CN113403308B - Method for improving bacterial leaf blight resistance of rice - Google Patents
Method for improving bacterial leaf blight resistance of rice Download PDFInfo
- Publication number
- CN113403308B CN113403308B CN202011568695.5A CN202011568695A CN113403308B CN 113403308 B CN113403308 B CN 113403308B CN 202011568695 A CN202011568695 A CN 202011568695A CN 113403308 B CN113403308 B CN 113403308B
- Authority
- CN
- China
- Prior art keywords
- osrlk1
- rice
- seq
- gene
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8281—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for bacterial resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for improving rice bacterial leaf blight resistance, which is used for knocking out a rice OsRLK1 gene or inactivating the OsRLK1 gene so as to inactivate an OsRLK1 protein. The invention discloses a new molecular mechanism for regulating and controlling rice disease resistance, and provides a new method for resisting rice bacterial leaf blight, wherein a receptor-like kinase gene OsRLK1 in rice is edited by utilizing a genome in a targeted manner, so that an immune signal of the rice can be activated, and the rice disease resistance is realized.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a method for improving bacterial leaf blight resistance of rice.
Background
Rice is one of the most important grain crops in the world and is also the main grain crop in China. Rice is affected by about 70 pathogens, particularly viruses, bacteria, fungi and nematodes, during its growth, which not only deprive the rice of nutrients but also disturb the growth and development process of rice, and severely reduce yield by causing tissue damage to the host through the production of toxins, cell wall degrading enzymes and toxic proteins. How to reduce the loss caused by these diseases has been the focus of rice research. The improvement of disease resistance by genetically modifying a disease resistance gene in rice can reduce the use of pesticides and is the best practice for environmental friendliness. By gene function excavation, a new disease-resistant variety is developed to protect the rice from being damaged by pathogens, and the method has very important significance for clarifying the molecular mechanism of rice disease resistance and further improving the disease resistance and yield of the rice.
The bacterial blight of rice is bacterial wilt caused by xanthomonas oryzae, and is a bacterial disease causing the greatest harm to rice in the world. Xanthomonas relies mainly on various effectors secreted through various types of secretory protein systems to attack plants to suppress host immunity and obtain nutrition from plants. In response, plants have a precise immune system that can detect invading microorganisms and initiate defense responses.
Plant innate immunity is a bi-layer immune system consisting of Pattern Recognition Receptor (PRR) triggered immunity (PTI) and Effector Triggered Immunity (ETI) (1). The pattern recognition receptor-triggered immunity is the first line of defense in plant innate immunity, enhancing the basic defense capacity of plants to resist most invading pathogens, while the effector-triggered immune response is more often associated with an allergic response (a programmed cell death), and the plant resistance (R) gene encodes a protein that interacts with the effector of a particular pathogen and confers dominant resistance to the pathogen. Both innate immune responses and effector-triggered immunity are mediated by a complex network of signaling pathways that activate the expression of defense response genes, such as pathogenesis-related genes (PR), reactive Oxygen Species (ROS), glucanases, chitinases, secondary metabolites, stomatal closure, and callus and lignin deposition.
The most well-studied immune pathway triggered by the pattern recognition receptor in the model plant Arabidopsis thaliana is initiated by the receptor kinase FLS 2. When bound to bacterial flagellin flg22, FLS2 rapidly binds to another receptor-like kinase BAK1, activating a downstream immune response. At present, receptor-like protein kinases are more studied in the innate immunity of arabidopsis thaliana, while the disease-resistant immune response of the receptor-like protein kinases in rice is less reported, the molecular mechanism is not clear, and the disease-resistant factors in rice still need to be further researched.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provide a method for improving the bacterial leaf blight resistance of rice.
The first purpose of the invention is to provide a method for improving the bacterial leaf blight resistance of rice.
The second purpose of the invention is to provide a target sequence for constructing rice with bacterial blight resistance.
The third purpose of the invention is to provide the application of the target sequence in constructing rice resistant to bacterial blight or constructing OsRLK1 gene-deleted rice.
The fourth purpose of the invention is to provide the application of the OsRLK1 gene and/or the OsRLK1 protein inhibitor in improving the bacterial blight resistance of rice.
In order to achieve the purpose, the invention is realized by the following scheme:
the invention claims a method for improving rice bacterial leaf blight resistance, which knocks out rice OsRLK1 genes or inactivates the OsRLK1 genes to inactivate OsRLK1 proteins.
