CN109280671B - Wheat cell wall related receptor protein kinase gene and expression vector and application thereof - Google Patents

Abstract

The invention belongs to the field of genetic engineering, and discloses a cell wall related receptor protein kinase gene TaWAK6 in wheat, and an expression vector and application thereof. The cDNA sequence of TaWAK6 is SEQ ID NO.3 and the coded amino acid sequence is SEQ ID NO. 4. The gene is from common wheat (Triticum asetivum L.) Nannong 9918. TaWAK6 is induced by powdery mildew to express in anti-powdery mildew wheat variety Nannong 9918, and the expression level is far higher than that in susceptible wheat mutant SM-1. The virus-mediated gene silencing technology is used for inducing TaWAK6 to silence in Nannong 9918, so that the powdery mildew resistance is obviously reduced; transient expression can transform the gene into a susceptible wheat mutant SM-1, so that the haustorium index is obviously reduced, and the powdery mildew resistance is improved. Therefore, TaWAK6 can be used for genetic engineering breeding, and is expected to improve the powdery mildew resistance of wheat when being introduced into wheat varieties susceptible to powdery mildew.

Description

Wheat cell wall related receptor protein kinase gene and expression vector and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and discloses a cell wall related protein kinase gene TaWAK6 in wheat, and an expression vector and application thereof.

Background

Wheat (Triticum aestivum) is a worldwide food crop with strong adaptability and wide distribution range, and about 35-40% of people all over the world use wheat as main food, providing about 20% of protein and 21% of food calories (lirit, 2006). China is the first major country of wheat planting and yield in the world, and the annual yield accounts for about 17% of the total yield in the world; wheat is the third largest food crop in China, and the total yield is inferior to rice and corn (reference: He Zhong Hu, Zhuang Qiao Sheng, Cheng shun He, etc.. Chinese wheat industry development and technological progress [ J ] agronomy report, 2018(1): 99-106.). Wheat production in China not only plays an important role in guaranteeing domestic food safety, but also can affect international food safety.

Wheat powdery mildew caused by Blurmeria graminis f.sp.tritici, Bgt, is one of the most serious fungal diseases affecting wheat production worldwide, and has become the main disease damaging wheat safe production in China (reference: Zhanhaixian, Changzhi, Yanzujun, and the like.) research progress of wheat powdery mildew resistant gene source and resistance evaluation [ J ] Chinese agronomy report, 2010,26(10):42-46 ]. In areas with serious diseases, the control is still mainly dependent on chemical agents, and the food and ecological safety are damaged. The cultivation of disease-resistant varieties is the most economical and effective method for preventing and treating wheat powdery mildew and ensuring the safe production of wheat. As wheat powdery mildew has multiple physiological races and rapid toxicity variation, once new toxic races or races are generated and the population changes, the wheat powdery mildew can cause large outbreak, which brings disastrous consequences to agricultural production. The discovery and utilization of broad-spectrum persistent disease-resistant genes have important significance for preventing and treating powdery mildew, and are the premise and guarantee for cultivating persistent disease-resistant varieties (Kurapathoy et al, 2007).

Haynaldia villosa (2 n 2x 14 VV) is a related species of wheat, carries a plurality of disease-resistant and stress-resistant genes, and the genetic diversity of common wheat can be improved by introducing the disease-resistant genes of the Haynaldia villosa into the common wheat. The Nanjing university of agriculture cell genetics institute utilizes tetraploid cone wheat to hybridize with diploid Haynaldia villosa, and then backcrosses with common wheat for multiple generations, so as to breed a common wheat-Haynaldia villosa translocation line T6 VS.6 AL (references: Chen PD, Qi LL, Zhou B, Zhang SZ, Liu DJ (1995) Development and molecular cytogenetic analysis of what-wheat-Haynaldia villosa 6VS/6AL translocation lines specific genetic application to powder application mill 91: 1125-1128.), and introduces a broad-spectrum high-powdery mildew-resistance gene Pm21 carried on Haynaldia villosa 6VS into common wheat. More than 30 new powdery mildew resistant wheat varieties have been bred since 1994 through domestic breeding and utilization of T6VS & 6AL, become important germplasm resources for powdery mildew resistance breeding in China, and Pm21 also becomes a main powdery mildew resistance gene in China. The Pm21 gene has been cloned (ref: Xing, P.Hu, J.Liu, K.Witek, S.Zhou, J.Xu, W.Zhou, L.Gao, Z.Huang, R.Zhang, X.Wang, P.Chen, H.Wang, J.D.G.Jones, M.Karafi < tov > a, J.Vr < na, J).

J.

Y.Tian, Y.Wu, A.Cao, Pm21from Haynaldia villosa encodes a CC-NBS-LRR protein regulating powdery resistance in wheat plant (2018) doi:10.1016/j.mol p.2018.02.013), but mediated resistance pathwayIt is not clear which genes are involved. The analysis of the broad-spectrum resistance mechanism mediated by Pm21 and the cloning of the gene in the disease-resistant way are of great significance for the cultivation of wheat varieties with powdery mildew broad-spectrum resistance by using genetic engineering means.

