CN110229826A

CN110229826A - One haynaldia villosa CEBiP1-V gene and its encoded albumen and application

Info

Publication number: CN110229826A
Application number: CN201910526659.3A
Authority: CN
Inventors: 王宗宽; 王秀娥; 樊安琪; 刘佳; 韦璐阳; 王雅嘉; 张鑫; 袁春霞; 王海燕; 肖进
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2019-06-18
Filing date: 2019-06-18
Publication date: 2019-09-13
Anticipated expiration: 2039-06-18
Also published as: CN110229826B

Abstract

The invention discloses a haynaldia villosa CEBiP1-V gene and its encoded albumen and applications.The cDNA sequence of CEBiP1-V is SEQ ID NO.1 and its amino acid sequence of coding is SEQ ID NO.2.CEBiP1-V gene overexpression vector pBI220-CEBiP1-V is converted into susceptible wheat breed Yangmai No.158 by unicellular transient expression technology, the results showed that moment, overexpression CEBiP1-V can reduce the haustorium index of Yangmai No.158.The expression quantity of CEBiP1-V is 9-65 times of Yangmai No.158 expression quantity in overexpression CEBiP1-V transgenic plant, to wheat powdery mildew show in resistance level.Therefore, CEBiP1-V is expected to import its overexpression vector pBI220-CEBiP1-V in susceptible powdery mildew wheat breed for genetic engineering breeding, is expected to improve the powder mildew resistance of wheat.

Description

One haynaldia villosa CEBiP1-V gene and its encoded albumen and application

Technical field

The invention belongs to genetic engineering field, disclose a haynaldia villosa CEBiP1-V gene and its encoded albumen and Using.

Background technique

Wheat powdery mildew is that have by obligatory parasitism fungi wheat powdery mildew (Blumeria graminis DC F.sp.tritici wheat diseases caused by) are one of the three big fungal diseases in China's Wheat Production, it is small to seriously threaten us Wheat safety in production.Currently, China's wheat powdery mildew onset area maintains 100,000,000 mu or so, the yield of 15-30% is caused to damage every year It loses.

Plant forms two kinds of active defense mechanisms to protect itself infecting from pathogen, i.e. pathogen-associated molecular mould The immune response (Pattern Triggered Immunity, PTI) of formula excitation and the immune response of effect protein excitation (Effector Triggered Immunity,ETI).PTI is mainly by species identification receptor (Pattern Recognition Receptors, PRRs) identify conservative, indispensable molecule, that is, pathogen relevant molecule in pathogen Mode (Pathogen-Associated Molecular Patterns, PAMPs), as bacterial flagellin, bacterium extend because The immune response of son and chitin triggering.The effector as secreted by plant intracorporal R gene identification pathogen, to touch The immune response of hair is called ETI.When pathogen instruction plant, the disease of the pattern recognition receptors identification pathogen of surface of Plant callus cell Former associated molecular pattern, to trigger the defence of plant basis.Pathogen inhibits the PTI of plant by secretion effector, or The immune defense [4] [5] of host is escaped using " self camouflage ".The R gene of NBS-LRR type in Plant Genome can lead to It crosses and identifies specific effector, trigger ETI, and along with programmed cell death (PCD), the wheat powdery mildew resistance cloned at present Gene Pm2, Pm3, Pm8, Pm21, Pm60 are the R genes of NBS-LRR type.

Plant PRRs be generally be positioned on cell membrane Receptor-like protein ki-nase (Receptor Like Kinases, ) and RLPs (Receptor Like Proteins) RLKs.One typical RLK would generally include extracellular ligand binding Domain, a transmembrane domain and kinase domain intracellular, RLP lack kinase domain intracellular.According to the extracellular of PRRs Structural domain, the PRRs cloned at present mainly have 4 classes: LRR, EGF-like, LysM and Lectin type.Chitin in plant Pattern recognition receptors usually contain LysM structural domain, therefore LysM genoid plays important work in the disease-resistant middle possibility of powdery mildew With.LysM structural domain plays extremely in plant and fungi Interaction as a kind of ancient and generally existing structural domain Important role.Albumen containing LysM structural domain in plant cell can identify that variety classes contain N-acetyl-glucosamine structure Ligand molecular, to start plant to the special defense reaction [9] of pathogen.Chitin be the cell wall of fungi it is main at Point, it is a kind of very typical PAMP.And it was found that the intracorporal LysM genoid of plant can be special in the research of forefathers The identification chitin of property simultaneously triggers immune response.