The nucleotide sequence of the rice OsRLK1 gene, namely Os06G22810, is shown as SEQ ID NO:1 is shown in the specification; the amino acid sequence of the encoded protein is shown as SEQ ID NO:2, respectively.
Preferably, the RLK1 gene is knocked out using CRISPR technology.
More preferably, the nucleotide sequence shown as SEQ ID NO:3 and/or SEQ ID NO:4 knockdown the RLK1 gene.
Most preferably, the nucleotide sequence as set forth in SEQ ID NO:3 and SEQ ID NO:4 to knock out RLK1 gene.
More preferably, the target sequence is ligated into a Cas9 vector, which is driven by the U6a promoter, to obtain a targeting vector; and (3) introducing the targeting vector into a wild rice plant through an agrobacterium-mediated genetic transformation system, and screening and/or identifying to obtain a positive transgenic plant.
More preferably, the nucleotide sequence shown as SEQ ID NO:5 to 6 for screening and/or identification.
More preferably, resistance to the Cas9 vector is screened and/or identified.
The invention also protects a target sequence for constructing rice with bacterial leaf blight resistance, and the nucleotide sequence is shown as SEQ ID NO:3 and/or SEQ ID NO:4, respectively.
More preferably, the nucleotide sequence is as set forth in SEQ ID NO:3 and SEQ ID NO:4, respectively.
And the target sequence is applied to construction of rice resistant to bacterial blight or construction of OsRLK1 gene-deleted rice.
The invention also protects the application of the inhibitor of the OsRLK1 gene and/or the OsRLK1 protein in improving the bacterial leaf blight resistance of rice.
Compared with the prior art, the invention has the following beneficial effects:
the invention discloses a new molecular mechanism for regulating and controlling rice disease resistance and provides a new method for resisting rice bacterial blight, wherein a receptor-like kinase gene OsRLK1 in rice is edited by utilizing genome targeting, so that immune signals of the rice can be activated, and the rice disease resistance is realized.
Drawings
FIG. 1 shows the editing of OsRLK1 gene: FIG. 1A is a model OsRLK1 gene, wherein the OsRLK1 gene comprises an intron and two exons, and two target points T1 and T2 are selected from the second exon as targeted editing sites; FIG. 1B shows the gene editing of 8 stably inherited mutant lines.
FIG. 2 is a CRISPR/Cas9 vector map used in the present invention.
FIG. 3 shows the active oxygen burst of OsRLK1 mutant Osrlk 1: FIG. 3A shows the Osrlk1 reactive oxygen species burst phenotype with leaf yellowing and cell death on a10 cm scale; FIG. 3B is trypan blue staining with enhanced cell death of Osrlk1 over wild type ZH11 cells; FIG. 3C is DAB staining with Osrlk1 higher than wild type ZH11 hydrogen peroxide accumulation; FIG. 3D shows NBT staining with Osrlk1 accumulating higher than wild type ZH11 superoxide anion.
FIG. 4 shows that OsRLK1 mutant Osrlk1 has the function of improving the bacterial leaf blight resistance of rice: FIG. 4A is a plot of mean and standard error for 30 biological replicates for spot length measurements of inoculated P.albilineans, orange guangdong 4, asterisks indicate 2 differences between phosphorus levels (Student's T-test), indicate significant differences (. Rho. < 0.05),. Indicate very significant differences (. Rho. < 0.01), and bars indicate 1cm; fig. 4B shows the average and standard error of spot length measurements for inoculated b.albugenosus xanthmonas oryzae pv. Oryzae guangdong 5, the asterisks indicate 2 sample-to-sample differences (Student's T-test), the asterisks indicate significant differences (ρ < 0.05), the asterisks indicate very significant differences (ρ < 0.01), and the scale indicates 1cm.
Fig. 5 shows that RLK1 mutant Osrlk1 causes activation of resistance genes and activates disease resistance signal response of rice, qRT-PCR detects seven-week-seedling resistance related genes (N = 3) of mutant Osrlk1 and wild type ZH11, the OsActin gene is used as an internal reference, asterisks represent 2 sample-to-sample differences (Student's T-test), (# 0.05) and # 0.01, and the experiment has three replicates with similar results.
