CN109280671A - One Wheat cell wall associated receptor protein kinase gene and its expression vector and application - Google Patents

Abstract

The invention belongs to genetic engineering field, a cell wall associated receptor protein kinase gene TaWAK6 and its expression vector and application in wheat are disclosed.The cDNA sequence of TaWAK6 is SEQ ID NO.3 and its amino acid sequence of coding is SEQ ID NO.4.The gene comes from common wheat (Triticum asetivum L.) Nan Nong 9918.TaWAK6 is enhanced in powdery-mildew-resistance wheat kind south agriculture 9918 by powdery mildew inducing expression, and expression is much higher than the expression in susceptible Wheat Mutant SM-1.TaWAK6 silencing in southern agriculture 9918 is induced by virus mediated gene silent technology, powder mildew resistance can be made to significantly reduce；The susceptible Wheat Mutant SM-1 of the genetic transformation can be such that haustorium index significantly reduces, powder mildew resistance improves by Transient Expression.Therefore, TaWAK6 can be used for genetic engineering breeding, be conducted into susceptible powdery mildew wheat breed, be expected to improve the powder mildew resistance of wheat.

Description

One Wheat cell wall associated receptor protein kinase gene and its expression vector and application

Technical field

The invention belongs to genetic engineering field, disclose in wheat a cell wall associated proteins kinase gene TaWAK6 and Its expression vector and application.

Background technique

Wheat (Triticum aestivum) is a kind of worldwide cereal crops, adaptable, have a very wide distribution, entirely There are about the populations of 35%-40% in the world using wheat as main food, provides about 20% protein and 21% food heat for the mankind It measures (Li Litai, 2006).China is the first big country of global wheat planting and yield, and average annual output accounts for about global total output 17%；Wheat is the third-largest cereal crops at home, and total output is only second to rice and corn (bibliography: He Zhonghu, Zhuan Qiao Raw, Cheng Shunhe waits the industry development of Wheat in China and scientific and technological progress [J] agricultural journal, 2018 (1): 99-106.).China's wheat Production not only plays a significant role in ensureing domestic grain security, but also will affect ternational grain safety.

Harm of the wheat entire breeding time by a variety of disease pests, wherein by wheat powdery mildew (Blurmeria Graminis f.sp.tritici, Bgt) caused by wheat powdery mildew be that Wheat Production is influenced in world wide is the most serious One of fungal disease has become the Major Diseases (bibliography: Zhan Haixian, smooth will for endangering the safety in production of China's wheat at present Heavily fortified point, Yang Zujun wait progress [J] China's agronomy of powdery mildew resistance gene in wheat source and evaluation of resistance to be notified to, and 2010,26 (10):42-46.).Serious area occurs in disease and still relies primarily on Agro-chemicals control, damages food and ecological safety. Cultivating disease-resistant variety is prevention and treatment wheat powdery mildew, guarantees wheat safety in production method the most cost-effective.Due to wheat white powder Biological Strains of The Pest is more, toxicity variation is fast, changes once generating new toxicity microspecies or microspecies population, will lead to white wheat Agricultural production bringing on a disaster property consequence is given in the great outburst of powder disease.The excavation and utilization of broad spectrum durable disease-resistant gene are anti-to powdery mildew Jig is significant, is the premise and guarantee (Kuraparthy et al., 2007) for cultivating permanent disease-resistant kind.

Haynaldia villosa (Haynaldia villosa, 2n=2x=14, VV) is wheat affinity species, is carried multiple disease-resistant, anti- Common wheat genetic diversity can be improved in haynaldia villosa disease-resistant gene importing common wheat by inverse gene.Agricultural University Of Nanjing's cell The utilized tetraploid duckbill wheat of genetic research hybridizes with Dasypyrum villosum, then with after common wheat backcrossing mostly generation, selects Triticum aestivum-Haynaldia villosa translocation line T6VS6AL (bibliography: Chen PD, Qi LL, Zhou B, Zhang SZ, Liu DJ(1995)Development and molecular cytogenetic analysis of wheat-Haynaldia villosa 6VS/6AL translocation lines specifying resistance to powdery Mildew.Theor Appl Genet 91:1125-1128.), the high mildew-resistance gene of wide spectrum that will be carried on haynaldia villosa 6VS Pm21 imports common wheat.Since T6VS6AL entered domestic breeding utilization from 1994, more than 30 anti-white powder have been selected Sick wheat new varieties become the important germ plasm resource of China's powdery mildew disease-resistant breeding, and Pm21 also becomes the main white powder in China The anti-source gene of disease.Although Pm21 gene be cloned (bibliography: Xing, P.Hu, J.Liu, K.Witek, S.Zhou, J.Xu, W.Zhou,L.Gao,Z.Huang,R.Zhang,X.Wang,P.Chen,H.Wang,J.D.G.Jones,M.Karafiátová, J.Vrána,J.J.Y.Tian,Y.Wu,A.Cao,Pm21from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powdery mildew resistance in wheat,Mol.Plant (2018) doi:10.1016/j.molp.2018.02.013.), but there is which gene to participate in mesh in the resistance pathway of its mediation It is preceding not clear.The resistance of wide spectrum mechanism and clone the gene in its disease-resistant approach that Pm21 is mediated are analyzed, for utilizing gene work Journey means are cultivated, and there is the wheat breed of powdery mildew resistance of wide spectrum to be of great significance.

