CN110092820A - Bracteal leaf of corn length-adjusting albumin A RR8 and its encoding gene and application - Google Patents

Abstract

The invention discloses bracteal leaf of corn length-adjusting albumin A RR8 and its encoding gene and applications.The bracteal leaf of corn length-adjusting albumin A RR8 is following protein a) or b) or c) or d): a) amino acid sequence is protein shown in sequence 2；B) fused protein that the N-terminal of the protein shown in sequence 2 and/or C-terminal connection label obtain；C) protein with the same function for obtaining amino acid sequence shown in sequence 2 by the substitution and/or deletion and/or addition of one or several amino acid residues；D) homology with amino acid sequence shown in sequence 2 with 75% or 75% or more and protein with the same function.It is knocked out by transgenosis and the verifying of ARR8 mutant, the deletion mutant of ARR8 gene and the bract length of ARR8 mutant significantly reduces, illustrate that ARR8 plays an important role in regulation bract length is built up.

Description

Bracteal leaf of corn length-adjusting albumin A RR8 and its encoding gene and application

Technical field

The present invention relates to plant biotechnology fields, and in particular to bracteal leaf of corn length-adjusting albumin A RR8 and its coding base Cause and application.

Background technique

Corn machine receives the great change that seed is cropping pattern, is the key that realize the production of corn large area high-yield and high-efficiency Measure and development trend.However, in the prevalence of seed dewatering speed, excessively slow, harvest time contains the corn variety that China promotes at present The excessively high problem of water seriously constrains the industrialization process of corn combination machine receipts.Influence the factor of corn maturity period water content Including kind ripe phase, fruit ear bract character and itself rate of water loss of kernel grouting later period；Wherein, bract character itself is direct shadow Ring fruit ear dehydration, and indirectly influence Grain water scatter and disappear, be corn with high yield, suitable machine receive breeding need to preferentially solve it is key Shape.

Bracteal leaf of corn is the armour of fruit ear on fruit ear nutrient reservoir official and plant, is provided for fruit ear good Good developing environment.First, preference temperature needed for bract maintains Grain Development by package fruit ear.Especially in maize growth In the later period, in the case that harvest is likely encountered freeze injury, bract can prevent scattering and disappearing for heat, be effectively reduced freeze injury caused by cooling Rate.Second, bract can reduce water deficit caused by adverse circumstance environment to which bring maize reproductive inhibits.Third, reasonably Bract covering and tightness degree can be effectively reduced or eliminate the pollution of aflatoxins.4th, it is longer and tight when harvest corn Close bract can prevent disease and insect from entering inside fruit ear, to advantageously reduce or prevent the generation of pest and disease damage.

Corn ear belongs to abnormal side stem, and fruit ear handle be the stalk shortened, bract be exactly on fringe scapus give birth to by The abnormal leaf that leaf sheath is converted to.Fringe handle has section and the internode of shortening to break up, and each section has bract former base, and final development is female fringe Bract.Therefore, the quantity of bract is consistent with the joint number of fringe handle.After bract point is stretched out from fringe portion leaf sheath, bract area increases rapidly Greatly, this process continues to the spinning phase, and leaf color turns green, strong but pliable in texture, hard-pressed bale inflorescence.Fruit ear is similar to stem, but all sections Between it is all very short, and most upper section is most short, and other each sections gradually increase, and what is grown at first is the leaf on most base portion section, other each leaf structures At " fruit ear bud ", enclosure and protection " basidixed fruit ear ".In this way, fruit ear panel length and the degree of packing of bract are closely related.Bract In stretching process, expanding for leaf area is related with bract elongation time and stretching, extension efficiency, also has with cell liquid and cell wall composition Certain relationship.

The genetic development of each phenotypic character of bracteal leaf of corn will determine the direction of its selection and improvement.In recent years, by high temperature drought injury Influence, Liaoning, Heilungkiang, Shanxi, there is " corn Lu top " phenomenon in more ground corns such as Shandong, and maize ear bract compares cob It is short, keep seed exposed outside, influences to be in the milk, lead to the underproduction；In addition, the short easy trick insect pest of bract, such as chrysomelid insect bite of double spot fireflies Filigree, chafer bite seed are eaten, will also result in the underproduction.Therefore, suitable bracteal leaf of corn length promotes the yield of corn Play a significant role.

Summary of the invention

The technical problem to be solved by the present invention is to how regulate and control bracteal leaf of corn character.

In order to solve the above-mentioned technical problem, present invention firstly provides a kind of protein.

The entitled ARR8 protein of protein provided by the invention, the ARR8 protein be it is following a) or b) or c) or D) protein:

A) amino acid sequence is protein shown in sequence 3；

B) fused protein that the N-terminal of the protein shown in sequence 3 and/or C-terminal connection label obtain；

C) by amino acid sequence shown in sequence 3 by one or several amino acid residues substitution and/or missing and/or Add obtained protein with the same function；

D) homology with amino acid sequence shown in sequence 3 with 75% or 75% or more and egg with the same function White matter.

In order to make protein in a) convenient for purifying, can in sequence table the amino terminal of protein shown in sequence 3 or Carboxyl terminal connects upper label as shown in Table 1.

The sequence of table 1, label

Label	Residue	Sequence
			Poly-Arg	5-6 (usually 5)	RRRRR
Poly-His	2-10 (usually 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

It is above-mentioned c) in protein, the substitutions of one or several amino acid residues and/or deletion and/or addition is not More than the substitution and/or deletion and/or addition of 10 amino acid residues.

It is above-mentioned c) in protein can be artificial synthesized, can also first synthesize its encoding gene, then carry out biological expression and obtain.

It is above-mentioned c) in the encoding gene of protein can be one or several by will be lacked in DNA sequence dna shown in sequence 2 The codon of amino acid residue, and/or the missense mutation of one or several base-pairs is carried out, and/or at its 5 ' end and/or 3 ' ends The coded sequence for connecting label shown in table 1 obtains.

It is above-mentioned d) in, " homology " include with amino acid sequence shown in sequence of the invention 3 have 75% or higher, or 80% or higher or 85% or higher or 90% or higher or 95% or more high homology amino acid sequence.

In order to solve the above-mentioned technical problem, invention further provides biomaterials relevant to ARR8 protein.