Detailed Description
The present invention will be described in further detail with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention. The test methods used in the following examples are, unless otherwise specified, all conventional methods; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
Example 1 OsRLK1 Gene editing and vector transformation of wild-type Rice Z H11
1. Experimental methods
Designing a gene editing target sequence 1 according to a Nipponbare reference sequence: GAGGCTGCAAGCCGCCAACCA (SEQ ID NO: 3), and target sequence 2: AGAGCACGACGCTCGGCACG (SEQ ID NO: 4); the position of which is shown in figure 1A. Firstly, finding out the genome sequence of OsRLK1 in an NCBI website (www.ncbi.nlm.nih.gov), then selecting the two target spots from the genome sequence of OsRLK1, and respectively connecting the DNA sequences of the two target spots together into a Cas9 vector (shown in figure 2) started by a U6a promoter to obtain a double-target-spot targeting vector.
Then, the targeting vector is introduced into a wild-type rice ZH11 plant through genetic transformation mediated by agrobacterium EHA105, a transgenic plant is screened through hygromycin, and the transgenic plant is sequenced and identified by using primers OsRLK1-F and OsRLK1-R (Table 1). As a result, independently transformed individuals were obtained.
TABLE 1 primers for identification
| Gene | Primer sequence (5 '→ 3') |
| OsRLK1-F | CGAATGGTGGTCGGTCTCC(SEQ ID NO：5) |
| OsRLK1-R | ACACCTCCCTGGAAATCCT(SEQ ID NO：6) |
2. Results of the experiment
Obtaining 8 stably inherited mutant strains in total; as shown in FIG. 1B, 8 gene-edited lines all resulted in a frameshift of the amino acid or premature termination of the coding sequence, all with the same phenotype. Representative lines L1 and L3 were selected as the lines of investigation according to the invention.
Example 2 ROS and cell death assays
1. Experimental method
(1) DAB dyeing: two leaves were taken from eight-week-old mutant Osrlk1 (L1 and L3) and wild type ZH11 plants, respectively, and rapidly inserted into DAB (pH = 3.8) solution at a concentration of 1mg/mL, evacuated for 30 minutes, and then left to stand in the dark at room temperature for 5 hours, and after completion of staining, the color floated was removed in 95% ethanol, and 6 leaves were used for each genotype for measurement.
(2) NBT staining: two leaves were taken from eight-week-old mutant Osrlk1 (L1 and L3) and wild type ZH11 plants, respectively, and rapidly inserted into NBT solution at a concentration of 0.1%, evacuated for 30 minutes, and left to stand in the dark at room temperature for 3 hours, and after completion of dyeing, the color separation was carried out in 95% ethanol, and 6 leaves were used for each genotype for measurement.
(3) Trypan blue staining: outburst from eight weeks of ageTwo leaves of the variant Osrlk1 (L1 and L3) and wild type ZH11 plants were removed and trypan blue (10 g phenol, 10 ml glycerol, 10 ml lactic acid, 10 ml ddH) was quickly inserted into the leaves 2 O,0.02 g Trypan Blue) solution, boiling for two minutes, treating at room temperature overnight, and decolorizing with 250 g chloral hydrate in 100ml ddH the next day 2 O) to remove the flooding.
2. Results of the experiment
As in fig. 3, mutant Osrlk1 died to a higher degree than wild-type ZH 11; the mutant Osrlk1 has higher hydrogen peroxide accumulation amount than that of the wild ZH 11; the mutant Osrlk1 has higher superoxide anion accumulation than wild type ZH 11. Indicating that the mutant has ROS outbreak and cell death related to disease resistance.
EXAMPLE 3 Rhizoctonia solani test
1. Experimental methods
Inoculating by leaf-cutting method, using two strains Xanthomonas oryzae pv. Oryzae guard 4 (FIG. 3A) and Xanthomonas oryzae pv. Oryzae guard 5 (FIG. 3B), culturing in an incubator at 28 deg.C for 2 days to bright yellow, diluting with PBS solution, and diluting to a concentration of about 9X 10 by turbidimetric method 9 bacteria/mL. (strains from institute for plant protection, academy of agricultural sciences, guangdong province), mutant Osrlk1 (L1 and L3) and wild type ZH11 plants were inoculated at the booting stage of rice. The bacterial solution was dipped with scissors during inoculation, the length of about 2cm of the leaf was cut off, and the lesion length was measured 21 days after inoculation.