Summary of the invention

The purpose of the present invention is in view of the above drawbacks of the prior art, provide a cell wall associated receptor protein kinase base Expression vector and application because of TaWAK6.

The purpose of the present invention can be achieved through the following technical solutions:

Cell wall associated receptor protein kinase gene TaWAK6 is from the south common wheat (Triticum asetivum L.) Agriculture 9918, nucleotides sequence are classified as SEQ ID NO.3.

The protein of the cell wall associated receptor protein kinase gene is TaWAK6, and amino acid sequence is SEQ ID NO.4。

Recombinant expression carrier pBI220 containing the cell wall associated receptor protein kinase gene TaWAK6: TaWAK6。

The recombinant expression carrier of the cell wall associated receptor protein kinase gene TaWAK6 is preferably with pBI220 Carrier is sent out, by gained between BamHI the and KpnI restriction enzyme site of TaWAK6 gene insertion pBI220.

The expression vector of the cell wall associated receptor protein kinase gene TaWAK6 is in building powdery-mildew-resistance wheat product Application in kind.

The utility model has the advantages that

The present invention is cloned from wheat have been obtained a cell wall associated receptor protein kinase gene TaWAK6 and its has been compiled The protein TaWAK6 of code, is inserted into expression vector pBI220, and the Overexpression vector of the obtained gene imports susceptible small In wheat variety, sense powdery mildew wheat breed can be improved to the resistance of powdery mildew.The overexpression carrier of TaWAK6 is used for gene Engineering Breeding is conducted into susceptible powdery mildew wheat breed, can obtain the wheat germplasm for having powder mildew resistance.

Detailed description of the invention

Fig. 1 BSMV:TaWAK6 carrier digestion verification figure

M:DL2000Marker；1:BSMV:TaWAK6 plasmid；2:BSMV:TaWAK6 plasmid is through NheI digestion；

Fig. 2 TaWAK6 silencing in southern agriculture 9918 can lead to powder mildew resistance and be remarkably decreased

1, powdery mildew impaired development in the blade of inoculation BSMV: γ, the resistance of Nan Nong 9918 are uninfluenced；

2,3: being inoculated with powdery mildew development in the blade of BSMV:TaWAK6, normally, the resistance of Nan Nong 9918 is remarkably decreased；

Fig. 3 pBI220:TaWAK6 overexpression Vector map

TaWAK6 is inserted between the BamHI and KpnI of pBI220, is placed in 35S promoter downstream

The influence and mildew-resistance effect that Fig. 4 is formed using Transient Expression research TaWAK6 gene pairs haustorium

TaWAK6 moment overexpression in susceptible material can significantly inhibit the formation of powdery mildew haustorium and improve powdery mildew Resistance

Specific embodiment

The clone of a cell wall associated receptor protein kinase gene TaWAK6 in the southern agriculture 9918 of embodiment 1

Southern agriculture 9918 is the wheat containing wide spectrum powdery mildew resistance gene Pm 21 that Agricultural University Of Nanjing's cytogenetics is bred as (public, bibliography: Chen Peidu, Zhang Shouzhong, Wang Xiue, Wang Suling, cycle, Feng's Yi is high, the big anti-white powder of an ancient unit of weight of Liu for kind Sick 9918. Agricultural University Of Nanjing's journal of High-yield Wheat new varieties Nan Nong, 2002,25 (4): 1438-1444), SM-1 is Nanjing agriculture Sparetime university is learned handle southern agriculture 9918 with EMS after screen acquisition sense powdery mildew mutant (public, bibliography: Xing, P.Hu,J.Liu,K.Witek,S.Zhou,J.Xu,W.Zhou,L.Gao,Z.Huang,R.Zhang,X.Wang,P.Chen, H.Wang,J.D.G.Jones,M.Karafiátová,J.Vrána,J.J.Y.Tian,Y.Wu,A.Cao, Pm21from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powdery mildew resistance in wheat,Mol.Plant(2018)doi:10.1016/j.molp.2018.02.013.).For Southern agriculture 9918 is screened by the gene of powdery mildew inducing expression, powdery-mildew-resistance wheat south agriculture is obtained using the method for high-flux sequence 9918 with sense powdery mildew mutant SM-1 (public, bibliography: Xing, P.Hu, J.Liu, K.Witek, S.Zhou, J.Xu,W.Zhou,L.Gao,Z.Huang,R.Zhang,X.Wang,P.Chen,H.Wang,J.D.G.Jones,M.Karafiá tová,J.Vrána,J.J.Y.Tian,Y.Wu,A.Cao,Pm21from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powdery mildew resistance in wheat, Mol.Plant (2018) doi:10.1016/j.molp.2018.02.013.) digital gene express spectra, and on this basis Screen the difference expression gene in anti-sense material.Detailed process is as follows: by the seed of powdery-mildew-resistance wheat south agriculture 9918 and feeling white The seed of powder sick wheat SM-1, which is sowed in culture dish, to germinate, and is transplanted to basin alms bowl after showing money or valuables one carries unintentionally, and a leaf phase is from sense white powder sick wheat material The powdery mildew spores collected on material are inoculated on seedling and are induced, and 24 hours before inoculation and after inoculation sample, biology weight Again three times.It is extracted respectively RNA (Invitrogen, USA) using Trizol reagent, form sequencing sample: (Nan Nong 9918 is lured R24 Lead 24 hours three biology repeat samples), R0 (three Nan Nong 9918 non-induced biology repeat samples), S24 (SM-1 24 hours three biology repeat samples of induction), S0 (three SM-1 non-induced biology repeat samples).Four RNA are sent Beijing Liuhe Huada Genomics Technology Co., Ltd is handed over to carry out the sequencing of digital gene express spectra.The comparison of sample room data, Including R24vs R0, S24vs S0, R24vs S24, it is greater than 2 so that the ratio of item number is sequenced for standard, screens in southern agriculture 9918 The gene of inducible up regulation expression.One of difference expression gene is Ta#S58887995, which is a cell wall correlation Receptor protein kinase gene, the gene are shown as difference expression gene when R24 is compared with R0, i.e., should in disease-resistant southern agriculture 9918 Gene is by powdery mildew inducing expression；Non- difference expression gene is shown as when S24 is compared with S0, i.e., the gene in susceptible SM-1 Not by powdery mildew expression profile；Difference expression gene is shown as when R24 is compared with S24, i.e., disease-resistant southern agriculture 9918 with Susceptible SM-1 powdery mildew induces the expression of 24 hours genes to have differences.Based on the analysis of digital gene express spectra, tentatively sentence Disconnected Ta#S58887995 and powder mildew resistance have Close relation.