Biomaterial relevant to ARR8 protein provided by the invention is following A 1) any one of to A12):

A1 the nucleic acid molecules of ARR8 protein) are encoded；

A2) contain A1) expression cassettes of the nucleic acid molecules；

A3) contain A1) recombinant vectors of the nucleic acid molecules；

A4) contain A2) recombinant vector of the expression cassette；

A5) contain A1) recombinant microorganisms of the nucleic acid molecules；

A6) contain A2) recombinant microorganism of the expression cassette；

A7) contain A3) recombinant microorganism of the recombinant vector；

A8) contain A4) recombinant microorganism of the recombinant vector；

A9) contain A1) the transgenic plant cells systems of the nucleic acid molecules；

A10) contain A2) the transgenic plant cells system of the expression cassette；

A11) contain A3) the transgenic plant cells system of the recombinant vector；

A12) contain A4) the transgenic plant cells system of the recombinant vector.

In above-mentioned relevant biological material, A1) nucleic acid molecules be it is following 1) or 2) or 3) shown in gene:

1) its coded sequence is cDNA molecule or genomic DNA molecule shown in sequence 1 or sequence 2；

2) there is 75% or 75% or more identity with the nucleotide sequence 1) limited, and encodes the cDNA of ARR8 protein Molecule or genomic DNA molecule；

1) or 2) 3) and the cDNA molecule of ARR8 protein is encoded with the nucleotide sequence hybridization that limits under strict conditions Or genomic DNA molecule.

Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules can also To be RNA, such as mRNA or hnRNA.

Those of ordinary skill in the art can easily adopt by known method, such as the side of directed evolution and point mutation Method is mutated the nucleotide sequence of coding ARR8 protein of the invention.Those are by manually modified, with coding The nucleotide sequence 75% of ARR8 protein or the nucleotide of higher identity, as long as encoding ARR8 protein and having identical Function is derived from nucleotide sequence of the invention and to be equal to sequence of the invention.

Term " identity " used herein refers to the sequence similarity with native sequence nucleic acid." identity " includes and this hair Amino acid sequence shown in bright coded sequence 3 composition protein nucleotide sequence have 75% or higher or 85% or Higher or 90% or higher or 95% or higher identity nucleotide sequence.Identity can with the naked eye or computer software It is evaluated.Using computer software, identity between two or more sequences can be indicated with percentage (%), can be with For evaluating the identity between correlated series.

Above-mentioned 75% or 75% or more identity can be 80%, 85%, 90% or 95% or more identity.

In above-mentioned biomaterial, the stringent condition is hybridized simultaneously at 68 DEG C in 2 × SSC, the solution of 0.1%SDS It washes film 2 times, each 5min, and in 0.5 × SSC, the solution of 0.1%SDS, hybridize at 68 DEG C and washes film 2 times, every time 15min；Or, hybridizing under the conditions of 65 DEG C in the solution of 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS and washing film.

In above-mentioned biomaterial, A2) described in the nucleic acid molecules containing coding ARR8 protein expression cassette (ARR8 gene Expression cassette) it is the DNA for referring to express ARR8 protein in host cell, which not only may include that starting ARR8 is transcribed Promoter may also include the terminator for terminating ARR8 transcription.Further, the expression cassette may also include enhancer sequence.It can use Include but is not limited in promoter of the invention: constitutive promoter；It organizes, the promoter and induction type that organ and development are special Promoter.

The recombinant vector of the ARR8 expression casette can be contained with existing expression vector establishment.The plant expression carries Body includes double base agrobacterium vector and the carrier etc. that can be used for plant micropellet bombardment.As pAHC25, pBin438, PCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or PCAMBIA1391-Xb (CAMBIA company) etc..The plant expression vector also may include 3 ' end non-translational regions of foreign gene Domain, i.e., comprising polyadenylation signals and any other DNA fragmentation for participating in mRNA processing or gene expression.The polyadenylic acid letter Number bootable polyadenylic acid is added to 3 ' ends of mRNA precursor, as Agrobacterium crown gall nodule induces (Ti) plasmid gene (such as nopaline Synthase gene Nos), plant gene (such as soybean storage protein genes) 3 ' end transcription non-translational region all have similar functions. When using gene constructed plant expression vector of the invention, enhancer, including translational enhancer or transcriptional enhancer also can be used, These enhancer regions can be ATG initiation codon or neighboring region initiation codon etc., but must read with coded sequence Frame is identical, to guarantee the correct translation of entire sequence.The source of the translation control signal and initiation codon be it is extensive, Can be it is natural, be also possible to synthesis.Translation initiation region can come from transcription initiation region or structural gene.In order to just In transgenic plant cells or plant are identified and screened, plant expression vector used can be processed, it can as being added The coding expressed in plant can produce the enzyme of color change or gene (gus gene, luciferase genes of luminophor Deng), the marker gene of antibiotic (if assigned the nptII gene to kanamycins and associated antibiotic resistance, assigns to herbicide The bar gene of phosphinothricin resistance assigns the hph gene to antibiotic hygromycin resistance, and assigns to methotrexate resistance Dhfr gene is assigned to the EPSPS gene of glyphosate) or (such as anti-herbicide base such as anti-chemical reagent marker gene Cause), provide metabolism mannose ability mannose-6-phosphate isomerase gene.It, can not from the security consideration of genetically modified plants Add any selected marker, transformed plant is directly screened with adverse circumstance.

In above-mentioned biomaterial, the carrier can be plasmid, sticking grain, bacteriophage or viral vectors.

In above-mentioned biomaterial, the microorganism can be yeast, bacterium, algae or fungi, such as Agrobacterium.

In above-mentioned biomaterial, the transgenic plant cells system, Transgenic plant tissue and genetically modified plants organ are equal It does not include propagation material.

In order to solve the above-mentioned technical problem, the present invention also provides above-mentioned ARR8 protein or above-mentioned relevant biological materials New application.

The answering in regulation bracteal leaf of corn character the present invention provides above-mentioned ARR8 protein or above-mentioned relevant biological material With.

In above-mentioned application, the bract character is bract length.

The regulation bract length is embodied in when ARR8 gene lacks functionality, and bract length shortens.

The present invention also provides above-mentioned ARR8 protein or above-mentioned relevant biological material to turn what cultivation bract length shortened Application in gene corn.

The present invention also provides the application of above-mentioned ARR8 protein or above-mentioned relevant biological material in corn breeding.

In order to solve the above-mentioned technical problem, the present invention finally provides a kind of transgenic corns that cultivation bract length shortens Method.

The method provided by the invention for cultivating the transgenic corns that bract length shortens includes reducing ARR8 in recipient corn The expression quantity and/or activity of protein, the step of obtaining transgenic corns；The bract of the transgenic corns is shorter in length than described Recipient corn.

In the above method, the expression quantity of ARR8 protein and/or active method are to pass through in the reduction recipient corn The encoding gene of ARR8 protein in the recipient corn is knocked out or inhibited or silencing expression to realize.