Disclosure of Invention

The invention aims to provide an expression vector and application of a cell wall-associated receptor protein kinase gene TaWAK6 aiming at the defects of the prior art.

The purpose of the invention can be realized by the following technical scheme:

the cell wall related receptor protein kinase gene TaWAK6 is derived from common wheat (Triticum asetivum L.) Nannong 9918, and the nucleotide sequence thereof is SEQ ID NO. 3.

The protein of the cell wall related receptor protein kinase gene is TaWAK6, and the amino acid sequence thereof is SEQ ID NO. 4.

The recombinant expression vector pBI220 containing the cell wall related receptor protein kinase gene TaWAK6 is TaWAK 6.

The recombinant expression vector of the cell wall related receptor protein kinase gene TaWAK6 is obtained by preferably using pBI220 as a starting vector and inserting a TaWAK6 gene between BamHI and KpnI enzyme cutting sites of the pBI 220.

The expression vector of the cell wall related receptor protein kinase gene TaWAK6 is applied to the construction of powdery mildew resistant wheat varieties.

Has the advantages that:

the invention clones a cell wall related receptor protein kinase gene TaWAK6 and a protein TaWAK6 coded by the same from wheat, inserts the gene into an expression vector pBI220, and introduces the obtained over-expression vector of the gene into a disease-susceptible wheat variety, thereby improving the resistance of the disease-susceptible wheat variety to powdery mildew. The overexpression vector of TaWAK6 is used for genetic engineering breeding, and is introduced into wheat varieties susceptible to powdery mildew, so that wheat germplasm with powdery mildew resistance can be obtained.

Drawings

FIG. 1 shows the restriction enzyme digestion verification of the BSMV TaWAK6 vector

M: DL2000 Marker; 1: BSMV TaWAK6 plasmid; 2: the BSMV TaWAK6 plasmid is cut by NheI enzyme;

FIG. 2 silencing of TaWAK6 in Nannong 9918 results in a significant decrease in powdery mildew resistance

1. The growth of powdery mildew in the leaves inoculated with BSMV is hindered, and the resistance of Nannong 9918 is not influenced;

2. 3: the powdery mildew in the leaves inoculated with the BSMV TaWAK6 develops normally, and the resistance of Nannong 9918 is obviously reduced;

FIG. 3 pBI220 TaWAK6 overexpression vector map

TaWAK6 was inserted between BamHI and KpnI of pBI220, downstream of the 35S promoter

FIG. 4 investigation of the Effect of TaWAK6 Gene on haustorium formation and anti-powdery mildew Effect by transient expression

The transient overexpression of TaWAK6 in susceptible materials can obviously inhibit the formation of powdery mildew haustorium and improve the powdery mildew resistance

Detailed description of the preferred embodiments

Example 1 cloning of a cell wall-associated receptor protein kinase Gene TaWAK6 in Nannong 9918

Nanjing 9918 is a wheat variety containing a broad-spectrum powdery mildew resistance gene Pm21 developed by cell genetics of Nanjing agriculture university (publicly known, reference: Chenpei, Zhangzhong, Wangxuie, Wangsui, cycle, Von 31054;, high, Liu big jun. New wheat variety Nanjing 9918. Nanjing agriculture university journal, 2002,25(4): 1438. 1444), SM-1 is a powdery mildew-susceptible mutant obtained by the Nanjing agriculture university after treating Nanjing 9918 with EMS (publicly known, reference: Xing, P.Hu, J.Liu, K.Witek, S.ZHou, J.Xu, W.ZHou, L.Gao, Z.Huang, R.Zhang, X.Wang, P.Cheng, H.Cheng, J.G.Wanes, M.Karafi, Vr 84. J.

J.

Y.Tian, Y.Wu, A.Cao, Pm21from Haynaldia villosa encodes a CC-NBS-LRR protein relating to pore tissue resistance in leather, mol.plant (2018) doi:10.1016/j.mol p.2018.02.013.). To screen for Nannong9918 is induced by powdery mildew, and high-throughput sequencing is adopted to obtain powdery mildew resistant wheat Nannong 9918 and powdery mildew resistant mutant SM-1 (known and common, reference: Xing, P.Hu, J.Liu, K.Witek, S.Zhou, J.Xu, W.Zhou, L.Gao, Z.Huang, R.Zhang, X.Wang, P.Chen, H.Wang, J.D.G.Jones, M.Karafi tov a, J.Vr na, J).

J.