The nearly edge species of cultivated wheat remain a large amount of disease and insect resistance, resist during long-term evolution and natural selection The desirable genes such as inverse, high-quality are the important gene sources of Common Wheat Varieties improvement, therefore, are studied and anti-using affinity species Ospc gene is the important channel for improveing disease-resistant wheat.Haynaldia villosa (Haynaldia villosa L., 2n=2x=14, gene Group VV) be common wheat the nearly edge species of diploid, with high mildew-resistance merit, be expected to therefrom obtain anti-white powder The functional gene of disease.

Summary of the invention

The purpose of the present invention is in view of the above drawbacks of the prior art, provide a LysM receptoroid protein gene CEBiP1-V。

It is a further object of the present invention to provide the overexpression vectors of the gene.

It is yet another object of the invention to provide the applications of the gene and overexpression vector.

The purpose of the present invention can be achieved through the following technical solutions:

CEBiP1-V (Chitin Elicitor Receptor Kinase 1) gene comes from Dasypyrum villosum.Its core Nucleotide sequence is SEQ ID NO.1.

The protein C EBiP1-V of gene coding, amino acid sequence are SEQ ID NO.2.

The overexpression vector containing CEBiP1-V gene described in claim 1 is preferably to set out with pBI220 Carrier, by the BamHI of the positive insertion pBI220 carrier of CEBiP1-V full length gene described in claim 1 (SEQ ID NO.1) The gained between Stu I restriction enzyme site.

Application of the overexpression vector of the CEBiP1-V gene in powdery-mildew-resistance wheat kind.

Beneficial effect

The quasi- expression pattern by analysis haynaldia villosa LysM receptoroid protein gene family of this research, has been cloned and powdery mildew The relevant LysM receptoroid protein gene CEBiP1-V of resistance.Just by unicellular transient expression experiment preliminary proof CEBiP1-V Wheat cdna rifle genetic transfoumation is further utilized to regulation wheat powdery mildew resistance, the overexpression of CEBiP1-V gene is carried In body pBI220-CEBiP1-V transformed wheat kind Yangmai No.158, transgenic positive plant, Molecular Identification and Resistance Identification are obtained The result shows that overexpressing the gene can be improved powder mildew resistance, show that the gene plays forward direction in wheat powdery mildew resistance Adjusting function can be used for genetic engineering breeding, improve wheat to the resistance of powdery mildew.

Detailed description of the invention

QPCR analysis of Fig. 1 CEBiP1-V in the blade after the induction of Dasypyrum villosum powdery mildew

X-axis: 0h, 1h, 3h, 8h, 12h, 18h, for 24 hours, 36h, 48h respectively indicate haynaldia villosa blade by powdery mildew induction not The same period；Y-axis: CEBiP1-V gene induced in different samples by powdery mildew before and after expression multiple.

Fig. 2 CEBiP1-V gene overexpression vector constructs map

Fig. 3 utilizes unicellular overexpression technical research CEBiP1-V mildew-resistance effect

The T of Fig. 4 CEBiP1-V gene overexpression vector conversion Yangmai No.158₁For positive transgenic plant PCR Molecular Identification As a result

1st swimming lane is marker:DL2000, and the 2nd swimming lane is Yangmai No.158, and swimming lane 3-7 is followed successively by positive transformants plant OE- CEBiP1-T₀-12、OE-CEBiP1-T₀-17、OE-CEBiP1-T₀-31、OE-CEBiP1-T₀-50、OE-CEBiP1-T₀-74。

The T of Fig. 5 CEBiP1-V gene overexpression vector conversion Yangmai No.158₁Result is analyzed for positive transgenic plant qPCR

X-axis: Yangmai No.158 and above-mentioned 5 transgenic positive plant；Y-axis: CEBiP1-V gene is in transgenic plant Expression multiple relative to Yangmai No.158.