On the south the RNA reverse transcription that induces 24 hours blades to extract through powdery mildew of agriculture 9918 at cDNA be template, with root According to primer P1 (ATGTCACAAGCAAAGCTCAT, the SEQ of the gene Ta#S58887995 design of digital gene express spectra screening ID NO.1) and P2 (TCATCTAGGAATTTCAGATG, SEQ ID NO.2) be primer carry out RT-PCR, obtain Ta# The cDNA full length fragment of S58887995 gene.PCR process is as follows: the P1 primer (10 of 5 μ l cDNA templates (100ng/ul), 2 μ l μM), the P2 primer of 2 μ l, 25 μ l Phanta Max buffer (2 ×), 2 μ l dNTP Mix (10mM), 1 μ l Phanta Max Super-Fidelity DNA polymerase (1U/ μ l) (Vazyme, China), adds water to 50 μ l.PCR reaction condition: 95 DEG C initial denaturation 3 minutes；95 DEG C 15 seconds, 60 DEG C 40 seconds, 72 DEG C 2 minutes, 35 circulation；72 DEG C extend 10 minutes.PCR product warp The specificity and size of 1.2% agarose gel electrophoresis detection amplified band, recycling specific amplified band (AP-GX-50, Axygen) and it is connected to TOPO cloning vector (Vazyme, Nanjing, China).

To insertion TOPO cloning vector in genetic fragment be sequenced and compared, find the gene be cell wall correlation by Body protein kinase gene, it is consistent with Ta#S58887995 sequence, it is named as TaWAK6.Biological information credit is carried out to TaWAK6 Analysis finds that ORF (open reading frame) 2265bp, nucleotide sequence encode 754 amino acid, ammonia as shown in SEQ ID NO.3 Base acid sequence is as shown in SEQ ID NO.4.Conservative region analysis is carried out with BLASTP in NCBI, finds the amino acid of the gene Sequence includes GUB WAK, EGF-like and kinase structural domain belongs to typical cell wall associated receptor protein kinase gene.

Embodiment 2 utilizes the mildew-resistance function of BMSV-VIGS system research TaWAK6

Virus induced gene silencing (Virus Induced Gene Silencing, VIGS) refers to carrying target gene After the virus infection plant of segment, it can induce plant endogenous genes silencing, cause character mutation, and then studied according to phenotypic variation The function of target gene.Compared with traditional gene function analysis method, VIGS can quickly to target gene carry out silencing and Function Identification overcomes function to repeat.Barley Stripe Mosaic Disease poison BSMV (Barley Stripe Mosaic Virus, BSMV) is It is modified, for gene silencing and functional verification (bibliography: Zhou H, Li S, Deng Z, Wang X, Chen in wheat T,Zhang J,Chen S,Ling H,Zhang A,Wang D,Zhang X(2007)Molecular analysis of three new receptor-like kinase genes from hexaploid wheat and evidence for their participation in the wheat hypersensitive response to stripe rust fungus infection.Plant J 52:420–434)。