2. Results of the experiment
As shown in fig. 4, the length of the lesion of the mutant Osrlk1 inoculated with Xanthomonas oryzae pv. Oryzae guangdong 4 (fig. 4A) was significantly shorter, and the length of the lesion of the mutant Osrlk1 inoculated with Xanthomonas oryzae pv. Oryzae guangdong 5 (fig. 4B) was also shorter than that of the wild type, indicating that the mutant Osrlk1 had a definite effect of resisting bacterial blight, and simultaneously confirming that the Osrlk1 gene is involved in the disease resistance regulation network.
Example 4 real-time quantitative PCR (qRT-PCR) analysis
1. Experimental methods
RNA is respectively extracted from eight-week-old mutant Osrlk1 and wild type ZH11 plant leavesReverse transcription and qRT-PCR detection are carried out, and OsActin gene is taken as an internal reference 2 -△△CT The relative level of gene expression is calculated by a function, the genes for detection comprise OsWRKY45, osWRKY50, osPR5, osPBZ1 and OsNAC4, and primers are shown in Table 2.
TABLE 2qRT-PCR primers
2. Results of the experiment
As shown in figure 5, disease-resistant related genes OsWRKY45, osWRKY50, osPR5, osPBZ1 and OsNAC4 are all significantly up-regulated in the mutant Osrlk1, which indicates that the mutation of the OsRLK1 gene can cause the activation of resistance genes and activate the disease-resistant signal response of rice.
It should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention, and not for limiting the scope of the present invention, and those skilled in the art can make other variations or modifications based on the above description and ideas, and it is not necessary or exhaustive to all embodiments. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.
Sequence listing
<110> south China university of agriculture
<120> a method for improving the bacterial leaf blight resistance of rice
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2580
<212> DNA
<213> Oryza sativa
<400> 1
atgcccgccg cgcggcgctc cggcggacgg cttacggagg aggtgaacat gatggtggct 60
ctgtccggga ggaagaggag gctgcaagcc gcaaccatgg tggctttgtg tttcttgtca 120
tccatttgcg tttccacagc gcaattcaag cctgccgaca actacctggt ggactgcgga 180
tcctccaaga gcacgacgct cggcacgagg acctttgcgg ctgacggggc tgccccggtg 240
aaggtggaca cctccctgga aatccttgcc ggcacgtcgg cgaatggggt tgcgtcattc 300
gataactcgg cgctttacca gaccgcccgc atcttcacga gcccttcatc gtatactttc 360
ccgatccaga agcagggccg gcattttgtt cgtctctact tcttcgcctt tgcctaccag 420
agctatgatc tttccactgc caagttcacc gtgtcgaccc aagaaatgct cttgcttagt 480
gacttccaac agccagacaa gactgcgcca ttgttcaagg aatactcttt gaacatcacc 540
caagacaagc tcattatttc cttcaagcca tcgaatggaa tcgcattcat caatgcgatt 600
gaagtggttt cagtcccaga tgatctcata ggtgatagtg ccccgatggt caaccctatg 660
cagcagtaca gcggtttatc tacacaacca ttggaaacag tgtaccgtgt taacatgggt 720
ggaccaaagg tcactgcaga caatgatacc ctctccagga cctgggtcac tgacaaaaag 780
tatttagtga acccatctgt gactagagag gttaatgggg ggaaggtcaa ttatatgaaa 840
ggtggaggat caacaccgct gattgctcct gatattgttt atagcacagc tacagaattg 900
gcagcttcga atacaacgaa cgcacttttc aacatgacat ggcagtttga tgtggattca 960
ggtttcagct acttgataag atttcacttc tgtgatatag tcagcaaggc acttaaccaa 1020
ctctatttca atgcatatgt tggcagcttc tatgcgcagc atgatattga tctctcaatt 1080
caatcaatga atcagttggc tacagctatc tatttggatg tggttctttc atcaaatgat 1140
gcatctaaca agctcagcat cagtattggt ccatccactt tgaacaatgc attaccagat 1200