The T of Fig. 6 CEBiP1-V gene overexpression vector conversion Yangmai No.158₁It reflects in vitro for positive transgenic plant powdery mildew It is fixed

Specific embodiment

1 CEBiP1-V gene cloning of embodiment and the expression characteristic induced by powdery mildew

Devise homologous clone primer P1 (ATGCCGCTCCCGTCGCCGGC, SEQ ID NO.3) and P2 (TCAAAGGAAGCATACCAAG, SEQ ID NO.4) is cloned in the cDNA that haynaldia villosa blade receives after powdery mildew induction and is obtained 1080bp sequence, the sequence is as shown in SEQ ID NO.1.359 amino acid of the sequential coding, sequence such as SEQ ID NO.2 institute Show, is CEBiP1-V by the unnamed gene.

The tuft Wheat Seeds of mildew-resistance (bibliography: Qi Lili, Chen Peidu, etc. wheat powdery mildew new resistance source-base Because of Pm21, Acta Agronomica Sinica, 1995,21 (3): 257-262) it is sowed in culture dish and germinates, basin alms bowl is transplanted to after showing money or valuables one carries unintentionally (around with circle The isolation of column transparent plastic sheet, top are closed with filter paper, form the environment without powdery mildew).To tri-leaf period, in susceptible variety Soviet Union The wheat No. three upper Nanjing mixing powdery mildew Fresh spores cultivated gently are shaken off on the seedling of haynaldia villosa.After being inoculated with powdery mildew Haynaldia villosa continue to cultivate at 16 DEG C.Be inoculated with 0h, 1h, 3h, 8h, 12h, 18h, for 24 hours, 36h, 48h sampling, be placed in -70 DEG C of refrigerators Inside save backup.The RNA that the haynaldia villosa blade induced by powdery mildew is extracted with TRIZOL (Invitrogen), utilizes AMV enzyme (Takara) the first chain of reverse transcription is synthesized, reverse transcription product is obtained.

Using can specific amplified CEBiP1-V special primer P3 (ATCGCCACCGCCAACAAGG, SEQ ID NO.5) and P4 (GGAGCGGGACATCAAGAACCTG, SEQ ID NO.6) divides the gene by qPCR is carried out in powdery mildew induced samples Analysis.PCR reaction expands on qPCR instrument (Roche Light Cycler 480, Roche).Contain 2 μ in 20 μ l PCR reaction systems The l μ l primer P1 (10 μM) of cDNA, 10 μ l 2 × SYBR EX Taq TM (TakaRa), 0.4 and P2 (10 μM).Amplification are as follows: 95 DEG C of 5min, then 95 DEG C of 10s, 60 DEG C of 30s, 72 DEG C of 15s, totally 41 circulations.After reaction, relative expression quantity: root is calculated The different time points of target gene after treatment are calculated relative to untreated relative expression quantity, i.e., 2 according to obtained CT value^-△△CT。 Wherein, △ △ C_T=(C_T.Target-C_T.Tublin)_Timex-(C_T.Target-C_T.Tublin)_{Time 0}.Time x indicates any point-in-time, Time 0 indicates untreated point.The result shows that: it is high to reach induction for expression after haynaldia villosa blade is induced 18h by powdery mildew Peak is 31.3 times.QPCR's the result shows that, CEBiP1-V may positive regulation wheat powdery mildew resistance (attached drawing 1).

The building of 2 CEBiP1-V gene overexpression vector silent carrier of embodiment

Using above-mentioned CEBiP1-V gene clone carrier pMD18T-CEBiP1-V, with can specific amplified CEBiP1-V gene Primer pair P5 (CGGGATCCATGCCGCTCCCGTCGCC, SEQ ID NO.7) and P6 (GAAGGCCTAAGGAAGCATACCAAG, SEQ ID NO.8) PCR amplification is carried out, recycle amplified fragments.With BamHI and StuI Double digestion is inserted into carrier pBI220 (bibliography: Jefferson RA, Kavanagh TA, Bevan for target segment is expanded MW.GUS fusions:beta-glucuronidase as a sensitive and versatile gene fusion Marker in higher plants.EMBO is J.1987,6:3901-3907) the subsequent multiple cloning sites of 35S promoter Between BamHI and StuI.Thus to obtain CEBiP1-V gene overexpression vector pBI220-CEBiP1-V (attached drawing 2).

CEBiP1-V gene overexpression vector is transferred to wheat leaf blade using unicellular transient expression technology by embodiment 3

Unicellular transient expression technology is a kind of reliable and the method for Rapid identification gene function (bibliography: Schweizer,Pokorny et al.A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat Molecular Plant-Microbe Interactions.1999,12:647-654).The unicellular instant expression method of this research and utilization, by Plasmid DNA package to gold Belong to microparticle shell, metal particle is bombarded into the epidermal cell to wheat leaf blade by particle gun, then the GUS after statistics bombardment is thin Whether the powdery mildew haustorium index of born of the same parents, hard objectives gene have the function of powdery mildew disease-resistant.