Y.Tian, Y.Wu, A.Cao, Pm21from Haynaldia villosa encodes a CC-NBS-LRR protein relating gene expression level in wheat resistance, mol.plant (2018) doi: 10.1016/j.molp.2018.02.013), and screening the differential expression genes in the anti-influenza material on the basis. The specific process is as follows: the method comprises the steps of sowing seeds of southern agricultural 9918 resistant powdery mildew wheat and seeds of SM-1 susceptible powdery mildew wheat in a culture dish for germination, transplanting the seeds into a pot after exposure to white, inoculating powdery mildew spores collected from powdery mildew wheat materials to seedlings for induction in one-leaf period, sampling 24 hours before and after inoculation, and repeating biology for three times. RNA was extracted using Trizol reagent (Invitrogen, USA) to form sequencing samples: r24 (three biological replicates of nanong 9918 induced for 24 hours), R0 (three biological replicates of nanong 9918 non-induced), S24 (three biological replicates of SM-1 induced for 24 hours), S0 (three biological replicates of SM-1 non-induced). Four RNAs were delivered to Beijing Liu He Hua Dagen science and technology Co., Ltd for sequencing of digital gene expression profiles. Comparison of data among samples, including R24vs R0, S24vs S0 and R24vs S24, selects genes inducing up-regulated expression in Nannong 9918 based on the standard that the ratio of the number of sequencing strips is more than 2. One of the differential expression genes is Ta # S58887995, which is a cell wall related receptor protein kinase gene, and the gene shows differential expression when R24 is compared with R0, namely the gene is induced and expressed by powdery mildew in anti-southern agricultural 9918; it shows non-differentially expressed genes when compared to S24 and S0, i.e. the genes are not induced to express by powdery mildew in susceptible SM-1; comparison at R24 with S24The expression shows that the gene is expressed differentially, namely, the expression of the gene is different when the southern agricultural 9918 disease resistance and the SM-1 powdery mildew disease susceptibility are induced for 24 hours. Based on the analysis of the digital gene expression profile, the Ta # S58887995 is preliminarily judged to have close correlation with powdery mildew resistance.

RNA extracted from leaves of Nannong 9918 after being induced by powdery mildew for 24 hours is reversely transcribed into cDNA serving as a template, and primers P1(ATGTCACAAGCAAAGCTCAT, SEQ ID NO.1) and P2(TCATCTAGGAATTTCAGATG, SEQ ID NO.2) designed from a gene Ta # S58887995 screened according to a digital gene expression profile are used as primers for RT-PCR, so that a cDNA full-length fragment of the Ta # S58887995 gene is obtained. The PCR procedure was as follows: mu.l cDNA template (100ng/ul), 2. mu.l P1 primer (10. mu.M), 2. mu.l P2 primer, 25. mu.l Phanta Max buffer (2X), 2. mu.l dNTP Mix (10mM), 1. mu.l Phanta Max Super-Fidelity DNA polymerase (1U/. mu.l) (Vazyme, China) with water to 50. mu.l. And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 3 min; 15 seconds at 95 ℃, 40 seconds at 60 ℃,2 minutes at 72 ℃ and 35 cycles; extension at 72 ℃ for 10 min. The PCR product was subjected to electrophoresis in 1.2% agarose gel to detect the specificity and size of the amplified band, and the specifically amplified band (AP-GX-50, Axygen) was recovered and ligated to TOPO cloning vector (Vazyme, Nanjing, China).

The gene fragment inserted into the TOPO cloning vector is sequenced and compared, and the gene is found to be a cell wall related receptor protein kinase gene, has the same sequence with Ta # S58887995 and is named TaWAK 6. Bioinformatics analysis is carried out on TaWAK6, and an ORF (open reading frame) 2265bp is found, the nucleotide sequence of which is shown as SEQ ID NO.3, and the code 754 amino acids are shown as SEQ ID NO. 4. The amino acid sequence of this gene, which was found to contain GUB WAK, EGF-like and kinase domains, was found to belong to a typical cell wall-associated receptor protein kinase gene by conserved region analysis using BLASTP in NCBI.

EXAMPLE 2 study of anti-powdery mildew function of TaWAK6 Using BMSV-VIGS System

Virus Induced Gene Silencing (VIGS Induced Gene Silencing, VIGS) refers to the induction of plant endogenous Gene Silencing and the resulting phenotypic change after a plant is infected with a Virus carrying a target Gene fragment, and the function of the target Gene is further studied according to the phenotypic variation. Compared with the traditional gene function analysis method, the VIGS can rapidly silence target genes and identify functions to overcome function repetition. Barley streak Virus BSMV (BSMV) has been engineered for gene silencing and functional validation in wheat (references: Zhou H, Li S, Deng Z, Wang X, Chen T, Zhang J, Chen S, Link H, Zhang A, Wang D, Zhang X (2007) Molecular analysis of the gene new receptor-like enzymes from hexaploid wheat and for the expression of the expression discrimination in the gene expression of plant J52: 420-434).