It constructs the amplification of the TaWAK6 Insert Fragment of BSMV:TaWAK6 carrier: being carried by template design primer of TaWAK6 Primer P3 (the GCT of NheI digestion pointGCTAGCTGAAGATGCTGAGGTGGTTG, SEQ ID NO.5) and P4 (GCTGCTAGCGGAATTTCGGATGATTGGAT, SEQ ID NO.6), the 5 ' ends of P3 and P4 introduce restriction enzyme (primer 5 ' holds the restriction enzyme site that GCTAGC is NheI in underlined sequences to the restriction enzyme site and protectiveness base of NheI, and GCT is Protect base), so that the segment amplified utilizes the γ carrier of NheI digestion insertion BSMV.Specific amplification is as follows: with P3 and P4 For primer, PCR is carried out by template of the TOPO plasmid containing TaWAK6, expands 249bp segment in TaWAK6.PCR program: 2 μ l Plasmid template (100ng/ul), the P3 primer (10 μM) of 2 μ l, the P4 primer of 2 μ l, 25 μ l Phanta Max buffer (2 ×), 2μl dNTP Mix(10mM)、1μl Phanta Max Super-Fidelity DNA polymerase(1U/μl) (Vazyme, China) adds water to 50 μ l.PCR reaction condition: 95 DEG C initial denaturation 3 minutes；95 DEG C 15 seconds, 60 DEG C 15 seconds, 72 DEG C 30 seconds, 35 circulations；72 DEG C extend 5 minutes.PCR product detects the special of amplified band through 1.2% agarose gel electrophoresis Property and size (attached drawing 2), recycle specific amplified band (AP-GX-50, Axygen).

The building of BSMV:TaWAK6 carrier: after the recycling of TaWAK6 amplified production, with the complete enzyme of restriction enzyme NheI It cuts, while utilizing restriction enzyme NheI complete degestion BSMV:PDS carrier, cut the Insert Fragment of next 200bp or so (for PDS gene order) and the carrier segments greater than 2kb；By the recycling segment and BSMV:PDS enzyme after TaWAK6 digestion For carrier segments after cutting using T4 ligase connection (NEB, USA), connection product transformed competence colibacillus Escherichia coli apply ammonia benzyl resistance Plate, select monoclonal.After monoclonal shakes bacterium culture, carrying out PCR screening as template using bacterium solution has reversed intron Positive colony.Specific step is as follows: being first that left and right primer carries out PCR and agarose gel electrophoresis with P3 and P4, filters out insertion The positive monoclonal of target gene fragment；Using the bacterium solution of positive monoclonal as template, with the γ-strain-p primer on carrier P5 is that (I restriction enzyme site of 5 '-CAACTGCCAATCGTGAGTAGG-3 ', SEQ ID NO.7, primer distance Nhe is about for left primer 230bp), it is that right primer carries out PCR and agarose gel electrophoresis with the forward primer P3 of TaWAK6, compares target if can amplify The segment of the big 230bp of band then shows that TaWAK6 gene in monoclonal is reversely inserted in I restriction enzyme site of Nhe of BSMV: γ carrier Between.Further by recombinant vector using NheI carry out digestion (Fig. 1), verify correct carrier in next step be transcribed in vitro with Induced gene silencing.

In-vitro transcription process: extracted respectively according to extraction reagent kit specification in plasmid (Tiangeng company) BSMV viral vectors α, β, γ, γ-PDS and the recombination γ-TaWAK6 plasmid for carrying target gene external source Insert Fragment recycle RiboMAXTM Large Scale RNA Production Systems-T7 kit and Ribo m7G Cap Analog kit are to linear (Promega, USA) is transcribed in vitro in the carrier of change.α chain transcript, β chain transcript and γ chain transcript are taken after in-vitro transcription Isometric mixing, then be diluted with the DEPC water of three times volume, be then added 2 × GKP Buffer (50mM glycine, 30mM K2HPO4, pH 9.2,1%bentonite, 1%celite), it is spare that mixed liquor is stored in -80 DEG C of refrigerators.

BSMV:TaWAK6 inoculation and powder mildew resistance identification: virus inoculation induction is carried out to 9918 wheat of two leaf stage south agriculture Gene silencing.Emgloves is first put on when inoculation, takes 8ul virus mixture to be added dropwise on index finger, then thumb and index finger are mutual It mutually touches viral mixed liquor gently spreadable between referring to two, then is rubbed moderately blade with two finger dynamics, until liquid whole It disappears.All basin platinum is put into turnover box after inoculation, a small amount of DEPC water is sprayed in turnover chamber interior wall with watering can, covers week It is placed into after turnning box lid in 23 DEG C or so of dark-grown room, 24 hours plant switch to regular culture conditions growth, growth temperature Degree control is at 20~28 DEG C.It is sampled for the 4th blade of wheat within 15 days after inoculation and is identified with powdery mildew, take inoculation BAMV: The control blade of γ (inoculation α chain+β chain+γ chain) and be inoculated with BAMV:TaWAK6 TaWAK6 silencing blade (inoculation α chain+β chain+ γ: TaWAK6) it is placed on the fresh-keeping culture medium of 6BA, is inoculated with fresh powdery mildew spores with method is shaken off, inoculation observed leaf after 6-8 days Piece incidence.The result shows that: behind inoculation powdery mildew 6 days of inoculation BAMV:TaWAK6 plant, with compareing for inoculation BSMV: γ It compares, Nan Nong 9918 loses the resistant part of powdery mildew, illustrates that TaWAK6 is played in resistance in southern agriculture 9918 and plays important work With (attached drawing 2).