The nucleotide sequence of the encoding gene of the ARR8 protein is DNA molecular shown in sequence 1.

Further, the encoding gene of ARR8 protein in the recipient corn is knocked out or inhibited or silencing expression Method be struck using encoding gene of the CRISPR-Cas9 gene Knockout to ARR8 protein in the recipient corn It removes or the encoding gene of ARR8 protein in the recipient corn is mutated.

Further, using CRISPR-Cas9 gene Knockout to the volume of ARR8 protein in the recipient corn The method that code gene is knocked out is by will realize in recipient corn described in CRISPR/Cas9 vector introduction.

In a specific embodiment of the present invention, the CRISPR/Cas9 carrier is that double target sites will be had shown in sequence 4 DNA sequence dna insertion pBUE411 carrier obtained in carrier.Wherein, DNA molecular shown in sequence 4 25-100 is sgRNA DNA sequences encoding.

The method being mutated to the encoding gene of ARR8 protein in the recipient corn is by beautiful in the receptor Insertion mutator transposons is realized in the ARR8 gene order of rice genome sequence.

In the above method, the recipient corn is wild-type corn B104 or wild-type corn W22 self-mating system.

The present invention provides an ARR8 albumen relevant to bracteal leaf of corn length, by comparing point to its amino acid sequence Analysis discovery ARR8 albumen contains a highly conserved Myb_DNA_bing structural domain and a cytokinin response_ Reg structural domain.By transgenosis knock out and ARR8 mutant verifying, the deletion mutant (crispr-arr) of ARR8 gene and The bract length of ARR8 mutant significantly reduces, and illustrates that ARR8 plays an important role in regulation bract length is built up.

Detailed description of the invention

Fig. 1 is albumen conserved domain schematic diagram.Note: green portion is Response_reg structural domain, and RED sector is Myb_DNA_bing structural domain.

Specific embodiment

Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly What routine biochemistry reagent shop was commercially available.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result makes even Mean value.

PBUE411 carrier in following embodiments be recorded in " Xing, H.L., Dong, L., Wang, Z.P., Zhang, H.Y.,Han,C.Y.,Liu,B.,Wang,X.C.,and Chen,Q.J.(2014).A CRISPR/Cas9 toolkit for In 14,327. " document of multiplex genome editing in plants.BMC plant biology, the public can be from It is obtained at China Agricultural University, which only attaches most importance to used in the related experiment of duplicate invention, and not can be used as other purposes makes With.

Corn B104 in following embodiments be recorded in " Char, S.N., Neelakandan, A.K., Nahampun, H., Frame,B.,Main,M.,Spalding,M.H.,Becraft,P.W.,Meyers,B.C.,Walbot,V.,Wang,K., Yang,B.(2016).An Agrobacterium-delivered CRISPR/Cas9 system for high- frequency targeted mutagenesis in maize.Plant biotechnology journal,15(2), In 257-268. " document, the public can from B73 genome public database buy obtain, the biomaterial only attach most importance to duplicate invention Related experiment used in, not can be used as other purposes and use.

Embodiment 1, the acquisition of ARR8 albumen and its encoding gene and sequence analysis

One, the acquisition of ARR8 albumen and its encoding gene

It is found in studying bracteal leaf of corn phenotype, GRMZM2G479110 gene is in regulation bracteal leaf of corn length It plays an important role.GRMZM2G479110 gene (V4 version gene number is Zm00001d018380) is located on No. 5 chromosomes, entirely Long 4805bp shares 6 exons, encodes 676 amino acid.It is ARR8, ARR8 gene by GRMZM2G479110 unnamed gene Sequence is as shown in sequence 1, and the CDS sequence of ARR8 gene is as shown in sequence 2, the amino acid sequence such as sequence 3 of ARR8 gene coding It is shown.

Two, sequence is analyzed

It is scanned for using multiple protein structure domain forecasting softwares (SMART, CDD, PFAM), the results showed that ARR8 gene Encoding ARR8 albumen includes a highly conserved Myb_DNA_bing structural domain and a cytokinin response_Reg Structural domain (Fig. 1).In corn B73 genome public database (www.maizeGDB.org), carried out using BLASTP program Protein sequence retrieval, GRMZM2G479110 gene consider from its overall length, only comprising a copy on B73 genome, without it Its similar genes.

Embodiment 2, the verifying of ARR8 gene function

One, the acquisition of the deletion mutant (crispr-arr) of ARR8 gene and its phenotypic analysis

1, the acquisition of the deletion mutant (crispr-arr) of ARR8 gene

A corn has been formulated in conjunction with corn gene genetic transforming method by CRISPR-Cas9 gene Knockout The deletion mutant (crispr-arr) of ARR8 gene, mutational site are located at first exon encoding histone initiation codon It is the encoding histone missense mutation as caused by the missing of 61 bases at the 28bp of the downstream ATG.Specific step is as follows:

1) selection of sgRNA sequence

Target site sequence, length 20bp are designed on corn ARR8 gene.

Target site 1 is located at 1196-1215 of ARR8 gene order (sequence 1), and 1 sequence of target site is as follows: TGGGGAGAGTCAGGGACCAG。

Target site 2 is located at 1257-1276 of ARR8 gene order (sequence 1), and 2 sequence of target site is as follows: CGTGTGCCTCAAGGTGCTTG。

SgRNA sequence is as follows: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC；

The DNA sequences encoding of sgRNA is as follows: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTA TCAACTTGAAAAAGTGGCACCGAGTCGGTGC。

2) building of CRISPR/Cas9 carrier

Four primer PCR amplifications are carried out by template of pCBC-MT1T2 carrier, obtain PCR product, for double target sites Sequence (sequence 4).Primer sequence is as follows:

ARR12-MT1T2-F:AATAATGGTCTCAGGCGTGGTCCCTGACTCTCCCCA；

ARR12-MT1T2-F0:GTGGTCCCTGACTCTCCCCAGTTTTAGAGCTAGAAATAGC；

ARR12-MT1T2-R0:CGTGTGCCTCAAGGTGCTTCGCTTCTTGGTGCC；

ARR12-MT1T2-R:ATTATTGGTCTCTAAACCGTGTGCCTCAAGGTGCTT.

By in the DNA sequence dna insertion pBUE411 carrier shown in sequence 4 with double target sites, CRISPR/Cas9 load is obtained Body.Wherein, DNA molecular shown in sequence 4 25-100 is the DNA sequences encoding of sgRNA.

