CN116355956A

CN116355956A - LSA10563 gene and application thereof in regulation of lettuce fertility

Info

Publication number: CN116355956A
Application number: CN202310521797.9A
Authority: CN
Inventors: 杨效曾; 李子时; 李波
Original assignee: Beijing Academy of Agriculture and Forestry Sciences
Current assignee: Beijing Academy of Agriculture and Forestry Sciences
Priority date: 2023-05-10
Filing date: 2023-05-10
Publication date: 2023-06-30

Abstract

The invention discloses an LSA10563 gene and application thereof in regulating fertility of lettuce. The LSA10563 gene disclosed by the invention codes for a protein with the amino acid sequence of SEQ ID No. 3. Experiments prove that after the LSA10563 gene is edited, the male fertility of plants can be obviously reduced, and the LSA10563 gene and the protein coded by the LSA10563 gene can regulate the male fertility of plants, and male sterile plants can be cultivated by knocking out the LSA10563 gene, so that the LSA10563 gene has good application prospect.

Description

LSA10563 gene and application thereof in regulation of lettuce fertility

Technical Field

The invention relates to the biotechnology field, in particular to an LSA10563 gene and an application thereof in regulating lettuce fertility.

Background

Lettuce (Lactuca sativa l.) is a plant of the genus lettuce of the family compositae, originates from the coastal and western asia bands of the mediterranean in europe, is domesticated from wild species, is one of the three-leaf vegetables in the global area, and has important economic value. Global production has doubled in the past two decades. As a global universal vegetable, lettuce is also increasing in demand and consumption in China, and has become an important vegetable in the national vegetable basket at present.

Lettuce is a diploid plant, is subjected to strict self-pollination, has extremely low natural outcrossing rate, has small flower organs, has short duration of flowering time of each flower, is difficult to hybridize, and is difficult to obtain hybrid seeds. Currently, seed for production is generally an inbred line. The lettuce has obvious heterosis in terms of yield, disease and pest resistance and the like observed in the early-stage laboratory, so that the creation of the male sterile line for producing lettuce hybrid seeds has important significance in production.

Along with the great development of CRISPR/Cas9 gene editing technology in recent years, the targeted knockout, knockout and site-directed mutation of animal and plant genes can be directly realized, and target character mutants are quickly created, so that the technology is used for realizing the construction of male sterile mutants in various crops such as corn, rice, chinese cabbage, rape, wheat and the like, but related reports are not found in lettuce.

Disclosure of Invention

The technical problem to be solved by the invention is how to cultivate male sterile plants.

In order to solve the technical problems, the invention firstly provides application of protein or a substance for regulating and controlling the protein content or activity in regulating and controlling male fertility of plants;

the protein is named LSA10563, which is A1), A2) or A3) as follows:

a1 A protein having an amino acid sequence of SEQ ID No. 3;

a2 A protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues for the amino acid sequence shown in SEQ ID No.3 in the sequence table and has the same function;

a3 A fusion protein obtained by ligating a tag to the N-terminal or/and the C-terminal of A1) or A2).

The agent that modulates LSA10563 content or activity may be an agent that inhibits or increases LSA10563 content or activity. The regulation of the male fertility of the plant may be inhibition or improvement of the male fertility of the plant.

The LSA10563 protein in A2) has 75% or more identity with the amino acid sequence of the protein shown in SEQ ID No.3 and has the same function. The identity of 75% or more is 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity.

In the above application, the substance may be any one of the following B1) to B9):

b1 A nucleic acid molecule encoding LSA 10563;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b3 A recombinant vector comprising the nucleic acid molecule of B1) or a recombinant vector comprising the expression cassette of B2);

b4 A recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);

b5 A transgenic plant cell line comprising the nucleic acid molecule of B1) or a transgenic plant cell line comprising the expression cassette of B2);

b6 A transgenic plant tissue comprising the nucleic acid molecule of B1) or a transgenic plant tissue comprising the expression cassette of B2);

b7 A transgenic plant organ comprising the nucleic acid molecule of B1) or a transgenic plant organ comprising the expression cassette of B2);

b8 A nucleic acid molecule that reduces LSA10563 content or activity;

b9 An expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ comprising the nucleic acid molecule of B8).