gggattctga atggtcttga ggtcatgaag atgagcagtg gctcaggttc tgctttcact 1260
gttggatcat ctggttcaaa caagaattta ggtgtgatta ttgggtcagt ccttggagct 1320
gttggtattc tgataattgt ccttgtcata gtacttcttt gccgaaagaa aaagactctg 1380
gagaagcagc actcaaagac ttggatgcct ttctctatca atgggctcac ctctctcagt 1440
acaggaagta gaacttctta tggtactact ctcacatcag ggctgaatgg aagctatgga 1500
taccgatttg cctttagcgt gctccaagaa gcaacaaaca attttgatga gaactgggtt 1560
attggcgttg gaggttttgg gaaggtctac aaaggtgtgc tgagggatga caccaaggtt 1620
gcagtgaagc gagggaaccc gaagtctcag caaggtctca atgagttccg tacagagatc 1680
gaactccttt cacggctgcg gcaccgccat ctggtgtccc tgattgggta ttgtgatgaa 1740
aggaatgaga tgatcttggt ctatgaatat atggaaaaag ggactctgaa aagccacctg 1800
tatggctcgg ataacccctc actcaactgg aagcagcggt tggagatttg cattggagca 1860
gcaaggggac ttcactacct tcataccggt tctgcgaagg ctattatcca ccgtgatgtc 1920
aagtctgcaa acatcttgct tgatgagaat ctcctagcaa aggttgctga ctttgggcta 1980
tcaaagactg ggcctgagtt ggaccaaact catgtcagta ctgcagtgaa gggtagcttt 2040
gggtatcttg accctgaata tttccgaagg cagcaactga ctgagaagtc agatgtctac 2100
tccttcggtg ttgttttgct cgaggtgctt tgcgcaaggc cagtgattga ccctacgctc 2160
ccaagggaga tggtgaattt ggcagagtgg gggatgaaat ggcagaagag aggagagctg 2220
catcagatcg tcgatcagcg agtttctggt tcaatcaggc cggattctct gaggaagttt 2280
ggcgaaacag tggagaaatg cctggcggac tacggtgtgg agcggccatc catgggagat 2340
gtcctgtgga acttggagta cgtcctgcag ctccaggatg cagattcatc gacagtatca 2400
gatgtaaaca gcatgaacag gattgtcgaa ctcccgtcgc aagtccagaa catcggcgcc 2460
ctcgagagca tcagcgtgac aatggcggaa gctggagctt cacatgagcc tgatcatgac 2520
ctctccgacg tttccatgag cagggtgttc tctcagctaa tcaaagctga gggaaggtga 2580
<210> 2
<211> 859
<212> PRT
<213> Oryza sativa
<400> 2
Met Pro Ala Ala Arg Arg Ser Gly Gly Arg Leu Thr Glu Glu Val Asn
1 5 10 15
Met Met Val Ala Leu Ser Gly Arg Lys Arg Arg Leu Gln Ala Ala Thr
20 25 30
Met Val Ala Leu Cys Phe Leu Ser Ser Ile Cys Val Ser Thr Ala Gln
35 40 45
Phe Lys Pro Ala Asp Asn Tyr Leu Val Asp Cys Gly Ser Ser Lys Ser
50 55 60
Thr Thr Leu Gly Thr Arg Thr Phe Ala Ala Asp Gly Ala Ala Pro Val
65 70 75 80
Lys Val Asp Thr Ser Leu Glu Ile Leu Ala Gly Thr Ser Ala Asn Gly
85 90 95
Val Ala Ser Phe Asp Asn Ser Ala Leu Tyr Gln Thr Ala Arg Ile Phe
100 105 110
Thr Ser Pro Ser Ser Tyr Thr Phe Pro Ile Gln Lys Gln Gly Arg His
115 120 125
Phe Val Arg Leu Tyr Phe Phe Ala Phe Ala Tyr Gln Ser Tyr Asp Leu
130 135 140
Ser Thr Ala Lys Phe Thr Val Ser Thr Gln Glu Met Leu Leu Leu Ser
145 150 155 160
Asp Phe Gln Gln Pro Asp Lys Thr Ala Pro Leu Phe Lys Glu Tyr Ser
165 170 175
Leu Asn Ile Thr Gln Asp Lys Leu Ile Ile Ser Phe Lys Pro Ser Asn
180 185 190
Gly Ile Ala Phe Ile Asn Ala Ile Glu Val Val Ser Val Pro Asp Asp
195 200 205
Leu Ile Gly Asp Ser Ala Pro Met Val Asn Pro Met Gln Gln Tyr Ser
210 215 220
Gly Leu Ser Thr Gln Pro Leu Glu Thr Val Tyr Arg Val Asn Met Gly
225 230 235 240
Gly Pro Lys Val Thr Ala Asp Asn Asp Thr Leu Ser Arg Thr Trp Val
245 250 255
Thr Asp Lys Lys Tyr Leu Val Asn Pro Ser Val Thr Arg Glu Val Asn
260 265 270
Gly Gly Lys Val Asn Tyr Met Lys Gly Gly Gly Ser Thr Pro Leu Ile
275 280 285
Ala Pro Asp Ile Val Tyr Ser Thr Ala Thr Glu Leu Ala Ala Ser Asn
290 295 300
Thr Thr Asn Ala Leu Phe Asn Met Thr Trp Gln Phe Asp Val Asp Ser
305 310 315 320
Gly Phe Ser Tyr Leu Ile Arg Phe His Phe Cys Asp Ile Val Ser Lys
325 330 335
Ala Leu Asn Gln Leu Tyr Phe Asn Ala Tyr Val Gly Ser Phe Tyr Ala
340 345 350
Gln His Asp Ile Asp Leu Ser Ile Gln Ser Met Asn Gln Leu Ala Thr
355 360 365