The building of embodiment 3TaWAK6 gene Transient Expression carrier

Using the TaWAK6 gene cDNA cloned in the southern agriculture 9918 induced through powdery mildew as template, primer pair is used TaWAK6-BamHI-F (AGTCCGGAGCTAGCTCTAGAATGTCACAAGCAAAGCTCATC, SEQ ID NO.8) and TaWAK6-KpnI-R (CCCTTGCTCACCATGGATCCTCTAGGAATTTCAGATGATTGG, SEQ ID NO.9) carries out PCR Amplified fragments are recycled in amplification.PCR program: 2 μ l plasmid templates (100ng/ul), the P3 primer (10 μM) of 2 μ l, 2 μ l P4 draw Object, 25 μ l Phanta Max buffer (2 ×), 2 μ l dNTP Mix (10mM), 1 μ l Phanta Max Super- Fidelity DNA polymerase (1U/ μ l) (Vazyme, China), adds water to 50 μ l.PCR reaction condition: 95 DEG C of pre- changes Property 3 minutes；95 DEG C 15 seconds, 58 DEG C 15 seconds, 72 DEG C 30 seconds, 35 circulation；72 DEG C extend 5 minutes.PCR product through 1.2% fine jade The specificity and size of sepharose electrophoresis detection amplified band recycle specific amplified band (AP-GX-50, Axygen).It utilizes BamHI and KpnI double digestion is to pBI220 (Jefferson RA, Kavanagh TA, Bevan MW.GUS fusions:beta- glucuronidase as a sensitive and versatile gene fusion marker in higher Plants.EMBO J.1987,6:3901-3907.) carry out double digestion and recycling carrier framework, utilize homologous recombination kit The TaWAK6 product of recycling is inserted into digestion by (ClonExpress MultiS One Step Cloning Kit, Vazyme) TaWAK6 is placed at the subsequent multiple cloning sites of 35S promoter by the carrier framework of recycling.Thus by TaWAK6 grams of target gene The grand downstream to strong promoter 35S obtains expression vector pBI220:TaWAK6 (attached drawing 3).Through sequence verification, show carrier structure Build up function.

TaWAK6 gene is transferred to wheat leaf blade using Transient Expression method by embodiment 4

Transient Expression method is a kind of reliable and Rapid identification gene function method (Schweizer, Pokorny et al.A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat Molecular Plant-Microbe Interactions.1999,12:647-654.).This research Using Transient Expression method, Plasmid DNA is wrapped up to metal particle outer layer, is arrived metal particle and gene bombardment by particle gun The epidermal cell of wheat leaf blade, then in SM-1 blade statistics bombardment TaWAK6 cell powdery mildew haustorium index with do not bombard Whether the powdery mildew haustorium index of TaWAK6 cell, hard objectives gene have the function of powdery mildew disease-resistant.

Carrier DNA and the program that metal particle wraps up are as follows:

It prepares tungsten powder: weighing the tungsten powder of 30mg in 1.5ml eppendorf pipe, 70% alcohol of 1ml, vortex 3- is added 15min is stood after 5min, precipitates tungsten powder completely.Supernatant is abandoned after 12000rpm centrifugation 1min.1ml ddH is added₂O water is vortexed After mixing, supernatant (in triplicate) is abandoned in centrifugation.It is eventually adding 500 μ l, 50% glycerol vortex to mix, with spare.

Package bullet: 5 μ l are drawn and are vortexed uniform tungsten powder in the eppendorf pipe of 1.5ml, 5 μ l Plasmid DNA are added (total amount should be 1 μ g).50 μ l 2.5M CaCl are added dropwise into eppendorf pipe in vortex₂, it is sub- that 20 μ l 0.1M are then added Smart ammonia (now match and first use), vortex 3min.It is centrifuged 2s after standing 1min, abandons supernatant.It is added 140 μ l, 70% alcohol, sufficient vortex, It is centrifuged 2s, abandons supernatant.Then 140 μ l, 100% alcohol is added, sufficient vortex is centrifuged 2s, abandons supernatant.It is eventually adding 15 μ l 100% alcohol, sufficient vortex, in case using.

When implementing gus gene single-turn, gus gene expression vector pAHC25 (Christensen AH, Quail will be contained P H.Ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker genes in monocotyledonous plants.Transgenic Research, 1996,5:213-218.) Plasmid DNA and tungsten powder wrap up；It, will when implementing TaWAK6 and gus gene cotransformation Plasmid DNA containing TaWAK6 expression vector pBI220:TaWAK6 and the plasmid containing gus gene expression vector pAHC25 DNA is mixed in the ratio of molar concentration 1:1, wraps up tungsten powder.When gus gene and TaWAK6 gene carry out cotransformation, Marker The cell that gene GUS is transferred to is also the cell that TaWAK6 is transferred to.Because indigo plant is presented through dyeing entire cell in the cell of gus gene expression Color, so expression cell of this research using blue cell as TaWAK6.