In the above applications, the nucleic acid molecule of B1) may be B11) or B12) or B13) or B14) or B15) as follows:

b11 A cDNA molecule or a DNA molecule of SEQ ID No.2 in the sequence table;

b12 A DNA molecule shown in SEQ ID No.2 of the sequence table;

b13 A DNA molecule shown in SEQ ID No.1 of the sequence table;

b14 A cDNA or DNA molecule having 75% or more identity to the nucleotide sequence defined in b 11) or b 12) or b 13) and encoding LSA 10563;

b15 Under stringent conditions with a nucleotide sequence defined by b 11) or b 12) or b 13) or b 14), and a cDNA molecule or a DNA molecule encoding LSA 10563;

b8 The nucleic acid molecule is a sgRNA targeting the nucleic acid molecule of B1);

b9 The recombinant vector, the recombinant microorganism, the transgenic plant cell line, the transgenic plant tissue, or the transgenic plant organ is further capable of expressing a Cas9 protein.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

The nucleotide sequence encoding the LSA10563 protein of the invention can be easily mutated by a person skilled in the art using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or more identity to the nucleotide sequence of the LSA10563 protein isolated by the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the LSA10563 protein and function as the LSA10563 protein.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence having 75% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of the protein consisting of the amino acid sequence shown in SEQ ID No.3 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.

In the above application, the stringent conditions may be as follows: 50℃in 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 2 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA in Mixed solutionRinsing in 1 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 0.5 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 65 ℃; the method can also be as follows: hybridization was performed in a solution of 6 XSSC, 0.5% SDS at 65℃and then washed once with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS; the method can also be as follows: hybridization and washing the membrane 2 times at 68℃in a solution of 2 XSSC, 0.1% SDS for 5min each time, and hybridization and washing the membrane 2 times at 68℃in a solution of 0.5 XSSC, 0.1% SDS for 15min each time; the method can also be as follows: hybridization and washing of membranes were performed at 65℃in 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS solution.

The 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

In the above applications, the expression cassette (LSA 10563 gene expression cassette) described in B2) containing a nucleic acid molecule encoding LSA10563 protein refers to DNA capable of expressing LSA10563 protein in a host cell, and the DNA may include not only a promoter for initiating transcription of LSA10563 gene but also a terminator for terminating transcription of LSA10563 gene. Further, the expression cassette may also include an enhancer sequence.

Recombinant vectors containing the LSA10563 gene expression cassette can be constructed using existing expression vectors.

In the above applications, the vector may be a plasmid, cosmid, phage or viral vector. The plasmid may specifically be a pKSE401 vector.

B8 The target sequence of the sgRNA may be sgRNA1: GGTGCCACAACTCTCTATC; and/or, sgRNA2: AGATGGGTTCGGACTTAGC.

B9 The recombinant vector may be a recombinant vector that can reduce LSA10563 content prepared using CRISPR/Cas9 system. The recombinant vector may express an sgRNA targeting the nucleic acid molecule of B1).

In the above application, the microorganism may be yeast, bacteria, algae or fungi. Wherein the bacterium may be Agrobacterium, such as Agrobacterium tumefaciens GV3101.

In the above applications, none of the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs include propagation material.

The invention also provides the following X1) or X2):

x1) a method of inhibiting male fertility in a plant comprising: reducing the content or activity of LSA10563 in the recipient plant, or inhibiting expression of LSA10563 encoding gene in the recipient plant, or knocking out LSA10563 encoding gene in the recipient plant to obtain a target plant with reduced male fertility compared with the recipient plant, thereby realizing inhibition of male fertility of the plant;

x2) a method of growing a male fertility-reducing plant comprising: reducing the amount or activity of LSA10563 in the recipient plant, or inhibiting expression of a gene encoding LSA10563 in the recipient plant, or knocking out a gene encoding LSA10563 in the recipient plant, to obtain a plant of interest having reduced male fertility compared to said recipient plant.

Among the above methods, the methods described in X1) and X2) can be implemented by gene editing of the coding gene of LSA10563 by CRISPR/Cas9 system.

The coding gene may be the nucleic acid molecule.

The methods of X1) and X2) are specifically carried out by introducing B9) the recombinant vector into the recipient plant to obtain an LSA10563 gene-edited plant.

In one embodiment of the invention, the methods described for X1) and X2) are carried out by deleting positions 108 to 112 of sequence 1 and/or deleting positions 108 to 116 of sequence 1.