Ala Ile Tyr Leu Asp Val Val Leu Ser Ser Asn Asp Ala Ser Asn Lys
370 375 380
Leu Ser Ile Ser Ile Gly Pro Ser Thr Leu Asn Asn Ala Leu Pro Asp
385 390 395 400
Gly Ile Leu Asn Gly Leu Glu Val Met Lys Met Ser Ser Gly Ser Gly
405 410 415
Ser Ala Phe Thr Val Gly Ser Ser Gly Ser Asn Lys Asn Leu Gly Val
420 425 430
Ile Ile Gly Ser Val Leu Gly Ala Val Gly Ile Leu Ile Ile Val Leu
435 440 445
Val Ile Val Leu Leu Cys Arg Lys Lys Lys Thr Leu Glu Lys Gln His
450 455 460
Ser Lys Thr Trp Met Pro Phe Ser Ile Asn Gly Leu Thr Ser Leu Ser
465 470 475 480
Thr Gly Ser Arg Thr Ser Tyr Gly Thr Thr Leu Thr Ser Gly Leu Asn
485 490 495
Gly Ser Tyr Gly Tyr Arg Phe Ala Phe Ser Val Leu Gln Glu Ala Thr
500 505 510
Asn Asn Phe Asp Glu Asn Trp Val Ile Gly Val Gly Gly Phe Gly Lys
515 520 525
Val Tyr Lys Gly Val Leu Arg Asp Asp Thr Lys Val Ala Val Lys Arg
530 535 540
Gly Asn Pro Lys Ser Gln Gln Gly Leu Asn Glu Phe Arg Thr Glu Ile
545 550 555 560
Glu Leu Leu Ser Arg Leu Arg His Arg His Leu Val Ser Leu Ile Gly
565 570 575
Tyr Cys Asp Glu Arg Asn Glu Met Ile Leu Val Tyr Glu Tyr Met Glu
580 585 590
Lys Gly Thr Leu Lys Ser His Leu Tyr Gly Ser Asp Asn Pro Ser Leu
595 600 605
Asn Trp Lys Gln Arg Leu Glu Ile Cys Ile Gly Ala Ala Arg Gly Leu
610 615 620
His Tyr Leu His Thr Gly Ser Ala Lys Ala Ile Ile His Arg Asp Val
625 630 635 640
Lys Ser Ala Asn Ile Leu Leu Asp Glu Asn Leu Leu Ala Lys Val Ala
645 650 655
Asp Phe Gly Leu Ser Lys Thr Gly Pro Glu Leu Asp Gln Thr His Val
660 665 670
Ser Thr Ala Val Lys Gly Ser Phe Gly Tyr Leu Asp Pro Glu Tyr Phe
675 680 685
Arg Arg Gln Gln Leu Thr Glu Lys Ser Asp Val Tyr Ser Phe Gly Val
690 695 700
Val Leu Leu Glu Val Leu Cys Ala Arg Pro Val Ile Asp Pro Thr Leu
705 710 715 720
Pro Arg Glu Met Val Asn Leu Ala Glu Trp Gly Met Lys Trp Gln Lys
725 730 735
Arg Gly Glu Leu His Gln Ile Val Asp Gln Arg Val Ser Gly Ser Ile
740 745 750
Arg Pro Asp Ser Leu Arg Lys Phe Gly Glu Thr Val Glu Lys Cys Leu
755 760 765
Ala Asp Tyr Gly Val Glu Arg Pro Ser Met Gly Asp Val Leu Trp Asn
770 775 780
Leu Glu Tyr Val Leu Gln Leu Gln Asp Ala Asp Ser Ser Thr Val Ser
785 790 795 800
Asp Val Asn Ser Met Asn Arg Ile Val Glu Leu Pro Ser Gln Val Gln
805 810 815
Asn Ile Gly Ala Leu Glu Ser Ile Ser Val Thr Met Ala Glu Ala Gly
820 825 830
Ala Ser His Glu Pro Asp His Asp Leu Ser Asp Val Ser Met Ser Arg
835 840 845
Val Phe Ser Gln Leu Ile Lys Ala Glu Gly Arg
850 855
<210> 3
<211> 20
<212> DNA
<213> Oryza sativa
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Oryza sativa
<400> 4
<210> 5
<211> 19
<212> DNA
<213> Oryza sativa
<400> 5
cgaatggtgg tcggtctcc 19
<210> 6
<211> 19
<212> DNA
<213> Oryza sativa
<400> 6
acacctccct ggaaatcct 19
Claims (6)
1. A method for improving the rice bacterial leaf blight resistance is characterized in that a rice OsRLK1 gene is knocked out by using a CRISPR technology, or the OsRLK1 gene is inactivated, so that OsRLK1 protein is inactivated; the nucleotide sequence of the OsRLK1 gene is shown as SEQ ID NO:1 is shown in the specification; the amino acid sequence of the OsRLK1 protein is shown as SEQ ID NO:2 is shown in the specification;
the nucleotide sequence of the target sequence knocked out by the CRISPR technology is shown as SEQ ID NO:3 and SEQ ID NO:4, respectively.
2. The method of claim 1, wherein the target sequence is ligated into a Cas9 vector initiated by a U6a promoter to obtain a targeting vector; and introducing the targeting vector into a wild rice plant through an agrobacterium-mediated genetic transformation system, and screening and/or identifying to obtain a positive transgenic plant.