3) acquisition of transgenic corn plant

CRISPR/Cas9 carrier is gone into Agrobacterium competent cell EHA105 (purchased from Beijing Austria by liquid nitrogen freezing Sen Dingxin Bioisystech Co., Ltd), obtain recombinant bacterium EHA105/CRISPR/Cas9.By recombinant bacterium EHA105/CRISPR/ Cas9 expands numerous under the conditions of 28 DEG C, expands numerous obtained bacterium solution using Agrobacterium infestation method and infects corn B104 rataria, by screening, After breaking up and taking root, T0 is obtained for transgenic corn plant.

4) identification of transgenic corn plant

T0 is acquired for transgenic corn plant blade, and extracts genomic DNA as template, with left primer crispr- Arr-F and right primer crispr-arr-R primer carry out PCR amplification, obtain the pcr amplification product of different strains.Primer sequence is such as Under:

Left primer crispr-arr-F:TCAGCTACTGCTGCTCTGC；

Right primer crispr-arr-R:TCTAACAACGCAGCGCTGAAC.

The pcr amplification products of different strains is subjected to Sanger sequencing, and by sequencing result and wild-type corn ARR8 base Because being compared, whether identification T0 mutates for ARR8 gene in transgenic corns difference strain.

Qualification result shows: 15 plants of T0 are in transgenic corn plant, ARR8 gene of 4 plants of T0 for transgenic corn plant It mutates.The plant that ARR8 gene mutates is positive T0 for transgenic corns, and missing is occurred for ARR8 gene and is dashed forward The plant of change is denoted as the deletion mutant (crispr-arr) of ARR8 gene.

The mutational site of the deletion mutant (crispr-arr) of ARR8 gene is located at first exon encoding histone and rises It is the encoding histone missense mutation as caused by the missing of 61 bases at beginning codon ATG downstream 28bp.

It is compared with wild-type corn B104, deletion mutant (crispr-arr) is will be in wild-type corn B104 genome ARR8 gene order 1199-1259 missings, and keep obtaining after other sequences are constant.Deletion sequence is as follows: GGAG AGTCAGGGACCAGTTCCCCGTCGGCATGAGGGTCCTCGCCGTGGACGACGACCCCGT。

2, the phenotypic analysis of crispr-arr mutant

The bract length of crispr-arr mutant and wild type is measured, the specific method is as follows: in corn kernel After full maturity, same time before harvest, field investigation bract length chooses corn ear and counts third pieces bud from outside to inside Leaf, with tightrope ruler measurement bract length, (bract length herein refers to the length at the top of bract base portion to bract, does not include most pushing up The boot leaf of end part).

The result shows that: crispr-arr mutant bract length average out to 12.5cm, wild type bract length average out to 19.6cm.Compared with wild type, crispr-arr mutant about reduces 35% bracteal leaf of corn length, and plant its other party Face phenotype does not have any significant changes.

Two, ARR8 mutant and its phenotypic analysis

1, the acquisition and identification of ARR8 mutant

(1) acquisition of ARR8 mutant

(www.maizeGDB.org) obtains 1 positioned at the area gene 5 ' UTR from B73 genome public database UnifromMu insertion mutation body (is purchased from B73 genome public database, mutant no UFMu-06545), by the mutation Body is named as ARR8 mutant.

It is compared with wild-type corn W22 self-mating system (being purchased from B73 genome public database), ARR8 mutant is will be wild It is inserted between any two base between 466-475 of ARR8 gene order in type W22 self-mating system genome sequence It is obtained after mutator transposons.The mutator transposon sequence of insertion is specific as shown in sequence 5.

(2) identification of ARR8 mutant

Using left primer arr-Mu06545-F, left primer arr-Mu06545-R and Mutator insertion primer ZmMuTIR mirror Determine ARR8 mutant gene type.If arr-Mu06545-F and arr-Mu06545-R amplify band, while arr-Mu06545-F Or arr-Mu06545-R and ZmMuTIR PCR amplification not shaping band, then the single plant is that (ARR8 is wild by homozygous wildtype materials A A Type plant)；If arr-Mu06545-F and arr-Mu06545-R expands not shaping band, while arr-Mu06545-F or arr- Mu06545-R and ZmMuTIR PCR amplification shaping band, then the single plant is that Mutants homozygous material aa (plant by ARR8 Mutants homozygous Strain)；If arr-Mu06545-F and arr-Mu06545-R amplify band, while arr-Mu06545-F or arr-Mu06545-R With ZmMuTIR PCR amplification shaping band, then the single plant is Heterozygous mutants materials A a (ARR8 Heterozygous mutants plant).

Mutant gene type identifies that primer is as follows:

Left primer arr-Mu06545-F:AGCAGTGGTCTCGAATGGC；

Right primer arr-Mu06545-R:GCAGAACCAACCTACTACT；

Mutator is inserted into primer ZmMuTIR:AGAGAAGCCAACGCCAWCGCCTCYATTTCGTC.

It identifies to obtain ARR8 Heterozygous mutants plant through said gene type.

2, the phenotypic analysis of ARR8 mutant

Summer in 2018 sows 45 ARR8 Heterozygous mutants plant (heterozygous Aa) identified through step 1 in Tieling altogether Seed, every row sow 9, totally 5 row, take seedling leaves to carry out genotype identification according to the method in step 1 after emergence, are obtained 11 plants of homozygous wildtype AA single plant (ARR8 WT lines), 9 plants of single plant of Mutants homozygous aa (ARR8 Mutants homozygous plant). The bract length of homozygous wildtype AA single plant and Mutants homozygous aa single plant to acquisition measures, the same step 1 of specific method 2.

The result shows that: the bract average length of homozygous wildtype AA is 27.2cm, and the bract of Mutants homozygous aa is averagely long Degree is 24.5cm.Compared with homozygous wildtype AA, the bract length of Mutants homozygous aa shortens 10% or so, and is not observed The significant changes of the other characters of plant.

Above-mentioned transgenosis knocks out and Mutator mutation type surface statistical result shows: ARR8 is built up in regulation bract length In play an important role, ARR8 have the function of regulate and control bracteal leaf of corn length.