The invention also provides a product for inhibiting male fertility in a plant, said product comprising (or having the activity of) said substance that modulates LSA10563 content or activity.

In the present invention, the plant may be M1) or M2) or M3):

m1) dicotyledonous or monocotyledonous plants;

m2) a plant of the family asteraceae;

m3) lettuce.

LSA10563 or the substance regulating the content or activity of LSA10563 also falls within the scope of the invention.

Experiments prove that after the LSA10563 gene is edited, the male fertility of plants can be obviously reduced, and the LSA10563 gene and the protein coded by the LSA10563 gene can regulate the male fertility of plants, and male sterile plants can be cultivated by knocking out the LSA10563 gene, so that the LSA10563 gene has good application prospect.

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

Drawings

FIG. 1 shows the results of measuring the expression level of LSA10563 and LSA27952 genes. Wherein N1151-1 represents an anther length of 0.5mm; n1151-2 represents anther length of 1mm; n1151-3 represents anther length of 2mm.

FIG. 2 is a schematic representation of pKSE401 vector.

FIG. 3 shows lettuce pollen I ₂ KI staining pattern. A: wild type; b: LSA10563-1 plants; c: LSA10563-2 plants; d: LSA27952-1 plants.

FIG. 4 is a paraffin section of lettuce anther at different developmental stages. A: wild type; b: LSA10563-1 plants; c: LSA10563-2 plants; d: LSA27952-1 plants.

Detailed Description

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents, instruments and the like used in the examples described below are commercially available unless otherwise specified. The quantitative tests in the following examples were all set up in triplicate and the results averaged. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.

The pCBC-DT1T2 vector in the examples described below (Limoniton et al, lettuce CRISPR/Cas9 gene editing System set up, plant physiology, 2017, 04), which is available to the public from applicant, is only used for repeated experiments related to the invention, but not as other uses.

The pKSE401 vector in the examples described below (limonson et al, lettuce CRISPR/Cas9 gene editing system set up, plant physiology newspaper, 2017, 04), which is available to the public from applicant, is only used for repeated experiments related to the invention, but not for other uses.

Example 1 detection of expression level of LSA10563 Gene and LSA27952 Gene

Anthers (0.5 mm;1mm;2 mm) of lettuce varieties in different development periods of America are sampled, total RNA of the anthers is extracted, reverse transcription is carried out, and the expression quantity of LSA10563 and LSA27952 genes is quantitatively detected by utilizing real-time fluorescence.

The primers used to detect the LSA10563 gene were: CTTAGCTGGGCACCTTGTCA and TCCCTCTTCCACCAGTGAGT;

the primers used to detect LSA27952 gene were: TTCCGGGAAGGTCCCTACAT and GTGGCCGAATTCACCAGGTA.

The result (figure 1) shows that the LSA10563 gene has higher expression quantity at the early stage of anther development of lettuce and hardly expresses at the later stage of anther development; the LSA27952 gene gradually reduces the expression quantity along with the development of lettuce anther.

In U.S. megasonic production, the genomic DNA of LSA10563 gene is shown as SEQ ID No.1, the CDS sequence is shown as SEQ ID No.2, and LSA10563 protein shown as SEQ ID No.3 is encoded; the genome DNA of LSA27952 gene is shown as SEQ ID No.4, the CDS sequence is shown as SEQ ID No.5, and LSA10563 protein shown as SEQ ID No.6 is encoded.

Example 2, LSA10563 Gene, LSA27952 Gene

In the embodiment, the CRISPR/Cas9 system is utilized to edit the LSA10563 gene and the LSA27952 gene of lettuce, and the influence of the two genes on anther development is detected. The vectors used for the CRISPR/Cas9 system were the pCBC-DT1T2 vector (chloramphenicol resistant, containing the gRNA expression cassette), pKSE401 vector (for transformation of agrobacterium tumefaciens GV3101 competent for lettuce genetic transformation).

1. Vector construction

For the LSA10563 gene and the LSA27952 gene, two targets are designed for each gene, and the two targets of the LSA10563 gene are as follows: sgRNA1: GGTGCCACAACTCTCTATC; sgRNA2: AGATGGGTTCGGACTTAGC; two targets of the LSA27952 gene are: sgRNA1: CACTTGCAGCCGCCGGAGTT; sgRNA2: CTTACGAAACTCCGATCGCT.