Biolistic bombardment program is as follows: cutting the wheat seedlings blade end for being about 6cm, is attached on glass slide in parallel, often It opens slide and pastes 6 blades or so.Particle gun uses PDS1000/He system, and using the diaphragm that splits of 1350psi, vacuum degree is 28inHg.Blade being placed in after bombardment in the porcelain dish for being lined with wetting filter paper, covers the preservative film to be with holes, moisturizing is simultaneously breathed freely, After 18-20 DEG C of renewal cultivation 4h, high density is inoculated with powdery mildew conidium.Be inoculated with 48h after with GUS dye liquor (formula are as follows: 0.1mol/L Na₂HPO₄/NaH₂PO₄Buffer (pH7.0), EDTA containing 10mmol/L, the 5mmol/L potassium ferricyanide and ferrous cyanogen Change potassium, 0.1mg/ml X-Gluc, 0.1%Triton X-100,20% methanol) vacuum infiltration 10min, 37 DEG C of dyeing 12h, so 2 days are decolourized until blade becomes white with 70% alcohol afterwards, and the Coomassie brilliant blue for being finally 0.6% using concentration is to white powder Bacterium spore staining.

Embodiment 5 utilizes the disease-resistant function of Transient Expression technique study TaWAK6

After powdery mildew invades wheat leaf blade epidermal cell, the finger-shaped material generated in epidermal cell is known as haustorium.Haustorium is not Can normally generate is the blade cell important indicator resistant to powdery mildew.In the cell of GUS expression, haustorium can be by GUS Dyeing liquor dyes blue, is easy identification (attached drawing 3) under the microscope.After gus gene transformed cells, pass through statistics and powdery mildew In the GUS expression cell of interaction, ratio (%) shared by the cell that haustorium is formed, as " haustorium index " (Schweizer, Pokorny et al.A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat Molecular Plant-Microbe Interactions.1999,12: 647-654.).Haustorium index is smaller, shows that disease resistance is stronger.Measurement of this research and utilization " haustorium index " as disease-resistant power Index.

It when single-turn gus gene, observes in 528 GUS expression cells, the haustorium index of susceptible wheat SM-1 is 56.44%；After gus gene and TaWAK6 cotransformation, 495 GUS expression cells are counted, the haustorium of susceptible wheat SM-1 refers to Number is 39.20% (having counted 495 cells) (attached drawing 4).Result explanation, TaWAK6 can significantly reduce haustorium index, right Powdery mildew has resistant effect.

Sequence table

<110>Agricultural University Of Nanjing

Nanjing Xin Maixiu Biotechnology Co., Ltd

<120>Wheat cell wall associated receptor protein kinase gene and its expression vector and an applications

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

atgtcacaag caaagctcat 20

<210> 2

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

tcatctagga atttcagatg 20

<210> 3

<211> 2265

<212> DNA

<213>common wheat (Triticum asetivum L.)