Sequence table

<110>China Agricultural University

<120>bracteal leaf of corn length-adjusting albumin A RR8 and its encoding gene and application

<160>5

<170>PatentIn version 3.5

<210>1

<211>4805

<212>DNA

<213>artificial sequence (Artificial Sequence)

<400>1

agtattaaga gattcagata aaacaaaaag aatacaccgc ggagtagcag tacaaattta 60

cggagagata gagagagggc tttgacagtt tcacaggagg tagcagtggt ctcgaatggc 120

ttggttgcat tgcacggcgg agaggatcac gcacgctgta gttaccagtg gttgcttgga 180

catgggcggg gtccactcgc ttttcccgcc gccgccacca ccgccatttt gacccacgta 240

tatctaccat ccatggctgc cagccatggg aggatgctcg ccaccgcacc gcccgtgcca 300

caggaaccaa aagctacaga cctctcgtca atccatgctg agcagcagtg gcgctgtgga 360

agaggcggag cggaggggag gggaggggag ccgagcttgg cgtggactgt agtgactgct 420

gagcttgctt gtgtagaaga ggtgggaaag agggaagagt cagagaggga gacagaggtg 480

gcttggttca tctgtaacag tcgccatctc tgcctgcttt ccagctcctt tgcttgcttt 540

ccctgcccat ctcttttgtt ctggcctgcc ctctccatcc cgtccaactc cctatccttc 600

ctccttttgc tttcccacat ctttgctcca ataatgatgg cgtggtggtg ggtttggtcg 660

tgaacctgcc gctgtggctg tgctgcatcc cccaccctcg ccgctccctc gtccaaatcc 720

accagccgtt cgctttcctc tcctctcctc tccatcatcc cggccggctc gccagtcgcc 780

accctccctt tcctcttttc agctacagtt gagcttgggc agtagtaggt tggttctgct 840

tcccttcccc tcccccgatc ccttttcctt gctggggatc gggaggcctt caggcttcaa 900

cccatcttcc tccctgtcca catctcgctc cttgtttggg gtagtgccgg ctggtggtgc 960

cgctactgct agccgggaac ccaatttctt gataggactg gacgactggt gcgtgccaac 1020

cacgagtttt tcctgttcgc tttgctttct cggctcagct actgctgctc tgctaggaac 1080

accaacagta gtgtgttctt gcgccggctt ttcttgccgt gtttcgggtc gatattattg 1140

ggagggtggg tctcccgtcc cgtttcgatg aggccggagg agagagatgc tgccgtgggg 1200

agagtcaggg accagttccc cgtcggcatg agggtcctcg ccgtggacga cgaccccgtg 1260

tgcctcaagg tgcttgagaa cctcctgcgc cgctgccagt atcatggtaa ggatttctgc 1320

gccacagggc tatcattttt atttctgcgg cctggagact gctagtatat atatttctag 1380

ttcagcgctg cgttgttaga tttctctttt cctggatttt gccaaattat ctgcttccag 1440

agtagacgct aaaaaataaa gatgctgttg tgcaattgcg taacactagt tgttacagtt 1500

atatattaca tatgtactta tcatgtatag attcttcccg cagctacaga tttgtttaca 1560

tcgaatgatc aaaatagtta agcactgaat tggtaacctc actacacttt ttatattatg 1620

tatgctgcat ttttttgggt gggtgtacta caatttgggt actttcacat gcagtatgta 1680

caagatgctt gttctggctt ttgctatagc tactcacctg taagactttt catatttgca 1740

gtgacaacga cgaatcaggc tgttgtcgcc ttgagtatgc tgaggcaaaa cagggacctg 1800

tttgatcttg ttattagtga tgttcacatg ccagacatgg atggctttaa gcttctagag 1860

cttgtggggc ttgaaatgga cctccctgtc attagtaagt caaaattgct atatcttact 1920

ggtggccgac tctcactgtt gttgatagta gtatgcagct tttatttaat gatattctta 1980

taccatcttc aaagtaacca tggcatacag caaatcttaa gcctgtattt gaggaaggca 2040

aaacttagaa tgctaacatg tcattataca tgcagtgtta tcggtgaatg gagagacaaa 2100

aactgtaatg aaggggataa ctcatggtgc ctgtgactat ctcttaaaac cggttcggct 2160

ggaagagctt aggaatatct ggcagcatgt tgttaggagg aaattcagta actgtgatcg 2220

tgctaacaat gatggctatg aggagtgcaa taggccatca aatgcagatt ttgatcttgc 2280

tcacagccaa attacagctg ggccacctga ccaaagtggg aggcccagca aaaagaggaa 2340

ggaatatcat agtgaagagg aagatgaagg agaagagagt aatggccaag ataacgatga 2400

tccttcagct ccaaagaaac caagggttgt ttggtcagtt gaactgcacc gaaaatttgt 2460

tgctgctgtc aatcagctag gaattgacag tgagtcccac tgccacctgc tgtttttttt 2520

tcagctttgc tgctgttaag ttatttgcca cggttcattc acaacctaat cttttctgtt 2580

gacgcagaag ccgtgccaaa aaggatactt gagctcatga atgttgagag actcaccagg 2640

gaaaatgttg caagtcacct gcaggcaagg catctatgga cttaacccca ctttgttctg 2700

tttagccgcc tcaccaccct cattaagcaa gacatatctg ttttaggaat actatacagt 2760

gggagtgcat gacaagtgca tatatttatt aaaattcttt ggttgttgct gaccagtctt 2820

ataaatgtgg aagaaaggac acatagactg ttccatagct gtattttcag tttatcgtgt 2880

aacatttggt ttagacttaa tattgcatac attgtgaagc tgaaaaggac tcagcaagca 2940

tatccctgca aaattgctcc tcttgttact gtacatatcc aatgccaaaa taaactaaat 3000

tgtagctgac catatatata tgcatctaaa ctgtttgctt tgtgtgccat gcagaagtat 3060

agactctacc ttaaacggct aagtgctgtg gcatcacaac aggctagcat tgttgctgct 3120

ttgggaggca acgacccctt tatgcggatg agtgcatttg aaggactcca tggttatcaa 3180

tcttttgtct cttcagcagc tctgccatct ttcagtccac agggactgtt aaatagaaat 3240

aatccagcat catttgcgat tcaaggggtg tctgcttcca ggccaattca gattgcaacc 3300

ggcaatacca caatgagtca ttccattggc gatccaaatg ataaatatca ccttagctta 3360