Construction of BSMV amplification of the TaWAK6 insert of TaWAK6 vector: design primer P3 (GCT) with NheI enzyme cleavage point by using TaWAK6 as templateGCTAGCTGAAGATGCTGAGGTGGTTG, SEQ ID NO.5) and P4 (GCT)GCTAGCGGAATTTCGGATGATTGGAT, SEQ ID NO.6), restriction sites of restriction endonuclease NheI and protective bases (GCTAGC is the restriction site of NheI and GCT is the protective base in underlined sequence at the 5 'end of the primer) are introduced into the 5' ends of P3 and P4, so that the amplified fragments are digested and inserted into a gamma vector of BSMV by using NheI. The specific amplification is as follows: PCR was performed using P3 and P4 as primers and a TOPO plasmid containing TaWAK6 as a template to amplify a 249bp fragment in TaWAK 6. PCR procedure: mu.l plasmid template (100ng/ul), 2. mu.l P3 primer (10. mu.M), 2. mu.l P4 primer, 25. mu.l Phanta Max buffer (2X), 2. mu.l dNTP Mix (10mM), 1. mu.l Phanta Max Super-Fidelity DNA polymerase (1U/. mu.l) (Vazyme, China), with water to 50. mu.l. And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 3 min; 15 seconds at 95 ℃, 15 seconds at 60 ℃,30 seconds at 72 ℃ and 35 cycles; extension at 72 ℃ for 5 minutes. The specificity and size of the amplified band were checked by 1.2% agarose gel electrophoresis of the PCR product (FIG. 2), and the specific amplified band (AP-GX-50, Axygen) was recovered.

Construction of BSMV TaWAK6 vector: after the recovery of the amplification product of TaWAK6, using restriction enzyme NheI to completely cut enzyme, and simultaneously using restriction enzyme NheI to completely cut enzyme BSMV, namely a PDS vector, cutting an insertion fragment (being a PDS gene sequence) of about 200bp and a vector fragment of more than 2 kb; the recovered fragment after enzyme digestion of TaWAK6 and the vector fragment after enzyme digestion of BSMV, PDS are connected by T4 ligase (NEB, USA), the connection product is transformed into competent Escherichia coli, coated with ampicillin resistant plate, and single clone is selected. After the monoclonal shake culture, the positive clones with the reverse insert were screened by PCR using the bacterial solution as template. The method comprises the following specific steps: carrying out PCR and agarose gel electrophoresis by taking P3 and P4 as left and right primers, and screening out a positive monoclonal inserted with a target gene fragment; PCR and agarose gel electrophoresis are carried out by taking the bacterial liquid of the positive monoclonal as a template, taking a gamma-strain-P primer P5 on a carrier as a left primer (5'-CAACTGCCAATCGTGAGTAGG-3', SEQ ID NO.7, the primer is about 230bp away from the Nhe I enzyme cutting site) and taking a forward primer P3 of TaWAK6 as a right primer, and if a fragment 230bp larger than a target band can be amplified, the fact that the TaWAK6 gene in the monoclonal is reversely inserted into BSMV is shown: between the Nhe I sites of the gamma vector. The recombinant vector was further digested with NheI (FIG. 1), verifying that the correct vector was used for the next step of in vitro transcription and induction of gene silencing.

In vitro transcription process: the BSMV viral vectors alpha, beta, gamma-PDS and the recombinant gamma-TaWAK 6 plasmid carrying the exogenous insert of the target gene were extracted according to the plasmid extraction kit (Tiangen corporation), and the linearized vector was transcribed in vitro using RiboMAXTM Large Scale RNA Production Systems-T7 kit and Ribo m7G Cap Analog kit (Promega, USA). After in vitro transcription, the alpha chain transcript, beta chain transcript and gamma chain transcript were mixed in equal volume, diluted with three volumes of DEPC water, and then 2 XGKP Buffer (50mM glycine,30mM K2HPO4, pH 9.2, 1% bentonite, 1% celite) was added, and the mixture was stored in a refrigerator at-80 ℃ for further use.

BSMV TaWAK6 inoculation and powdery mildew resistance identification: virus inoculation induced gene silencing is carried out on the southern agricultural 9918 wheat in the two-leaf period. During inoculation, the latex gloves are worn firstly, 8ul of virus mixture is dripped on the index finger, then the thumb and the index finger touch each other lightly to spread the virus mixture between the two fingers, and then the two fingers rub the leaves moderately until the liquid disappears completely. After all inoculation, the platinums are placed in a turnover box, a small amount of DEPC water is sprayed on the inner wall of the turnover box by a spray can, the turnover box is covered, the container is placed in a dark growth room with the temperature of about 23 ℃, plants grow under normal culture conditions for 24 hours, and the growth temperature is controlled to be 20-28 ℃. Sampling and identifying powdery mildew on the fourth leaf of wheat 15 days after inoculation, placing a control leaf inoculated with BAMV: gamma (inoculated with alpha chain + beta chain + gamma chain) and a TaWAK6 silent leaf (inoculated with alpha chain + beta chain + gamma: TaWAK6) inoculated with BAMV: TaWAK6 on a 6BA preservation medium, inoculating fresh powdery mildew spores by a shake-off method, and observing the disease condition of the leaves after 6-8 days of inoculation. The results show that: 6 days after inoculation with powdery mildew of the plant BAMV: TaWAK6, southern agricultural 9918 had partially lost resistance to powdery mildew compared to the control inoculated with BSMV: γ, indicating that TaWAK6 plays an important role in resistance development by southern agricultural 9918 (FIG. 2).