Carrier DNA and the program that metal particle wraps up are as follows:

It prepares tungsten powder: weighing the tungsten powder of 30mg in 1.5ml eppendorf pipe, 70% alcohol of 1ml, vortex 3- is added 15min is stood after 5min, precipitates bronze completely.Supernatant is abandoned after 12,000rpm centrifugation 1min.1ml ddH is added₂O is vortexed mixed After even, supernatant (being repeated 3 times) is abandoned in centrifugation.500 μ l, 50% glycerol vortex is eventually adding to mix, it is spare.

Package bullet: 5 μ l are drawn and are vortexed uniform tungsten powder in the eppendorf pipe of 1.5ml, 5 μ l Plasmid DNA are added (total amount should be 1 μ g, use ddH such as the larger inadequate 5 μ l of plasmid concentration₂O is diluted to the concentration of 5 μ l/1 μ g).In vortex to 50 μ l 2.5M CaCl are added dropwise in eppendorf pipe₂, 20 μ l 0.1M spermidine (ready-to-use), vortex 3min is then added.

It is centrifuged 2s after standing 1min, abandons supernatant.140 μ l, 70% alcohol is added, sufficient vortex is centrifuged 2s, abandons supernatant.So After be added 140 μ l, 100% alcohol, sufficient vortex is centrifuged 2s, abandons supernatant.It is eventually adding 15 μ l, 100% alcohol, sufficient vortex, In case using.

When implementing gus gene single-turn, gus gene expression vector pAHC25 (bibliography: Christensen will be contained A H,Quail P H.Ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker genes in monocotyledonous Plants.Transgenic Research, 1996,5:213-218) Plasmid DNA and tungsten powder wrap up；Implement CEBiP1-V base When because of overexpression vector pBI220-CEBiP1-V and gus gene cotransformation, CEBiP1-V gene overexpression vector will be contained PBI220-CEBiP1-V Plasmid DNA is with the Plasmid DNA containing gus gene expression vector pAHC25 in the ratio of molar concentration 1:1 Tungsten powder is wrapped up in mixing.Gus gene and CEBiP1-V gene overexpression vector pBI220-CEBiP1-V carry out cotransformation, Marker The cell that gene GUS is transferred to is also the cell that CEBiP1-V gene overexpression vector pBI220-CEBiP1-V is transferred to.Because of GUS base Because blue is presented in entire cell to the cell of expression after GUS is dyed, so this research is using blue cell as CEBiP1-V gene The cell of expression.

Biolistic bombardment program is as follows: cutting the wheat seedlings blade end for being about 6cm, is attached on glass slide in parallel, often It opens slide and pastes 6 blades or so.Particle gun uses PDS1000/He system, and using the diaphragm that splits of 1350psi, vacuum degree is 28inHg.Blade being placed in after bombardment in the porcelain dish for being lined with wetting filter paper, covers the preservative film to be with holes, moisturizing is simultaneously breathed freely, After 18-20 DEG C of renewal cultivation 4h, high density is inoculated with powdery mildew conidium.Be inoculated with 48h after with GUS dye liquor (formula are as follows: 0.1molL Na₂HPO₄/NaH₂PO₄Buffer (pH7.0), EDTA containing 10mmolL, the 5mmolL potassium ferricyanide and ferrocyanide Potassium, 0.1mg/ml X-Gluc, 0.1%Triton X-100,20% methanol) vacuum infiltration 10min, 37 DEG C of dyeing 12h, then 2 days are decolourized until blade becomes white with 70% alcohol, and the Coomassie brilliant blue for being finally 0.6% using concentration is to powdery mildew Spore staining.

After powdery mildew invades wheat leaf blade epidermal cell, the finger-shaped material generated in epidermal cell is known as haustorium.Haustorium is not Can normally generate is the blade cell important indicator resistant to powdery mildew.In the cell of GUS expression, cell can be by GUS Dyeing liquor dyes blue, is easy identification under the microscope.After gus gene transformed cells, by counting and powdery mildew interaction GUS expression cell, haustorium formed cell shared by ratio (%), as " haustorium index " (public, Schweizer, Pokorny et al.A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat Molecular Plant-Microbe Interactions.1999,12: 647-654).Haustorium index is smaller, shows that disease resistance is stronger.This research and utilization " haustorium index " refers to as the measurement of disease-resistant power Mark.