ccaggcacta gttgcctaca aggaaatcta gcacaaggtt tgccaactcc agttgggcag 3420

gtccagctgc cacagaagtg gatacacgaa gaaaccgacg atctatctac tatcctttct 3480

gcgagtggcc gggctaatag tggtgttcct ggcacactcc aaagtgtcac gaacagtcac 3540

ttgctgcagc aaggctttgt tgaacgtaga caagacaaag ttgttatcca gccatcttca 3600

tctgcaagtt cagatcgtcc tgaaggcact gttggagttt cctccagtct gatggattcc 3660

tgtgcaaccc agcagagggt tgttccattg tctgccttct ctagcagtgc atctccaatg 3720

aatggctcgt tttgcagcaa cggtgtagct gagttgggtg ctacatcctc tggaggtaca 3780

agtattttcc cctccaatga cctgaggata gaaagagaca gcaaagtggg agctagctct 3840

tttggtagtg tgatacttct gtctccagac actgtgccaa accaaaaata cttgaacttc 3900

ggcggtggaa gcgatttgag atcgaacatg gagggaggga acgcaggcaa tctgttgaat 3960

cccaagctac tatggagttg tttgccggcc tctcagccgc ctaatcttat cggaagtcat 4020

catcccatga gccaaagact gaaccttggc ggctcaatgg tcagacagac aacagcaagt 4080

gcttcggcag ctgccccaca gacgaggatc gacatgttta tctctggaga cgctccgaag 4140

agcgcgtcgg atttgagctt ccctaaggtc cacagcgagc ttagctctag cagctgcagc 4200

ttcgacggcc tcctcaactc cataatcaaa gtggtaagga ggctcttgtt atgtttcaac 4260

aactagtttg tgcagggttc gtcttctgac caaaggaagg agtacctgta cctgcaaaca 4320

ttctgtctct ctctctcccc ccagcatttt catctaacag caatgctgat tgctgatccc 4380

cgttgcagga gaaggacgat gcttccttca gcgatgacct gggatgcgac ttgtactccc 4440

tgggtgcctg tatatgatcg ctaccttcca cgtatctgca tctgcatctg tgttaatctc 4500

ccattgtatg ctgtgcagct agtgttaatc ttaggtagaa ttgtagctgt gcgcctatct 4560

ttgcttgccc acagccaaga aaaaaaaatt atgtctgcac gtgatgtgct agcagtaaga 4620

tatctggatt gtggaagtca atgcccattt gctaaatcga gctggagaca ctgttggcac 4680

gagttgattc taaaagcggc cttgatgatc taggcccaat ttgaatgtcg acacactggt 4740

aatgacacgt ggtgttcatg taaacaaatc caaaagttca aaacaaattg ggagatttga 4800

agtcg 4805

<210>2

<211>2031

<212>DNA

<213>artificial sequence (Artificial Sequence)

<400>2

atgaggccgg aggagagaga tgctgccgtg gggagagtca gggaccagtt ccccgtcggc 60

atgagggtcc tcgccgtgga cgacgacccc gtgtgcctca aggtgcttga gaacctcctg 120

cgccgctgcc agtatcatgt gacaacgacg aatcaggctg ttgtcgcctt gagtatgctg 180

aggcaaaaca gggacctgtt tgatcttgtt attagtgatg ttcacatgcc agacatggat 240

ggctttaagc ttctagagct tgtggggctt gaaatggacc tccctgtcat tatgttatcg 300

gtgaatggag agacaaaaac tgtaatgaag gggataactc atggtgcctg tgactatctc 360

ttaaaaccgg ttcggctgga agagcttagg aatatctggc agcatgttgt taggaggaaa 420

ttcagtaact gtgatcgtgc taacaatgat ggctatgagg agtgcaatag gccatcaaat 480

gcagattttg atcttgctca cagccaaatt acagctgggc cacctgacca aagtgggagg 540

cccagcaaaa agaggaagga atatcatagt gaagaggaag atgaaggaga agagagtaat 600

ggccaagata acgatgatcc ttcagctcca aagaaaccaa gggttgtttg gtcagttgaa 660

ctgcaccgaa aatttgttgc tgctgtcaat cagctaggaa ttgacaaagc cgtgccaaaa 720

aggatacttg agctcatgaa tgttgagaga ctcaccaggg aaaatgttgc aagtcacctg 780

cagaagtata gactctacct taaacggcta agtgctgtgg catcacaaca ggctagcatt 840

gttgctgctt tgggaggcaa cgaccccttt atgcggatga gtgcatttga aggactccat 900

ggttatcaat cttttgtctc ttcagcagct ctgccatctt tcagtccaca gggactgtta 960

aatagaaata atccagcatc atttgcgatt caaggggtgt ctgcttccag gccaattcag 1020

attgcaaccg gcaataccac aatgagtcat tccattggcg atccaaatga taaatatcac 1080

cttagcttac caggcactag ttgcctacaa ggaaatctag cacaaggttt gccaactcca 1140

gttgggcagg tccagctgcc acagaagtgg atacacgaag aaaccgacga tctatctact 1200

atcctttctg cgagtggccg ggctaatagt ggtgttcctg gcacactcca aagtgtcacg 1260

aacagtcact tgctgcagca aggctttgtt gaacgtagac aagacaaagt tgttatccag 1320

ccatcttcat ctgcaagttc agatcgtcct gaaggcactg ttggagtttc ctccagtctg 1380

atggattcct gtgcaaccca gcagagggtt gttccattgt ctgccttctc tagcagtgca 1440

tctccaatga atggctcgtt ttgcagcaac ggtgtagctg agttgggtgc tacatcctct 1500

ggaggtacaa gtattttccc ctccaatgac ctgaggatag aaagagacag caaagtggga 1560

gctagctctt ttggtagtgt gatacttctg tctccagaca ctgtgccaaa ccaaaaatac 1620

ttgaacttcg gcggtggaag cgatttgaga tcgaacatgg agggagggaa cgcaggcaat 1680

ctgttgaatc ccaagctact atggagttgt ttgccggcct ctcagccgcc taatcttatc 1740

ggaagtcatc atcccatgag ccaaagactg aaccttggcg gctcaatggt cagacagaca 1800

acagcaagtg cttcggcagc tgccccacag acgaggatcg acatgtttat ctctggagac 1860

gctccgaaga gcgcgtcgga tttgagcttc cctaaggtcc acagcgagct tagctctagc 1920

agctgcagct tcgacggcct cctcaactcc ataatcaaag tggagaagga cgatgcttcc 1980

ttcagcgatg acctgggatg cgacttgtac tccctgggtg cctgtatatg a 2031

<210>3

<211>676

<212>PRT

<213>artificial sequence (Artificial Sequence)