Example 3 construction of TaWAK6 Gene transient expression vector

TaWAK6 gene cDNA cloned in Nannong 9918 induced by powdery mildew is used as a template, primers are used for carrying out PCR amplification on TaWAK6-BamHI-F (AGTCCGGAGCTAGCTCTAGAATGTCACAAGCAAAGCTCATC, SEQ ID NO.8) and TaWAK6-KpnI-R (CCCTTGCTCACCATGGATCCTCTAGGAATTTCAGATGATTGG, SEQ ID NO.9), and an amplified fragment is recovered. PCR procedure: mu.l plasmid template (100ng/ul), 2. mu.l P3 primer (10. mu.M), 2. mu.l P4 primer, 25. mu.l Phanta Max buffer (2X), 2. mu.l dNTP Mix (10mM), 1. mu.l Phanta Max Super-Fidelity DNA polymerase (1U/. mu.l) (Vazyme, China), with water to 50. mu.l. And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 3 min; 15 seconds at 95 ℃, 15 seconds at 58 ℃,30 seconds at 72 ℃ and 35 cycles; extension at 72 ℃ for 5 minutes. The specificity and size of the amplified band were checked by 1.2% agarose gel electrophoresis of the PCR product, and the specific amplified band (AP-GX-50, Axygen) was recovered. pBI220(Jefferson RA, Kavanagh TA, Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatic gene fusion marker in high plant, EMBO J.1987,6: 3901. 3907.) was double digested with BamHI and KpnI and the vector backbone was recovered, the recovered TaWAK6 product was inserted into the digested recovered vector backbone using a homologous recombination Kit (Clon express MultiS One Step Cloning Kit, Vazyme), and TaWAK6 was placed at the multiple Cloning site behind the 35S promoter. Thus, the target gene TaWAK6 was cloned downstream of the strong promoter 35S to obtain the expression vector pBI220: TaWAK6 (FIG. 3). Sequencing verification shows that the vector construction is successful.

Example 4 transfer of TaWAK6 Gene into wheat leaves Using transient expression method

The Transient expression method is a reliable and rapid method for identifying gene function (Schweizer, Pokorny et al. A Transmission analysis System for the Functional analysis of feedback-Related Genes in Wheat Molecular plants-Microbe interactions.1999,12: 647-654.). The research utilizes an instantaneous expression method to wrap plasmid DNA on the outer layer of metal particles, bombards the metal particles and genes to epidermal cells of wheat leaves by means of a gene gun, and then counts the powdery mildew haustorium index bombarding TaWAK6 cells and the powdery mildew haustorium index not bombarding TaWAK6 cells in SM-1 leaves to determine whether a target gene has a powdery mildew disease-resistant function.

The procedure for encapsulating carrier DNA with metal particles is as follows:

preparing tungsten powder: weighing 30mg of tungsten powder into a 1.5ml eppendorf tube, adding 1ml of 70% alcohol, whirling for 3-5min, and standing for 15min to completely precipitate the tungsten powder. Centrifuge at 12000rpm for 1min and discard the supernatant. Add 1ml of ddH₂Water, vortex, mix well, centrifuge and discard supernatant (repeat three times). Finally, 500. mu.l of 50% glycerol was added and mixed by vortexing for further use.

Wrapping bullets: aspirate 5. mu.l of vortexed tungsten powder into a 1.5ml eppendorf tube and add 5. mu.l of plasmid DNA (total amount should be 1. mu.g). 50. mu.l of 2.5M CaCl was added dropwise to an eppendorf tube while vortexing₂Then 20. mu.l of 0.1M spermidine (now dispensed) was added and vortexed for 3 min. After standing for 1min, the mixture was centrifuged for 2s, and the supernatant was discarded. Add 140. mu.l 70% ethanol, vortex well, centrifuge for 2s, and discard the supernatant. Then 140. mu.l of 100% ethanol was added, vortexed thoroughly, centrifuged for 2s, and the supernatant was discarded. Finally, 15 μ l of 100% ethanol was added and vortexed thoroughly to prepare the solution for use.

When GUS gene single transformation is carried out, plasmid DNA containing a GUS gene expression vector pAHC25(Christensen AH, quick P H. ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable markers in monoclonal antibodies plants. transgenic Research,1996,5: 213. 218.) is wrapped with tungsten powder; when TaWAK6 and GUS gene cotransformation is carried out, plasmid DNA containing TaWAK6 gene expression vector pBI220: TaWAK6 and plasmid DNA containing GUS gene expression vector pAHC25 are mixed at a molar concentration of 1:1, and tungsten powder is wrapped. When the GUS gene and the TaWAK6 gene are co-transformed, the cells into which the Marker gene GUS is transferred are also cells into which the TaWAK6 is transferred. Since GUS gene-expressing cells were stained in blue color throughout the cells, blue cells were used as cells expressing TaWAK6 in this study.

The gene gun bombardment program was as follows: the end parts of wheat seedling leaves with the length of about 6cm are cut off and are pasted on glass slides in parallel, and about 6 leaves are pasted on each glass slide. The particle gun used the PDS1000/He system, using a 1350psi rupturable membrane at 28inHg vacuum. After bombardment, the leaves are placed in a porcelain plate padded with wetting filter paper, a preservative film with small holes is covered, moisture preservation and ventilation are carried out, and after recovery culture is carried out for 4 hours at the temperature of 18-20 ℃, powdery mildew conidia are inoculated at high density. Inoculating for 48 hr, and adding GUS dye solution (formula: 0.1mol/L Na)₂HPO₄/NaH₂PO₄Buffer (pH7.0) containing 10mmol/L EDTA, 5mmol/L potassium ferricyanide and potassium ferrocyanide, 0.1mg/ml X-Gluc, 0.1% Triton X-100, 20% methanol) was vacuum infiltrated for 10min, stained at 37 ℃ for 12h, then decolorized with 70% alcohol for 2 days until the leaves became white, and finally the powdery mildew spores were stained with 0.6% Coomassie Brilliant blue.

Example 5 study of the disease resistance of TaWAK6 Using transient expression method

After powdery mildew invades epidermal cells of wheat leaves, fingers produced in the epidermal cells are called haustoria. Failure of haustoria to produce normally is an important indicator of leaf cell resistance to powdery mildew. In GUS-expressing cells, the haustorium was stained blue with GUS staining solution and was easily identified under a microscope (FIG. 3). After GUS gene transformation of cells, the ratio (%) of cells formed by haustorium in GUS expressing cells interacting with Erysiphe cichoracearum was counted as the "haustorium index" (Schweizer, Pokorny et al. A transformed Assay System for the Functional Assessment of Defence-Related Genes in Wheat Molecular Plant-microorganism interactions.1999,12: 647) 654). The smaller the haustorium index, the stronger the disease resistance. The research utilizes the suction index as a measure index of disease resistance.

When the GUS gene is singly transformed, the haustorium index of infected wheat SM-1 in 528 GUS expression cells is observed to be 56.44%; when GUS gene was co-transformed with TaWAK6, 495 GUS expressing cells were counted and the haustorium index of sick wheat SM-1 was 39.20% (495 cells counted) (FIG. 4). The result shows that TaWAK6 can obviously reduce the haustorium index and has disease resistance to powdery mildew.

Sequence listing

<110> Nanjing university of agriculture

Nanjing Xinmaixiu Biotech Co., Ltd

<120> wheat cell wall related receptor protein kinase gene, expression vector and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgtcacaag caaagctcat 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcatctagga atttcagatg 20

<210> 3

<211> 2265

<212> DNA

<213> common wheat (Triticum asetivum L.)

<400> 3

atgtcacaag caaagctcat cgtcgcaacg gtgacggcac ttcagctcct catggcgaca 60

gccgtcgccg ccgtccaggt agccttacct gggtgcccgc aggcctgcgg caacgtcacc 120

gtcccctacc ctttcggctt ccggcgaggc tgctttcgca agggcttcaa cctcacctgc 180

gacgagacgc gccgtccgcc gaggctgctc ctgggcgacg gcgtggaggt ggacgccatc 240

tccctggcgg acggcacggt gcatgtgcag accaaggtcg tggcattccg accactttac 300

acaaacggtg ccgtcggcgc gaggagatct atcgaccaca actactcgtg gtacggcggc 360

ctgccggaag tgtacaagag cggcggcgcg cagctcgcgg tgtccaccga ccacaacgtc 420

tttgtggcca tcgggtgcaa cttcatcggc tacctcgtcg cagtcagcga cgggggtcgc 480

gagtatgtca gcacatgctc cacgctgtgc aacgggaaaa cccgggacgc cttgtgcacg 540

ggcgtcggct gctgctggac gaccatcgcg cagcgttacc ccgggtacca ggtgaagttc 600

aaggatttgg acgatacggc ggcagcgtac gcgggccaaa gccgtgcgtc ggtggccgcg 660

ttcatagtcg atcgcgagtg gttcgtaggc accatgcaga acactgtcag cttcaatgat 720

tttgtcaatg atgatttcgg taacggtccg tccagcatgc ccaccgtgct gcaatggtgg 780

ctagacgtag atagcgaccg tgacttggtc gtcaaggatc cacgttctgc atctcgttgg 840

agatgcataa gcttgaacag tttcgctgcc tacatcggcg acgcagtgaa caaagtaagg 900

tgcaactgct cggatggata cgaaggcaac tcttacatcg ttgacggatg tcaagatatc 960

ggtgagtgct tacggccaga tgtttatccc tgccatggaa catgcatcaa tatgccaggg 1020

acatacagat gctcagcaaa gaaaagaatc atcagcttag caggtctaat taccataata 1080

gcaatcgttg ctggttttgg actactattt tcactcctag gtgttgccca agtcacaaaa 1140

aaactcaaga aaggaagagc caagaagatc agacaaaaat tctttaagaa aaaccatgga 1200

ctgcttctac aacagttaat ctcttcgaac aaagatatag ccgaaaagat gaagattttc 1260

agcttagaag agctagaaca agcaaccaac aaatttgatc ataatcggat ccttggtggc 1320

ggtgggcatg gcacggtgta taaagccatc ttatctgatc aacgtgtcgt ggccatcaag 1380

aaggccaaaa ttgttgtgca aagggaaatc gaccagttca taaatgaggt tgccatactt 1440

tcacagataa accacaggaa tgtggtgaaa ctttttggtt gttgtctcga gacagaagtt 1500

cctctactag tttacgagtt catattgaat ggaactctct cttgtcatct ccatggcaaa 1560

agtgagaacc atttgtcatg gaaaactcga ttgaggattg ctttggaaac tgcaagggct 1620

attgcatctc tacactctgc agcttccata tcagtatacc atagagatat caaatgtgcc 1680

aatattctac ttactgatac tttaatagca aaagtatcag attttggtgc ttcaaggtca 1740

attgcaatag acgggacagg aatacttaca gttgtccaag gaacctatgg ttaccttgat 1800

cctgaatact actacacgag tcgattgacg aagaagagtg atgtttacag ttttggtgtc 1860

atcctagcag agctattgac aagtgtcaca ccagtttttt cttctcattc atcagaagga 1920

acaagcctag catcgcactt tgtatcacta atgagcggca atcgcttgtc agatattcta 1980

gatacacaaa ttattcatga aggaggagtt gaagatgctg aggtggttgc aagacttgca 2040

caagcatgct taagcttaaa aggggaagaa agacctacaa tgaggcaagt ggagacaaca 2100

cttgaagatg tgcataactc aaaggtcaag ctcagttctc agataacaag agtgaatcag 2160

agtgctatga aagatcagcc atggatgggg aacaaaggcg gtgaaggaac taggttatac 2220

agcttggaaa aggagattat ccaatcatct gaaattccta gatga 2265

<210> 4

<211> 754

<212> PRT

<213> common wheat (Triticum asetivum L.)

<400> 4

Met Ser Gln Ala Lys Leu Ile Val Ala Thr Val Thr Ala Leu Gln Leu

1 5 10 15

Leu Met Ala Thr Ala Val Ala Ala Val Gln Val Ala Leu Pro Gly Cys

20 25 30

Pro Gln Ala Cys Gly Asn Val Thr Val Pro Tyr Pro Phe Gly Phe Arg

35 40 45

Arg Gly Cys Phe Arg Lys Gly Phe Asn Leu Thr Cys Asp Glu Thr Arg

50 55 60

Arg Pro Pro Arg Leu Leu Leu Gly Asp Gly Val Glu Val Asp Ala Ile

65 70 75 80

Ser Leu Ala Asp Gly Thr Val His Val Gln Thr Lys Val Val Ala Phe

85 90 95

Arg Pro Leu Tyr Thr Asn Gly Ala Val Gly Ala Arg Arg Ser Ile Asp

100 105 110

His Asn Tyr Ser Trp Tyr Gly Gly Leu Pro Glu Val Tyr Lys Ser Gly

115 120 125

Gly Ala Gln Leu Ala Val Ser Thr Asp His Asn Val Phe Val Ala Ile

130 135 140

Gly Cys Asn Phe Ile Gly Tyr Leu Val Ala Val Ser Asp Gly Gly Arg

145 150 155 160

Glu Tyr Val Ser Thr Cys Ser Thr Leu Cys Asn Gly Lys Thr Arg Asp

165 170 175

Ala Leu Cys Thr Gly Val Gly Cys Cys Trp Thr Thr Ile Ala Gln Arg

180 185 190

Tyr Pro Gly Tyr Gln Val Lys Phe Lys Asp Leu Asp Asp Thr Ala Ala

195 200 205

Ala Tyr Ala Gly Gln Ser Arg Ala Ser Val Ala Ala Phe Ile Val Asp

210 215 220

Arg Glu Trp Phe Val Gly Thr Met Gln Asn Thr Val Ser Phe Asn Asp

225 230 235 240

Phe Val Asn Asp Asp Phe Gly Asn Gly Pro Ser Ser Met Pro Thr Val

245 250 255

Leu Gln Trp Trp Leu Asp Val Asp Ser Asp Arg Asp Leu Val Val Lys

260 265 270

Asp Pro Arg Ser Ala Ser Arg Trp Arg Cys Ile Ser Leu Asn Ser Phe

275 280 285

Ala Ala Tyr Ile Gly Asp Ala Val Asn Lys Val Arg Cys Asn Cys Ser

290 295 300

Asp Gly Tyr Glu Gly Asn Ser Tyr Ile Val Asp Gly Cys Gln Asp Ile

305 310 315 320

Gly Glu Cys Leu Arg Pro Asp Val Tyr Pro Cys His Gly Thr Cys Ile

325 330 335

Asn Met Pro Gly Thr Tyr Arg Cys Ser Ala Lys Lys Arg Ile Ile Ser

340 345 350

Leu Ala Gly Leu Ile Thr Ile Ile Ala Ile Val Ala Gly Phe Gly Leu

355 360 365

Leu Phe Ser Leu Leu Gly Val Ala Gln Val Thr Lys Lys Leu Lys Lys

370 375 380

Gly Arg Ala Lys Lys Ile Arg Gln Lys Phe Phe Lys Lys Asn His Gly

385 390 395 400

Leu Leu Leu Gln Gln Leu Ile Ser Ser Asn Lys Asp Ile Ala Glu Lys

405 410 415

Met Lys Ile Phe Ser Leu Glu Glu Leu Glu Gln Ala Thr Asn Lys Phe

420 425 430

Asp His Asn Arg Ile Leu Gly Gly Gly Gly His Gly Thr Val Tyr Lys

435 440 445

Ala Ile Leu Ser Asp Gln Arg Val Val Ala Ile Lys Lys Ala Lys Ile

450 455 460

Val Val Gln Arg Glu Ile Asp Gln Phe Ile Asn Glu Val Ala Ile Leu

465 470 475 480

Ser Gln Ile Asn His Arg Asn Val Val Lys Leu Phe Gly Cys Cys Leu

485 490 495

Glu Thr Glu Val Pro Leu Leu Val Tyr Glu Phe Ile Leu Asn Gly Thr

500 505 510

Leu Ser Cys His Leu His Gly Lys Ser Glu Asn His Leu Ser Trp Lys

515 520 525

Thr Arg Leu Arg Ile Ala Leu Glu Thr Ala Arg Ala Ile Ala Ser Leu

530 535 540

His Ser Ala Ala Ser Ile Ser Val Tyr His Arg Asp Ile Lys Cys Ala

545 550 555 560

Asn Ile Leu Leu Thr Asp Thr Leu Ile Ala Lys Val Ser Asp Phe Gly

565 570 575

Ala Ser Arg Ser Ile Ala Ile Asp Gly Thr Gly Ile Leu Thr Val Val

580 585 590

Gln Gly Thr Tyr Gly Tyr Leu Asp Pro Glu Tyr Tyr Tyr Thr Ser Arg

595 600 605

Leu Thr Lys Lys Ser Asp Val Tyr Ser Phe Gly Val Ile Leu Ala Glu

610 615 620

Leu Leu Thr Ser Val Thr Pro Val Phe Ser Ser His Ser Ser Glu Gly

625 630 635 640

Thr Ser Leu Ala Ser His Phe Val Ser Leu Met Ser Gly Asn Arg Leu

645 650 655

Ser Asp Ile Leu Asp Thr Gln Ile Ile His Glu Gly Gly Val Glu Asp

660 665 670

Ala Glu Val Val Ala Arg Leu Ala Gln Ala Cys Leu Ser Leu Lys Gly

675 680 685

Glu Glu Arg Pro Thr Met Arg Gln Val Glu Thr Thr Leu Glu Asp Val

690 695 700

His Asn Ser Lys Val Lys Leu Ser Ser Gln Ile Thr Arg Val Asn Gln

705 710 715 720

Ser Ala Met Lys Asp Gln Pro Trp Met Gly Asn Lys Gly Gly Glu Gly

725 730 735

Thr Arg Leu Tyr Ser Leu Glu Lys Glu Ile Ile Gln Ser Ser Glu Ile

740 745 750

Pro Arg

<210> 5

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gctgctagct gaagatgctg aggtggttg 29

<210> 6

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gctgctagcg gaatttcgga tgattggat 29

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

caactgccaa tcgtgagtag g 21

<210> 8

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

agtccggagc tagctctaga atgtcacaag caaagctcat c 41

<210> 9

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cccttgctca ccatggatcc tctaggaatt tcagatgatt gg 42

Claims (6)

1. A wheat cell wall related receptor protein kinase gene TaWAK6 is derived from common wheat (Triticum aestivum L.) Nannong 9918, and its ORF sequence is shown in SEQ ID NO. 3.

2. The protein encoded by the gene TaWAK6 of claim 1, wherein the amino acid sequence is shown in SEQ ID NO. 4.

3. A recombinant expression vector pBI220: TaWAK6 containing the wheat cell wall related receptor protein kinase gene TaWAK6 of claim 1.

4. The recombinant expression vector of claim 3, wherein the expression vector pBI220 TaWAK6 is prepared by inserting the wheat cell wall related receptor protein kinase gene TaWAK6 of claim 1 into the BamHI site and KpnI site of pBI220 using pBI220 as starting vector.

5. The use of the wheat cell wall associated receptor protein kinase gene TaWAK6 in the construction of powdery mildew resistant wheat variety according to claim 1.

6. The use of the expression vector pBI220: TaWAK6 in the construction of powdery mildew resistant wheat varieties according to claim 3 or 4.

Images