When individually conversion gus gene, feeling the haustorium index in powdery mildew wheat breed Yangmai No.158 is 62.58%；When Gus gene and CEBiP1-V gene overexpression vector pBI220-CEBiP1-V corotation allelopathic powdery mildew wheat breed Yangmai No.158 Afterwards, the haustorium index of Yangmai No.158 is remarkably decreased to 31.13% (attached drawing 3).Result explanation, moment overexpresses CEBiP1-V can To reduce haustorium index significantly, CEBiP1-V has positive regulation effect to wheat anti-powdery mildew.

4 CEBiP1-V gene overexpression vector pBI220-CEBiP1-V of embodiment stablizes genetic transformation and gene function is ground Study carefully

Genetic transforming method (the Xing Liping wheat/haynaldia villosa mildew-resistance related gene conversion mediated using particle gun And Function Identification [D] Agricultural University Of Nanjing, 2007) rataria of pBI220-CEBiP1-V conversion susceptible variety Yangmai No.158 is cured Injured tissue.About 2500 Yangmai No.158 Immature embryo callis of picking preculture 7d, in hypertonic culture medium (MS+ before bombardment ABA0.5mg/L+ caseinhydrolysate 500mg/L+2,4-D2mg/L+ glucose 30g/L+0.4mol/L mannitol, pH5.8) on it is pre- 6-8h are handled, CEBiP1-V gene overexpression vector pBI220-CEBiP1-V is transformed into Yangmai No.158 by particle bombardment Continue to cultivate 16h on hypertonic culture medium in callus, after bombardment.Callus is transferred to the sieve containing herbicide later (1/2MS+ABA0.5mg/L+ caseinhydrolysate 500mg/L+IAA 0.5mg/L+ sucrose 30g/L+4mg/L is selected on culture medium Bialaphos, pH5.8), screening and culturing 4 weeks.Then resistant callus is transferred in differential medium (1/2MS + L- paddy ammonia phthalein amine lmmol/L+ caseinhydrolysate 200mg/L+KT 1mg/L+IAA 0.5mg/L+ sucrose 30g/L+ agar 0.8%, pH5.8) broken up, when Bud Differentiation it is long to 2-4cm when transfer them to root media (1/2MS+IAA 0.5mg/ L+ sucrose 30g/L+ agar 0.8%, pH5.8) in, until regrowth be about 8cm, root system it is more healthy and stronger when, can 1-2d of open pipe hardening, The culture based draff for finally washing away root system carrying can be transplanted into basin alms bowl, obtain regeneration plant totally 86.All regeneration are extracted to plant Pnca gene group DNA utilizes across introne internal primer P7 (ATCCTCCTTTCTCGCATGCT, the SEQ ID of gene to transformed plant NO.9) and rice intron sequences special primer P8 (CGCTGCAGTTCAAACACCTT, SEQ ID NO.10) carries out PCR expansion Increase, identifies positive transgenic plant.PCR program: 50-100ng/ul genomic templates, each 0.5 μ l of 10 μM of P7 and P8；2.5μl 10×buffer；The dNTP of 2.5 μ l 2.5mM；The Mg of 1.5 μ l 25mM²⁺；0.25μl(5U/μl)Taq polymerase (TaKaRa), 25 μ l are added water to.PCR reaction condition are as follows: 94 DEG C of initial denaturation 3min；94 DEG C of 30s, 55 DEG C of 45s, 72 DEG C of 30s, 30 Circulation；72 DEG C of extension 10min.PCR product through 8% polyacrylate hydrogel electrophoresis detection, wherein 5 plants of mesh that can expand 253bp Band, be accredited as positive plant, strain is numbered successively are as follows: OE-CEBiP1-T₀-12、OE-CEBiP1-T₀-17、OE- CEBiP1-T₀-31、OE-CEBiP1-T₀-50、OE-CEBiP1-T₀- 74 (attached drawings 4).It is extracted the RNA of this 5 positive plants, The expression of CEBiP1-V gene in each positive plant is identified using qPCR.The result shows that: OE-CEBiP1-T₀-12、OE- CEBiP1-T₀-17、OE-CEBiP1-T₀-31、OE-CEBiP1-T₀-50、OE-CEBiP1-T₀- 74 transgenic positive plant The expression quantity of CEBiP1-V is 9-65 times (attached drawing 5) of Yangmai No.158.