<400> 3

atgtcacaag caaagctcat cgtcgcaacg gtgacggcac ttcagctcct catggcgaca 60

gccgtcgccg ccgtccaggt agccttacct gggtgcccgc aggcctgcgg caacgtcacc 120

gtcccctacc ctttcggctt ccggcgaggc tgctttcgca agggcttcaa cctcacctgc 180

gacgagacgc gccgtccgcc gaggctgctc ctgggcgacg gcgtggaggt ggacgccatc 240

tccctggcgg acggcacggt gcatgtgcag accaaggtcg tggcattccg accactttac 300

acaaacggtg ccgtcggcgc gaggagatct atcgaccaca actactcgtg gtacggcggc 360

ctgccggaag tgtacaagag cggcggcgcg cagctcgcgg tgtccaccga ccacaacgtc 420

tttgtggcca tcgggtgcaa cttcatcggc tacctcgtcg cagtcagcga cgggggtcgc 480

gagtatgtca gcacatgctc cacgctgtgc aacgggaaaa cccgggacgc cttgtgcacg 540

ggcgtcggct gctgctggac gaccatcgcg cagcgttacc ccgggtacca ggtgaagttc 600

aaggatttgg acgatacggc ggcagcgtac gcgggccaaa gccgtgcgtc ggtggccgcg 660

ttcatagtcg atcgcgagtg gttcgtaggc accatgcaga acactgtcag cttcaatgat 720

tttgtcaatg atgatttcgg taacggtccg tccagcatgc ccaccgtgct gcaatggtgg 780

ctagacgtag atagcgaccg tgacttggtc gtcaaggatc cacgttctgc atctcgttgg 840

agatgcataa gcttgaacag tttcgctgcc tacatcggcg acgcagtgaa caaagtaagg 900

tgcaactgct cggatggata cgaaggcaac tcttacatcg ttgacggatg tcaagatatc 960

ggtgagtgct tacggccaga tgtttatccc tgccatggaa catgcatcaa tatgccaggg 1020

acatacagat gctcagcaaa gaaaagaatc atcagcttag caggtctaat taccataata 1080

gcaatcgttg ctggttttgg actactattt tcactcctag gtgttgccca agtcacaaaa 1140

aaactcaaga aaggaagagc caagaagatc agacaaaaat tctttaagaa aaaccatgga 1200

ctgcttctac aacagttaat ctcttcgaac aaagatatag ccgaaaagat gaagattttc 1260

agcttagaag agctagaaca agcaaccaac aaatttgatc ataatcggat ccttggtggc 1320

ggtgggcatg gcacggtgta taaagccatc ttatctgatc aacgtgtcgt ggccatcaag 1380

aaggccaaaa ttgttgtgca aagggaaatc gaccagttca taaatgaggt tgccatactt 1440

tcacagataa accacaggaa tgtggtgaaa ctttttggtt gttgtctcga gacagaagtt 1500

cctctactag tttacgagtt catattgaat ggaactctct cttgtcatct ccatggcaaa 1560

agtgagaacc atttgtcatg gaaaactcga ttgaggattg ctttggaaac tgcaagggct 1620

attgcatctc tacactctgc agcttccata tcagtatacc atagagatat caaatgtgcc 1680

aatattctac ttactgatac tttaatagca aaagtatcag attttggtgc ttcaaggtca 1740

attgcaatag acgggacagg aatacttaca gttgtccaag gaacctatgg ttaccttgat 1800

cctgaatact actacacgag tcgattgacg aagaagagtg atgtttacag ttttggtgtc 1860

atcctagcag agctattgac aagtgtcaca ccagtttttt cttctcattc atcagaagga 1920

acaagcctag catcgcactt tgtatcacta atgagcggca atcgcttgtc agatattcta 1980

gatacacaaa ttattcatga aggaggagtt gaagatgctg aggtggttgc aagacttgca 2040

caagcatgct taagcttaaa aggggaagaa agacctacaa tgaggcaagt ggagacaaca 2100

cttgaagatg tgcataactc aaaggtcaag ctcagttctc agataacaag agtgaatcag 2160

agtgctatga aagatcagcc atggatgggg aacaaaggcg gtgaaggaac taggttatac 2220

agcttggaaa aggagattat ccaatcatct gaaattccta gatga 2265

<210> 4

<211> 754

<212> PRT

<213>common wheat (Triticum asetivum L.)