<400>3

Met Arg Pro Glu Glu Arg Asp Ala Ala Val Gly Arg Val Arg Asp Gln

1 5 10 15

Phe Pro Val Gly Met Arg Val Leu Ala Val Asp Asp Asp Pro Val Cys

20 25 30

Leu Lys Val Leu Glu Asn Leu Leu Arg Arg Cys Gln Tyr His Val Thr

35 40 45

Thr Thr Asn Gln Ala Val Val Ala Leu Ser Met Leu Arg Gln Asn Arg

50 55 60

Asp Leu Phe Asp Leu Val Ile Ser Asp Val His Met Pro Asp Met Asp

65 70 75 80

Gly Phe Lys Leu Leu Glu Leu Val Gly Leu Glu Met Asp Leu Pro Val

85 90 95

Ile Met Leu Ser Val Asn Gly Glu Thr Lys Thr Val Met Lys Gly Ile

100 105 110

Thr His Gly Ala Cys Asp Tyr Leu Leu Lys Pro Val Arg Leu Glu Glu

115 120 125

Leu Arg Asn Ile Trp Gln His Val Val Arg Arg Lys Phe Ser Asn Cys

130 135 140

Asp Arg Ala Asn Asn Asp Gly Tyr Glu Glu Cys Asn Arg Pro Ser Asn

145 150 155 160

Ala Asp Phe Asp Leu Ala His Ser Gln Ile Thr Ala Gly Pro Pro Asp

165 170 175

Gln Ser Gly Arg Pro Ser Lys Lys Arg Lys Glu Tyr His Ser Glu Glu

180 185 190

Glu Asp Glu Gly Glu Glu Ser Asn Gly Gln Asp Asn Asp Asp Pro Ser

195 200 205

Ala Pro Lys Lys Pro Arg Val Val Trp Ser Val Glu Leu His Arg Lys

210 215 220

Phe Val Ala Ala Val Asn Gln Leu Gly Ile Asp Lys Ala Val Pro Lys

225 230 235 240

Arg Ile Leu Glu Leu Met Asn Val Glu Arg Leu Thr Arg Glu Asn Val

245 250 255

Ala Ser His Leu Gln Lys Tyr Arg Leu Tyr Leu Lys Arg Leu Ser Ala

260 265 270

Val Ala Ser Gln Gln Ala Ser Ile Val Ala Ala Leu Gly Gly Asn Asp

275 280 285

Pro Phe Met Arg Met Ser Ala Phe Glu Gly Leu His Gly Tyr Gln Ser

290 295 300

Phe Val Ser Ser Ala Ala Leu Pro Ser Phe Ser Pro Gln Gly Leu Leu

305 310 315 320

Asn Arg Asn Asn Pro Ala Ser Phe Ala Ile Gln Gly Val Ser Ala Ser

325 330 335

Arg Pro Ile Gln Ile Ala Thr Gly Asn Thr Thr Met Ser His Ser Ile

340 345 350

Gly Asp Pro Asn Asp Lys Tyr His Leu Ser Leu Pro Gly Thr Ser Cys

355 360 365

Leu Gln Gly Asn Leu Ala Gln Gly Leu Pro Thr Pro Val Gly Gln Val

370 375 380

Gln Leu Pro Gln Lys Trp Ile His Glu Glu Thr Asp Asp Leu Ser Thr

385 390 395 400

Ile Leu Ser Ala Ser Gly Arg Ala Asn Ser Gly Val Pro Gly Thr Leu

405 410 415

Gln Ser Val Thr Asn Ser His Leu Leu Gln Gln Gly Phe Val Glu Arg

420 425 430

Arg Gln Asp Lys Val Val Ile Gln Pro Ser Ser Ser Ala Ser Ser Asp

435 440 445

Arg Pro Glu Gly Thr Val Gly Val Ser Ser Ser Leu Met Asp Ser Cys

450 455 460

Ala Thr Gln Gln Arg Val Val Pro Leu Ser Ala Phe Ser Ser Ser Ala

465 470 475 480

Ser Pro Met Asn Gly Ser Phe Cys Ser Asn Gly Val Ala Glu Leu Gly

485 490 495

Ala Thr Ser Ser Gly Gly Thr Ser Ile Phe Pro Ser Asn Asp Leu Arg

500 505 510

Ile Glu Arg Asp Ser Lys Val Gly Ala Ser Ser Phe Gly Ser Val Ile

515 520 525

Leu Leu Ser Pro Asp Thr Val Pro Asn Gln Lys Tyr Leu Asn Phe Gly

530 535 540

Gly Gly Ser Asp Leu Arg Ser Asn Met Glu Gly Gly Asn Ala Gly Asn

545 550 555 560

Leu Leu Asn Pro Lys Leu Leu Trp Ser Cys Leu Pro Ala Ser Gln Pro

565 570 575

Pro Asn Leu Ile Gly Ser His His Pro Met Ser Gln Arg Leu Asn Leu

580 585 590

Gly Gly Ser Met Val Arg Gln Thr Thr Ala Ser Ala Ser Ala Ala Ala

595 600 605

Pro Gln Thr Arg Ile Asp Met Phe Ile Ser Gly Asp Ala Pro Lys Ser

610 615 620

Ala Ser Asp Leu Ser Phe Pro Lys Val His Ser Glu Leu Ser Ser Ser

625 630 635 640

Ser Cys Ser Phe Asp Gly Leu Leu Asn Ser Ile Ile Lys Val Glu Lys

645 650 655

Asp Asp Ala Ser Phe Ser Asp Asp Leu Gly Cys Asp Leu Tyr Ser Leu

660 665 670

Gly Ala Cys Ile

675

<210>4

<211>940

<212>DNA

<213>artificial sequence (Artificial Sequence)

<400>4

tggcgtggtc cctgactctc cccagtttta gagctagaaa tagcaagtta aaataaggct 60

agtccgttat caacttgaaa aagtggcacc gagtcggtgc tttttttttt cgttttgcat 120

tgagttttct ccgtcgcatg tttgcagttt tattttccgt tttgcattga aatttctccg 180

tctcatgttt gcagcgtgtt caaaaagtac gcagctgtat ttcacttatt tacggcgcca 240

cattttcatg ccgtttgtgc caactatccc gagctagtga atacagcttg gcttcacaca 300

acactggtga cccgctgacc tgctcgtacc tcgtaccgtc gtacggcaca gcatttggaa 360

ttaaagggtg tgatcgatac tgcttgctgc tcatgaatcc aaaccacacg gagttcaaat 420

tcccacagat taaggctcgt ccgtcgcaca aggtaatgtg tgaatattat atctgtcgtg 480

caaaattgcc tggcctgcac aattgctgtt atagttggcg gcagggagag ttttaacatt 540

gactagcgtg ctgataattt gtgagaaata ataattgaca agtagatact gacatttgag 600

aagagcttct gaactgttat tagtaacaaa aatggaaagc tgatgcacgg aaaaaggaaa 660

gaaaaagcca tacttttttt taggtaggaa aagaaaaagc catacgagac tgatgtctct 720

cagatgggcc gggatctgtc tatctagcag gcagcagccc accaacctca cgggccagca 780

attacgagtc cttctaaaag ctcccgccga ggggcgctgg cgctgctgtg cagcagcacg 840

tctaacatta gtcccacctc gccagtttac agggagcaga accagcttat aagcggaggc 900

gcggcaccaa gaagcgcgtg tgcctcaagg tgcttgttta 940

<210>5

<211>1724

<212>DNA

<213>artificial sequence (Artificial Sequence)