Seedling stage powder mildew resistance uses the Powdery Mildew mixed bacteria of Fossils From Nanjing Area, Jiangsu field acquisition, reflects to all PCR Fixed T₀Powder mildew resistance identification is carried out for the excised leaf of positive plant and Yangmai No.158.Seedling stage powder mildew resistance identification mark Standard using " 0-5 grade " powder mildew resistance response type grade scale, 0-1 grades be highly resistance, 2-3 grades be in it is anti-, 4-5 grades the above are senses Disease.Strain-forming period resistance is using the Powdery Mildew mixed bacteria of Fossils From Nanjing Area, Jiangsu field acquisition in Field inoculation T0 for positive plant And Yangmai No.158 and carry out powder mildew resistance identification.Adult plant powder mildew resistance standard of perfection uses " 0-9 grades " powder mildew resistance The grade scale of response type, 0-2 grades be highly resistance, 3-4 grades be in resist, 5-6 grade be middle sense, 7-9 grade the above are high senses.Seedling stage is in vitro Powder mildew resistance identification and Adult plant powder mildew resistance the result shows that: Yangmai No.158 all shows as high sense with Adult plant in seedling stage, And OE-CEBiP1-T₀-12、OE-CEBiP1-T₀-17、OE-CEBiP1-T₀-31、OE-CEBiP1-T₀-50、OE-CEBiP1-T₀- The resistance of 74 transgenic positive strains is significantly higher than Yangmai No.158 (table 1, attached drawing 6).

Table 1

Sequence table

<110>Agricultural University Of Nanjing

<120>haynaldia villosa CEBiP1-V genes and its encoded albumen and application

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1080

<212> DNA

<213> Haynaldia villosa

<400> 1

atgccgctcc cgtcgccggc cgcccgactg gccatccagg ccgccgccct cctcgtcctc 60

ctcaacctcg ccgccacggc cacggcggcc aacttcacct gcagcgcgcc gcggggcacc 120

acctgccgct ccgccatcgg ctaccgcgtg cccaacgcca ccacctacgg ggacctcctc 180

gcgcgcttca acaccaccac cctcgccggc ctcctcggcg ccaacgacct cccgcccgcc 240

acctccccca agaggcgcgt ccccgccaag gccaccgtcc gcatcccctt ccgctgcctc 300

tgcgccggca acggcgtcgg ccagtcggac cacgcgcccg tctacaccgt gcagccgcag 360

gacgggctgg acgccatcgc ccgcaactcc ttcgacgccg tcgtcaccta ccaggagatc 420

gccaccgcca acaaggtcgc cgacgtcaac ctcatcaccg tcggccagaa gctctggatc 480

ccgctgccct gcagctgcga ccccgtcggc ggcgccgacg tcttgcactt cacccacatc 540

gtcgacgccg gggagaccac ctccggcatc gccgccgcct tcggcgtcac cgaggacacg 600

ctcctcaagc tcaacaagat cgccgacccc aagaccctcc agaaggacca ggttcttgat 660

gtcccgctcc ctgtctgcag ctcatcaatc agcaacacct cagctgatca tgatctgcgc 720

ctctccaacg gcacctatgc gctcaccgcg caggactgca tccagtgccg ctgcagttca 780

aacaccttcc agctaaactg caccgcactg caaggaaaaa agggatgccc agcagtgccg 840

ccgtgccgcg aagggctcaa gcttggggac acaaacggca ccggttgcga ctcgactatg 900

tgcgcttaca ctggttattc caacagccct tcgctcggca tacataccac tcttttcaaa 960

aaccagaccg caccagcatg cgagaaagga ggatcttcga ggtcggtgtt cgccgggtcc 1020

atgtggagga tatctgccat ctccttccac atggtgttga tcttggtatg cttcctttga 1080

<210> 2

<211> 359

<212> PRT

<213>haynaldia villosa (Haynaldia villosa)