The pKSE401 vector is digested by BsaI restriction enzyme and then is respectively connected with DNA fragments containing two targets of LSA10563 gene and LSA27952 gene, the obtained recombinant vector targeting LSA10563 gene is marked as LSA10563-sgRNA, and the obtained recombinant vector targeting LSA27952 gene is marked as LSA27952-sgRNA.

The sequence of the DNA fragment containing the two targets of LSA10563 gene is as follows:

the sequence of the DNA fragment containing the two targets of LSA27952 gene is as follows:

2. genetic transformation of lettuce

And (2) respectively introducing the LSA10563-sgRNA and the LSA27952-sgRNA obtained in the step (1) into agrobacterium tumefaciens GV3101, and then respectively carrying out genetic transformation by taking American fast-growing plants as receptor plants to respectively obtain LSA10563 gene editing plants and LSA27952 gene editing plants.

Two ends of the target site are respectively designed with a pair of primers for identifying the gene editing plant, and the primers are as follows:

LSA10563 gene editing plants:

f primer: ACCCAAGTGGATGCAAGAAAAGG;

r primer: TCTCCATAAAGTCAAGAGAACCACCTT.

LSA27952 gene editing plants:

f primer: TGCCCCTTTCATGCATACTATTTGG;

r primer: TGAAAGCTCTTGTGGTAAAGGCC.

The LSA27952-1 gene editing plant is obtained by taking the American fast-growing plant as a receptor plant, utilizing LSA10563-sgRNA to obtain LSA10563 gene editing plants LSA10563-1 and LSA10563-2 and utilizing LSA27952-sgRNA.

Sequenced F ₀ The generation editing case (table 1) is as follows:

homozygous mutation of LSA10563-1 plant at Target1, deletion of 5bp base on both chromosomes, resulting in frame shift mutation of encoded protein;

LSA10563-2 plant is mutated at Target1, one chromosome has deletion of 5bp basic group, the other chromosome has deletion of 9bp basic group, and the LSA10563-2 plant is judged to be heterozygote, so that coded protein frame shift mutation is caused;

LSA27952-1 plants were mutated at Target1, with 1bp base insertion on one chromosome and no mutation on the other chromosome, as judged heterozygotes, resulting in frame shift mutation of the encoded protein.

Analysis of the gene sequence from the gene editing plants: LSA10563-1 and LSA10563-2 plants were mutated on the first exon of the gene; LSA27952-1 plants were mutated on the first exon of the gene.

TABLE 1 Gene editing cases

3. Phenotypic identification

And (3) measuring plants: LSA10563-1 plants, LSA10563-2 plants and LSA27952-1 plants.

3.1 pollen Activity identification

Pollen viability was detected using pollen viability staining solution (I2-KI method): LSA10563-1, LSA10563-2 and LSA27952-1 plants and wild plants were taken from the flowers of the American fast-growing plants, 1-2 drops I ₂ Placing KI solution on a glass slide, immersing a proper amount of pollen into the solution, filling pollen out, covering a cover glass, placing in a constant temperature incubator at 25 ℃ for dyeing for 5-10min, and observing under a microscope, wherein the reddish brown pollen is normal viable pollen, namely the fertility pollen; the yellow brown pollen is non-viable pollen, namely sterile pollen. As shown in FIG. 3, LSA27952-1 plant is heterozygous mutant, and the number of active pollen of lettuce is obviously reduced compared with that of wild type; the number of viable pollen of two plants of LSA10563 was significantly reduced compared to wild type, most of which were not fertile. In particular, the average percent sterile pollen of LSA27952-1 plants was 85%, and the average percent sterile pollen of LSA10563-1 and LSA10563-2 was 99.3 and 99.5%, respectively. Indicating the phenotype of male sterility after LSA27952, LSA10563 genes are edited.

3.2 anther Paraffin sections

Anthers of LSA10563-1, LSA10563-2 and LSA27952-1 plants and wild plants were taken at different developmental stages of the American fast-growing stamens, embedded in paraffin and sectioned with a microtome. Sections were stained with safranin fast green and stamen development was observed under a microscope.

