gly Leu Leu Gly Ala Asn Asp Leu Pro Pro Ala

65 70 75 80

Thr Ser Pro Lys Arg Arg Val Pro Ala Lys Ala Thr Val Arg Ile Pro

85 90 95

Phe Arg Cys Leu Cys Ala Gly Asn Gly Val Gly Gln Ser Asp His Ala

100 105 110

Pro Val Tyr Thr Val Gln Pro Gln Asp Gly Leu Asp Ala Ile Ala Arg

115 120 125

Asn Ser Phe Asp Ala Val Val Thr Tyr Gln Glu Ile Ala Thr Ala Asn

130 135 140

Lys Val Ala Asp Val Asn Leu Ile Thr Val Gly Gln Lys Leu Trp Ile

145 150 155 160

Pro Leu Pro Cys Ser Cys Asp Pro Val Gly Gly Ala Asp Val Leu His

165 170 175

Phe Thr His Ile Val Asp Ala Gly Glu Thr Thr Ser Gly Ile Ala Ala

180 185 190

Ala Phe Gly Val Thr Glu Asp Thr Leu Leu Lys Leu Asn Lys Ile Ala

195 200 205

Asp Pro Lys Thr Leu Gln Lys Asp Gln Val Leu Asp Val Pro Leu Pro

210 215 220

Val Cys Ser Ser Ser Ile Ser Asn Thr Ser Ala Asp His Asp Leu Arg

225 230 235 240

Leu Ser Asn Gly Thr Tyr Ala Leu Thr Ala Gln Asp Cys Ile Gln Cys

245 250 255

Arg Cys Ser Ser Asn Thr Phe Gln Leu Asn Cys Thr Ala Leu Gln Gly

260 265 270

Lys Lys Gly Cys Pro Ala Val Pro Pro Cys Arg Glu Gly Leu Lys Leu

275 280 285

Gly Asp Thr Asn Gly Thr Gly Cys Asp Ser Thr Met Cys Ala Tyr Thr

290 295 300

Gly Tyr Ser Asn Ser Pro Ser Leu Gly Ile His Thr Thr Leu Phe Lys

305 310 315 320

Asn Gln Thr Ala Pro Ala Cys Glu Lys Gly Gly Ser Ser Arg Ser Val

325 330 335

Phe Ala Gly Ser Met Trp Arg Ile Ser Ala Ile Ser Phe His Met Val

340 345 350

Leu Ile Leu Val Cys Phe Leu

355

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgccgctcc cgtcgccggc 20

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcaaaggaag cataccaag 19

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atcgccaccg ccaacaagg 19

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggagcgggac atcaagaacc tg 22

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cgggatccat gccgctcccg tcgcc 25

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gaaggcctaa ggaagcatac caag 24

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atcctccttt ctcgcatgct 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cgctgcagtt caaacacctt 20

Claims

1. Haynaldia villosa CEBiP1-V gene is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1.

2. The protein encoded by CEBiP1-V gene of claim 1, characterized in that its amino acid sequence is as shown in SEQ ID No. 2.

3. A overexpression vector comprising the CEBiP1-V gene of claim 1.

4. The CEBiP1-V gene overexpression vector of claim 3, wherein the CEBiP1-V gene of claim 1 is inserted between BamHI and StuI cleavage sites of pBI220 vector using pBI220 vector as starting vector.

5. Use of CEBiP1-V according to claim 1 for breeding powdery mildew resistant wheat varieties.

6. Use of the CEBiP1-V gene overexpression vector of any one of claims 3 or 4 for breeding powdery mildew resistant wheat varieties.