<400> 2

Met Pro Leu Pro Ser Pro Ala Ala Arg Leu Ala Ile Gln Ala Ala Ala

1 5 10 15

Leu Leu Val Leu Leu Asn Leu Ala Ala Thr Ala Thr Ala Ala Asn Phe

20 25 30

Thr Cys Ser Ala Pro Arg Gly Thr Thr Cys Arg Ser Ala Ile Gly Tyr

35 40 45

Arg Val Pro Asn Ala Thr Thr Tyr Gly Asp Leu Leu Ala Arg Phe Asn

50 55 60

Thr Thr Thr Leu Ala Gly Leu Leu Gly Ala Asn Asp Leu Pro Pro Ala

65 70 75 80

Thr Ser Pro Lys Arg Arg Val Pro Ala Lys Ala Thr Val Arg Ile Pro

85 90 95

Phe Arg Cys Leu Cys Ala Gly Asn Gly Val Gly Gln Ser Asp His Ala

100 105 110

Pro Val Tyr Thr Val Gln Pro Gln Asp Gly Leu Asp Ala Ile Ala Arg

115 120 125

Asn Ser Phe Asp Ala Val Val Thr Tyr Gln Glu Ile Ala Thr Ala Asn

130 135 140

Lys Val Ala Asp Val Asn Leu Ile Thr Val Gly Gln Lys Leu Trp Ile

145 150 155 160

Pro Leu Pro Cys Ser Cys Asp Pro Val Gly Gly Ala Asp Val Leu His

165 170 175

Phe Thr His Ile Val Asp Ala Gly Glu Thr Thr Ser Gly Ile Ala Ala

180 185 190

Ala Phe Gly Val Thr Glu Asp Thr Leu Leu Lys Leu Asn Lys Ile Ala

195 200 205

Asp Pro Lys Thr Leu Gln Lys Asp Gln Val Leu Asp Val Pro Leu Pro

210 215 220

Val Cys Ser Ser Ser Ile Ser Asn Thr Ser Ala Asp His Asp Leu Arg

225 230 235 240

Leu Ser Asn Gly Thr Tyr Ala Leu Thr Ala Gln Asp Cys Ile Gln Cys

245 250 255

Arg Cys Ser Ser Asn Thr Phe Gln Leu Asn Cys Thr Ala Leu Gln Gly

260 265 270

Lys Lys Gly Cys Pro Ala Val Pro Pro Cys Arg Glu Gly Leu Lys Leu

275 280 285

Gly Asp Thr Asn Gly Thr Gly Cys Asp Ser Thr Met Cys Ala Tyr Thr

290 295 300

Gly Tyr Ser Asn Ser Pro Ser Leu Gly Ile His Thr Thr Leu Phe Lys

305 310 315 320

Asn Gln Thr Ala Pro Ala Cys Glu Lys Gly Gly Ser Ser Arg Ser Val

325 330 335

Phe Ala Gly Ser Met Trp Arg Ile Ser Ala Ile Ser Phe His Met Val

340 345 350

Leu Ile Leu Val Cys Phe Leu

355

<210> 3

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

atgccgctcc cgtcgccggc 20

<210> 4

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

tcaaaggaag cataccaag 19

<210> 5

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

atcgccaccg ccaacaagg 19

<210> 6

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

ggagcgggac atcaagaacc tg 22

<210> 7

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

cgggatccat gccgctcccg tcgcc 25

<210> 8

<211> 24

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

gaaggcctaa ggaagcatac caag 24

<210> 9

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

atcctccttt ctcgcatgct 20

<210> 10

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

cgctgcagtt caaacacctt 20

Claims

1. a haynaldia villosa CEBiP1-V gene, it is characterised in that its nucleotides sequence is classified as SEQ ID NO.1.

2. the protein of CEBiP1-V coded by said gene described in claim 1, it is characterised in that its amino acid sequence is SEQ ID NO.2。

3. containing the overexpression vector of CEBiP1-V gene described in claim 1.

4. the overexpression vector of CEBiP1-V gene according to claim 3, it is characterised in that with pBI220 carrier for out Carrier is sent out, it will be between BamHI the and StuI restriction enzyme site of CEBiP1-V gene forward direction described in claim 1 insertion pBI220 carrier Gained.

5. CEBiP1-V described in claim 1 is cultivating the application in powdery-mildew-resistance wheat kind.

6. the overexpression vector of gene containing CEBiP1-V described in claim 3,4 is cultivating answering in powdery-mildew-resistance wheat kind With.