Paraffin section results show (fig. 4), that when five layers of anther epidermal cells, middle layer, inner wall of medicine room, tapetum and microsporocyte of wild type were differentiated, obvious arrangement of cells of each layer was seen, and when LSA27952 and LSA10563 were knocked out successfully, different cells of anther were abnormal in differentiation, and obvious epidermal cells, middle layer, inner wall of medicine room, tapetum and microsporocyte were not seen. Microsporocytes undergo meiosis, tetrad, young microsporocyte, monocaryosporic, terminal monocaryomicrospore, and low-age pollen grains in the later stage of anther development to finally form mature pollen grains. In this process the Tapetum (TP) plays a continuous, essential role in anthers: (1) nutrient supply and regulation of microsporocytes; (2) Synthesizing and secreting callase, and decomposing the outer walls of tetrad calluses; (3) secretion recognition proteins and transfer to pollen walls; (4) The synthesis of secreted sporopouenin onto mature pollen wall can raise the stability of pollen. LSA10563-1 plants had no mature pollen grains and LSA27952-1 and LSA10563-2 plants had a small amount of mature pollen grains compared to wild type.

The results show that after the LSA10563 and the LSA27952 are subjected to gene editing, lettuce male sterility is caused, and the lettuce male sterility line can be prepared by knocking out the two genes.

The above examples relate to the sequences as follows:

sequence 1: LSA10563 genome

Sequence 2: LSA10563 CDS

Sequence 3: LSA10563 amino acid sequence

Sequence 4: LSA27952 genome

Sequence 5: LSA27952 CDS

Sequence 6: LSA27952 amino acid sequence

/>

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains.

Claims

1. Use of a protein or a substance regulating the content or activity of said protein in regulating male fertility of a plant;

the protein is A1), A2) or A3) as follows:

a1 A protein having an amino acid sequence of SEQ ID No. 3;

2. The use according to claim 1, characterized in that: the substance is any one of the following B1) to B9):

b1 A nucleic acid molecule encoding the protein of claim 1;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b8 A nucleic acid molecule that reduces the protein content or activity of claim 1;

3. The use according to claim 2, characterized in that: b1 The nucleic acid molecule is b 11) or b 12) or b 13) or b 14) or b 15) as follows:

b11 A cDNA molecule or a DNA molecule of SEQ ID No.2 in the sequence table;

b12 A DNA molecule shown in SEQ ID No.2 of the sequence table;

b13 A DNA molecule shown in SEQ ID No.1 of the sequence table;

b14 A cDNA molecule or DNA molecule having 75% or more identity to the nucleotide sequence defined in b 11) or b 12) or b 13) and encoding the protein according to claim 1;

b15 A cDNA molecule or DNA molecule which hybridizes under stringent conditions to a nucleotide sequence as defined in b 11) or b 12) or b 13) or b 14) and which encodes a protein according to claim 1;

4. X1) or X2) below:

x1) a method of inhibiting male fertility in a plant comprising: reducing the content or activity of the protein of claim 1 in a recipient plant, or inhibiting the expression of the protein-encoding gene of claim 1 in a recipient plant, or knocking out the protein-encoding gene of claim 1 in a recipient plant, to obtain a target plant with reduced male fertility compared with the recipient plant, thereby achieving inhibition of male fertility in the plant;

x2) a method of growing a male fertility-reducing plant comprising: reducing the amount or activity of a protein according to claim 1 in a recipient plant, or inhibiting the expression of a gene encoding a protein according to claim 1 in a recipient plant, or knocking out a gene encoding a protein according to claim 1 in a recipient plant, to obtain a plant of interest having reduced male fertility compared to said recipient plant.

5. The method according to claim 4, wherein: the methods of X1) and X2) are achieved by gene editing of the gene encoding the protein of claim 1 by CRISPR/Cas9 system.

6. The method according to claim 4 or 5, characterized in that: the coding gene is the nucleic acid molecule of B1) in claim 2 or 3.

7. A product for inhibiting male fertility in a plant comprising a substance according to any one of claims 1 to 3 that modulates the protein content or activity.

8. Use according to any one of claims 1-3, or method according to any one of claims 4-6, or product according to claim 7, characterized in that: the plant is M1) or M2) or M3):

m1) dicotyledonous or monocotyledonous plants;

m2) a plant of the family asteraceae;

m3) lettuce.

9. The protein of claim 1 or said substance that modulates the content or activity of said protein.