<400> 4

Met Ser Gln Ala Lys Leu Ile Val Ala Thr Val Thr Ala Leu Gln Leu

1 5 10 15

Leu Met Ala Thr Ala Val Ala Ala Val Gln Val Ala Leu Pro Gly Cys

20 25 30

Pro Gln Ala Cys Gly Asn Val Thr Val Pro Tyr Pro Phe Gly Phe Arg

35 40 45

Arg Gly Cys Phe Arg Lys Gly Phe Asn Leu Thr Cys Asp Glu Thr Arg

50 55 60

Arg Pro Pro Arg Leu Leu Leu Gly Asp Gly Val Glu Val Asp Ala Ile

65 70 75 80

Ser Leu Ala Asp Gly Thr Val His Val Gln Thr Lys Val Val Ala Phe

85 90 95

Arg Pro Leu Tyr Thr Asn Gly Ala Val Gly Ala Arg Arg Ser Ile Asp

100 105 110

His Asn Tyr Ser Trp Tyr Gly Gly Leu Pro Glu Val Tyr Lys Ser Gly

115 120 125

Gly Ala Gln Leu Ala Val Ser Thr Asp His Asn Val Phe Val Ala Ile

130 135 140

Gly Cys Asn Phe Ile Gly Tyr Leu Val Ala Val Ser Asp Gly Gly Arg

145 150 155 160

Glu Tyr Val Ser Thr Cys Ser Thr Leu Cys Asn Gly Lys Thr Arg Asp

165 170 175

Ala Leu Cys Thr Gly Val Gly Cys Cys Trp Thr Thr Ile Ala Gln Arg

180 185 190

Tyr Pro Gly Tyr Gln Val Lys Phe Lys Asp Leu Asp Asp Thr Ala Ala

195 200 205

Ala Tyr Ala Gly Gln Ser Arg Ala Ser Val Ala Ala Phe Ile Val Asp

210 215 220

Arg Glu Trp Phe Val Gly Thr Met Gln Asn Thr Val Ser Phe Asn Asp

225 230 235 240

Phe Val Asn Asp Asp Phe Gly Asn Gly Pro Ser Ser Met Pro Thr Val

245 250 255

Leu Gln Trp Trp Leu Asp Val Asp Ser Asp Arg Asp Leu Val Val Lys

260 265 270

Asp Pro Arg Ser Ala Ser Arg Trp Arg Cys Ile Ser Leu Asn Ser Phe

275 280 285

Ala Ala Tyr Ile Gly Asp Ala Val Asn Lys Val Arg Cys Asn Cys Ser

290 295 300

Asp Gly Tyr Glu Gly Asn Ser Tyr Ile Val Asp Gly Cys Gln Asp Ile

305 310 315 320

Gly Glu Cys Leu Arg Pro Asp Val Tyr Pro Cys His Gly Thr Cys Ile

325 330 335

Asn Met Pro Gly Thr Tyr Arg Cys Ser Ala Lys Lys Arg Ile Ile Ser

340 345 350

Leu Ala Gly Leu Ile Thr Ile Ile Ala Ile Val Ala Gly Phe Gly Leu

355 360 365

Leu Phe Ser Leu Leu Gly Val Ala Gln Val Thr Lys Lys Leu Lys Lys

370 375 380

Gly Arg Ala Lys Lys Ile Arg Gln Lys Phe Phe Lys Lys Asn His Gly

385 390 395 400

Leu Leu Leu Gln Gln Leu Ile Ser Ser Asn Lys Asp Ile Ala Glu Lys

405 410 415

Met Lys Ile Phe Ser Leu Glu Glu Leu Glu Gln Ala Thr Asn Lys Phe

420 425 430

Asp His Asn Arg Ile Leu Gly Gly Gly Gly His Gly Thr Val Tyr Lys

435 440 445

Ala Ile Leu Ser Asp Gln Arg Val Val Ala Ile Lys Lys Ala Lys Ile

450 455 460

Val Val Gln Arg Glu Ile Asp Gln Phe Ile Asn Glu Val Ala Ile Leu

465 470 475 480

Ser Gln Ile Asn His Arg Asn Val Val Lys Leu Phe Gly Cys Cys Leu

485 490 495

Glu Thr Glu Val Pro Leu Leu Val Tyr Glu Phe Ile Leu Asn Gly Thr

500 505 510

Leu Ser Cys His Leu His Gly Lys Ser Glu Asn His Leu Ser Trp Lys

515 520 525

Thr Arg Leu Arg Ile Ala Leu Glu Thr Ala Arg Ala Ile Ala Ser Leu

530 535 540

His Ser Ala Ala Ser Ile Ser Val Tyr His Arg Asp Ile Lys Cys Ala

545 550 555 560

Asn Ile Leu Leu Thr Asp Thr Leu Ile Ala Lys Val Ser Asp Phe Gly

565 570 575

Ala Ser Arg Ser Ile Ala Ile Asp Gly Thr Gly Ile Leu Thr Val Val

580 585 590

Gln Gly Thr Tyr Gly Tyr Leu Asp Pro Glu Tyr Tyr Tyr Thr Ser Arg

595 600 605

Leu Thr Lys Lys Ser Asp Val Tyr Ser Phe Gly Val Ile Leu Ala Glu

610 615 620

Leu Leu Thr Ser Val Thr Pro Val Phe Ser Ser His Ser Ser Glu Gly

625 630 635 640

Thr Ser Leu Ala Ser His Phe Val Ser Leu Met Ser Gly Asn Arg Leu

645 650 655

Ser Asp Ile Leu Asp Thr Gln Ile Ile His Glu Gly Gly Val Glu Asp

660 665 670

Ala Glu Val Val Ala Arg Leu Ala Gln Ala Cys Leu Ser Leu Lys Gly

675 680 685

Glu Glu Arg Pro Thr Met Arg Gln Val Glu Thr Thr Leu Glu Asp Val

690 695 700

His Asn Ser Lys Val Lys Leu Ser Ser Gln Ile Thr Arg Val Asn Gln

705 710 715 720

Ser Ala Met Lys Asp Gln Pro Trp Met Gly Asn Lys Gly Gly Glu Gly

725 730 735

Thr Arg Leu Tyr Ser Leu Glu Lys Glu Ile Ile Gln Ser Ser Glu Ile

740 745 750

Pro Arg

<210> 5

<211> 29

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

gctgctagct gaagatgctg aggtggttg 29

<210> 6

<211> 29

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

gctgctagcg gaatttcgga tgattggat 29

<210> 7

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

caactgccaa tcgtgagtag g 21

<210> 8

<211> 41

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

agtccggagc tagctctaga atgtcacaag caaagctcat c 41

<210> 9

<211> 42

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

cccttgctca ccatggatcc tctaggaatt tcagatgatt gg 42

Claims (6)

1. a Wheat cell wall associated receptor protein kinase gene TaWAK6 comes from common wheat (Triticum asetivum L.) 9918 Nan Nong, ORF sequence is as shown in SEQ ID NO.3.

2. the protein of gene TaWAK6 coding described in claim 1, amino acid sequence are SEQ ID NO.4.

3. the recombinant expression carrier pBI220:TaWAK6 of a Wheat cell wall associated receptor protein kinase gene TaWAK6.

4. recombinant expression carrier according to claim 3, it is characterised in that a Wheat cell wall associated receptor It is the carrier that sets out that the expression vector pBI220:TaWAK6 of protein kinase gene TaWAK6, which is with pBI220, and TaWAK6 gene is inserted Obtained by entering between BamHI the and KpnI restriction enzyme site of pBI220.

5. Wheat cell wall associated receptor protein kinase gene TaWAK6 described in claim 1 is small in building mildew-resistance Application in wheat variety.

6. the expression vector of a Wheat cell wall associated receptor protein kinase gene TaWAK6 described in claim 3 or 4 Application of the pBI220:TaWAK6 in building powdery-mildew-resistance wheat kind.