3. The method of claim 2, wherein the nucleotide sequence set forth in SEQ ID NO:5 to 6 for screening and/or identification.
4. The method of claim 2, wherein positive plants are selected and/or identified by resistance to the Cas9 vector.
5. The target sequence is applied to construction of bacterial leaf blight resistant rice or construction of OsRLK1 gene deletion rice through a CRISPR technology;
the nucleotide sequence of the OsRLK1 gene is shown as SEQ ID NO:1 is shown in the specification;
the nucleotide sequence of the target sequence is shown as SEQ ID NO:3 to 4.
The application of an OsRLK1 gene and/or an OsRLK1 protein inhibitor in improving the bacterial leaf blight resistance of rice;
the nucleotide sequence of the OsRLK1 gene is shown as SEQ ID NO:1 is shown in the specification; the amino acid sequence of the OsRLK1 protein is shown as SEQ ID NO:2 is shown in the specification;
the inhibitor is an inhibitor for knocking out RLK1 gene by using CRISPR;
the nucleotide sequence of the CRISPR knocked-out target sequence is shown as SEQ ID NO:3 and SEQ ID NO:4, respectively.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011568695.5A CN113403308B (en) | 2020-12-25 | 2020-12-25 | Method for improving bacterial leaf blight resistance of rice |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011568695.5A CN113403308B (en) | 2020-12-25 | 2020-12-25 | Method for improving bacterial leaf blight resistance of rice |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113403308A CN113403308A (en) | 2021-09-17 |
| CN113403308B true CN113403308B (en) | 2022-10-21 |
Family
ID=77677523
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011568695.5A Active CN113403308B (en) | 2020-12-25 | 2020-12-25 | Method for improving bacterial leaf blight resistance of rice |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113403308B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115011618B (en) * | 2022-06-09 | 2023-06-02 | 华南农业大学 | Method for improving water transport efficiency of rice and/or promoting xylem growth of rice |
| CN117305267B (en) * | 2023-08-09 | 2024-05-28 | 中国农业大学 | New application of grape receptor protein kinase HERK1 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017103582A1 (en) * | 2015-12-15 | 2017-06-22 | Rothamsted Research Limited | Plant fungal resistance gene |
| CN110699369A (en) * | 2019-10-18 | 2020-01-17 | 中国农业科学院作物科学研究所 | Rice receptor kinase gene OsRLCK21 and protein coded by same and application thereof |
| CN110791487A (en) * | 2019-11-25 | 2020-02-14 | 中国科学院遗传与发育生物学研究所 | Rice receptor kinase gene LOC _ Os11g47290, and coding protein and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3447134B1 (en) * | 2017-08-22 | 2023-10-11 | KWS SAAT SE & Co. KGaA | Increased fungal resistance in crop plants |
| CN111826364B (en) * | 2019-03-28 | 2022-12-27 | 中国科学院分子植物科学卓越创新中心 | Disease and pest resistance related gene and application thereof |
-
2020
- 2020-12-25 CN CN202011568695.5A patent/CN113403308B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017103582A1 (en) * | 2015-12-15 | 2017-06-22 | Rothamsted Research Limited | Plant fungal resistance gene |
| CN110699369A (en) * | 2019-10-18 | 2020-01-17 | 中国农业科学院作物科学研究所 | Rice receptor kinase gene OsRLCK21 and protein coded by same and application thereof |