<400>5

ctaaaatgga tacgagacaa cacttagagc tgcgtaaaca gatatcagtg tcctgtcacc 60

gtttaccgtt cctgtgtgca gacggtgtct ggcgtactct agacccgacg actgggacct 120

gggccagcga ctcatgctag gcggctgcga cccgctgccc ggccgccgct gcctggcccc 180

ggcctccaag ctcttccgcc gcccgctgcc cgtcaacgag tcgctctgga cgctgtccga 240

cgacggcaac gtccggtgga gccgctacca ctgccgtggc tacaggtgcc tgtccgccag 300

gaaccagcgc cgcgctacga ccgctgcgtg gggtgcttcg acatggaccg cgagaggcag 360

cggtgggcca accgcaccgc gtcgtcgtcc ctcgccgact tcctcgtcga cgacgtgctc 420

gcggcgacaa ggggcgagtg cgcatcgggc tggacatgag cgtgggcacg ggcagctttg 480

cggcgcgcat gcgggagcgc ggcgtgacca tcgtgtcggc ggccatgaac ctggggcgcg 540

ccgttcgcgg agacagatcg gctgcgcggc tggtgcccct gtacacgacc atgagccagc 600

ggctgccgct gttcgacaac accatggacc tggtgcacac ggcgaggctc ttcgaggggt 660

gggtggacct gcacctgctg gacttcgtgc tcttcgactg ggaccgcgtg ctcgcccggt 720

gggctgctgt gggtggacaa gttgcctgcg cgcgcaagga cctggacgac tacatgtaca 780

tgttcctgca gttcaggtac aagaagcacc gctgggccgt ctccttcaag tccaaggacg 840

aggtctacct gcaatggaga tttggatgtg tgttctccca aatccaattt tgtcctcttc 900

agtgaatgtt cctgaatcag tagccattta tatatatcat gaagtggatt gggaaggagc 960

cgaacgaagt tgaactgttg aatgtcagtg aatctgatga tagagcagaa gttgaacagc 1020

tggaggacaa caaaagagca gagtttgagt gcaattccgg gggcaaatcg caatatcctg 1080

gactgggata ctcgtgatcc aagcttgggg gctttacatg caaaaaaaaa tccagttccg 1140

caatatcctg gactgggata ctcgtgaaca gctggaggtc aagagatgtg cagtccagat 1200

cgatcagtat ttgcagattg gtgcgtccac acgagagttt acggcggccc aaacccccca 1260

aatccagtta caccccaaat cgagttcgaa ttcgccccga cggcaagctc cgctacgcta 1320

acaactccaa ctacaagaac gacaccatga tccgcaagag gtcttcgtct ccccctccgt 1380

cctctgctag gccaggagga tcatccagga gtctgatgta tgtggggcgc acctgttttt 1440

cttccttgtt catcagcagc agcagcgatt gggtcctcgg tccgcgtatc agcagcggcg 1500

aaggagaagc gacggagacg agaagagtac gccagatggc gtctgcgcac gagaacggta 1560

aacggtgaca ggacactgat acctgtttac gcagtcctaa gtgttgtctc ggtatccatt 1620

ttagagtttg tctgtcgtct gcgtctctaa atcagagaag ccaacgccaa cgcctccatt 1680

tcgtcgaatc cccttgtctc ttcttccata atggcaatta tctc 1724

Claims (10)

1. protein is following protein a) or b) or c) or d):

A) amino acid sequence is protein shown in sequence 3；

B) fused protein that the N-terminal of the protein shown in sequence 3 and/or C-terminal connection label obtain；

C) amino acid sequence shown in sequence 3 is passed through to the substitution and/or deletion and/or addition of one or several amino acid residues Obtained protein with the same function；

D) homology with amino acid sequence shown in sequence 3 with 75% or 75% or more and albumen with the same function Matter.

2. it is following A 1 biomaterial relevant to protein described in claim 1) any one of to A12):

A1 the nucleic acid molecules of protein described in claim 1) are encoded；

A2) contain A1) expression cassettes of the nucleic acid molecules；

A3) contain A1) recombinant vectors of the nucleic acid molecules；

A4) contain A2) recombinant vector of the expression cassette；

A5) contain A1) recombinant microorganisms of the nucleic acid molecules；

A6) contain A2) recombinant microorganism of the expression cassette；

A7) contain A3) recombinant microorganism of the recombinant vector；

A8) contain A4) recombinant microorganism of the recombinant vector；

A9) contain A1) the transgenic plant cells systems of the nucleic acid molecules；

A10) contain A2) the transgenic plant cells system of the expression cassette；

A11) contain A3) the transgenic plant cells system of the recombinant vector；

A12) contain A4) the transgenic plant cells system of the recombinant vector.

3. relevant biological material according to claim 2, it is characterised in that: A1) nucleic acid molecules be it is following 1) or 2) Or 3) shown in gene:

1) its coded sequence is cDNA molecule or genomic DNA molecule shown in sequence 1 or sequence 2；

2) there is 75% or 75% or more identity with the nucleotide sequence 1) limited, and encodes albumen described in claim 1 The cDNA molecule or genomic DNA molecule of matter；

1) or 2) 3) and protein described in claim 1 is encoded with the nucleotide sequence hybridization that limits under strict conditions CDNA molecule or genomic DNA molecule.

4. protein described in claim 1 or relevant biological material described in claim 2 or 3 are in regulation bracteal leaf of corn character In application.

5. application according to claim 4, it is characterised in that: the bract character is bract length.

6. protein described in claim 1 or relevant biological material described in claim 2 or 3 shorten in cultivation bract length Transgenic corns in application.

7. protein described in claim 1 or relevant biological material described in claim 2 or 3 answering in corn breeding With.

8. a kind of method for cultivating the transgenic corns that bract length shortens, including reduce in recipient corn described in claim 1 Protein expression quantity and/or activity, the step of obtaining transgenic corns；The bract of the transgenic corns is shorter in length than institute State recipient corn.

9. according to the method described in claim 8, it is characterized by: egg described in claim 1 in the reduction recipient corn The expression quantity of white matter and/or active method are by the volume to protein described in claim 1 in the recipient corn Code gene knocked out inhibited or silencing expression to realize.

10. method according to claim 8 or claim 9, it is characterised in that: the nucleotide sequence of the encoding gene of the protein It is DNA molecular shown in sequence 1.