| CN110791487A (en) * | 2019-11-25 | 2020-02-14 | 中国科学院遗传与发育生物学研究所 | Rice receptor kinase gene LOC _ Os11g47290, and coding protein and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 水稻OsRLK1基因的生物学功能分析;杨邦邦;《中国优秀硕士学位论文全文数据库 基础科学辑》;20200815;第A006-72页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113403308A (en) | 2021-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Duan et al. | Natural variation in the promoter of GSE5 contributes to grain size diversity in rice | |
| Idnurm et al. | Spontaneous and CRISPR/Cas9-induced mutation of the osmosensor histidine kinase of the canola pathogen Leptosphaeria maculans | |
| WO2018113702A1 (en) | Plant grain trait-related protein, gene, promoter and snps and haplotypes | |
| Sun et al. | Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase‐like protein | |
| Undan et al. | Mutation in OsLMS, a gene encoding a protein with two double-stranded RNA binding motifs, causes lesion mimic phenotype and early senescence in rice (Oryza sativa L.) | |
| US20100192254A1 (en) | Method of increasing resistance against soybean rust in transgenic plants | |
| US11066677B2 (en) | Plants with enhanced tolerance to multiple abiotic stresses | |
| EP2013341A2 (en) | Disease-inducible promoters | |
| CN107759676B (en) | Plant amylose synthesis related protein Du15, and coding gene and application thereof | |
| CN115161339B (en) | Method for enhancing heat resistance of tomatoes by inducing SlWRKY3 genes at high temperature | |
| CN113403308B (en) | Method for improving bacterial leaf blight resistance of rice | |
| Chen et al. | TaEDS1 genes positively regulate resistance to powdery mildew in wheat | |
| Yang et al. | The PcMYB44‐mediated miR397‐PcLACs module regulates defence‐induced lignification in pear resistance to fungal disease | |
| CN103937812A (en) | Application of trait control gene SPL29 of rice spotted leaf on senescence and disease resistance | |
| Li et al. | Overexpression of MpbHLH transcription factor, an encoding ICE1-like protein, enhances Foc TR4-resistance of Cavendish banana | |
| CN113249395B (en) | Application of soybean agglutinin receptor kinase Rsc7-1 coding gene | |
| WANG et al. | Functional analysis of a wheat pleiotropic drug resistance gene involved in Fusarium head blight resistance | |
| AU2004253987A1 (en) | Nod-factor perception | |
| EP3010329A1 (en) | Method for identifying substances which prime cells for a stress response and cells for use in this method | |
| Di et al. | Complementary DNA (cDNA) cloning and functional verification of resistance to head smut disease (Sphacelotheca reiliana) of an NBS–LRR gene ZmNL in maize (Zea mays) | |
| CN108795949B (en) | Rice leaf color regulation related gene OsWSL6 and encoding protein and application thereof | |
| Gho et al. | Tissue-specific enhancement of OsRNS1 with root-preferred expression is required for the increase of crop yield | |
| Gao et al. | ZmXa21-L gene encodes a plant receptor-like kinases (RLKs) protein that enhances resistance to bacterial blight in rice | |
| BR102013007201B1 (en) | COMPOSITIONS AND METHODS CONTAINING LEAF SPECIFIC PROMOTER TO MODIFY THE EXPRESSION OF GENES OF INTEREST IN PLANTS | |
| CN114790449B (en) | Application of calpain gene GhCPK4 in verticillium resistance of plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |