CN109971760A - Circ_3234 and its preparing application in treatment of nasopharyngeal carcinoma preparation and treatment preparation - Google Patents

Circ_3234 and its preparing application in treatment of nasopharyngeal carcinoma preparation and treatment preparation Download PDF

Info

Publication number
CN109971760A
CN109971760A CN201910275579.5A CN201910275579A CN109971760A CN 109971760 A CN109971760 A CN 109971760A CN 201910275579 A CN201910275579 A CN 201910275579A CN 109971760 A CN109971760 A CN 109971760A
Authority
CN
China
Prior art keywords
circ
nasopharyngeal carcinoma
cell
sirna
preparation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910275579.5A
Other languages
Chinese (zh)
Other versions
CN109971760B (en
Inventor
曾朝阳
郭灿
熊炜
范春梅
赵梦瑶
熊芳
张立身
莫勇真
彭苗
李征
李小玲
李桂源
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Central South University
Original Assignee
Central South University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Central South University filed Critical Central South University
Priority to CN201910275579.5A priority Critical patent/CN109971760B/en
Publication of CN109971760A publication Critical patent/CN109971760A/en
Application granted granted Critical
Publication of CN109971760B publication Critical patent/CN109971760B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C12N2310/532—Closed or circular
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Veterinary Medicine (AREA)
  • Biotechnology (AREA)
  • Public Health (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention belongs to oncomolecularbiology technical fields, and in particular to circ_3234 and its prepare application in treatment of nasopharyngeal carcinoma preparation and treatment preparation.Since siRNA has good Gene silencing efficacy, the present invention is ensuring Nasopharyngeal Carcinoma Cell Line HONE1, after circ_3234 in HNE2 and CNE2 interferes silencing to fall with siRNA, the experiment of the cell Transwell and scratch Healing Experiments are carried out, relative to control group, the invasion migration velocity of siRNA group cell obviously slows down, that is silencing circ_3234 inhibits the invasion of nasopharyngeal carcinoma cell to migrate, accordingly, we also construct the carrier for being overexpressed circ_3234, in Nasopharyngeal Carcinoma Cell Line HONE1, after being overexpressed circ_3234 in HNE2 and CNE2, the invasion migration velocity of cell is obviously accelerated.Inhibit circ_3234 that can delay nasopharyngeal carcinoma diffusion transfer, there is far-reaching clinical meaning and important popularization and application foreground.

Description

Circ_3234 and its preparing application in treatment of nasopharyngeal carcinoma preparation and treatment preparation
Technical field
The invention belongs to oncomolecularbiology technical fields, and in particular to a kind of circular rna circ_3234, and suppression The reagent of circular rna circ_3234 expression processed is preparing the application in treatment of nasopharyngeal carcinoma preparation with it.
Background technique
Circular rna (Circular RNA) is a research hotspot at present, and circRNA is mainly derived from protein coding gene Exon 1, can also be by including sub-district, the area UTR, intergenic region, non-coding RNA site and the antisense position of known transcript Point is formed.CircRNA is reversely spliced to form by Pre-mRNA (precursor messenger RNA, pre-mRNA) One kind does not have 5 ' end cap and 3 ' end poly (A) tails and the non-coding RNA molecules that ring structure is formed with covalent bond.
CircRNA forming process can be divided into two major classes, i.e. exon cyclisation is (exon circularization) and interior Containing the big mechanism of subring (intron circularization) two.CircRNA (the exonic in the proposition such as Jeck exon source CircRNA, ecircRNA) lasso trick driving cyclisation (lariat-driven circularization) and introne can be divided into Pairing driving cyclisation (intron-pairing-driven circularization) two kinds of generation types, lasso trick driving cyclisation It is exon 3 ' it holds as 5 ' end acceptor splicing site (splice receptor) of donor splicing site (splice donor) attack, Alu Area's covalent bond and form lasso structure, excision introne forms circRNA after lasso structure carries out internal splicing；Introne is matched It is to wipe out introne after two introne base pair complementarities form cyclic structure and form circRNA to driving cyclisation.In in fact It itself can also be cyclized containing son, introne source circRNA (circular intronic RNA, ciRNA) can be formed. CircRNA is that one kind for being reversely spliced to form by Pre-mRNA does not have 5 ' end cap and 3 ' end poly (A) tails are simultaneously The non-coding RNA molecule of the closed ring structure formed in the form of covalent bond.There are the stability, conservative, specificity of height, And the high feature of content.
CircRNA most had found that subsequent Hsu MT et al. uses electron microscope skill for the first time early in 1976 in RNA virus Art has found the presence of circRNA in the nephrocyte matter of monkey.More and more circRNA are found in recent years, so far Known circRNA number has reached more than 30,000.CircRNA is also no longer regarded as the rna transcription sheet of mistake, but makees It rises up slowly for the dazzling star in non-coding RNA research.It was found that more novel circRNA are as diagnosing tumor and prognosis Biomarker and its application, and the protection that can be got well as early as possible in patent field can be obviously improved China in the technical field International competitiveness.
Nasopharyngeal carcinoma (nasopharyngeal carcinoma, NPC) belongs to head and neck neoplasm, originates from pharynx nasalis epithelium group It knits.It falls ill generally at the rear cornucopia of pharynx nasalis (Luo Senmiaole nest, Fossa of Rosenm ü ller), nasopharynx herein Cancer cell easily invades neighbouring tissue and organ.Since the occurrence and development of nasopharyngeal carcinoma are the familial inheritance and body cell something lost by accumulating Pass mutation and epigenetics be mutated caused by multistage complexity gene regulation process, be related to proto-oncogene and tumor suppressor gene The epigenetic regulation etc. that activation and silencing and ncRNA are participated in.So the specific molecular mechanism of nasopharyngeal carcinoma occurrence and development is still It is indefinite, and due to Tumor Heterogeneity and individual difference, the curative effect of traditional radiotherapy equipment system is not significant.Therefore pass through CircRNA probes into itself and nasopharyngeal carcinoma occurrence and development mechanism, is further the diagnosis of nasopharyngeal carcinoma, and controls nasopharyngeal cardnoma proliferation, invades Attacking and shifting will be the hot spot studied.
We detect the circ_3234 of a length 377bp.It is found by experiment that the hair of the circular rna and nasopharyngeal carcinoma There is association in hair tonic exhibition, it is possible to as nasopharyngeal carcinoma diagnosis marker, and the target spot for the treatment of.
Summary of the invention
Present invention finds the circ_3234 of a size 377bp, and have found its existing pass between nasopharyngeal carcinoma System, it is possible to the target spot as nasopharyngeal carcinoma diagnosis marker and treatment.
Primary and foremost purpose of the invention is to provide a kind of new circular rna circ_3234, sequence such as SEQ ID NO.1 institute Show.
A second object of the present invention is to provide a kind of reagents of inhibition circular rna circ_3234 expression to treat in preparation Application in nasopharyngeal carcinoma preparation, the circular rna circ_3234 sequence is as shown in SEQ ID NO.1.
Further, the reagent of inhibition circular rna circ_3234 expression includes but is not limited to siRNA.
Further, the siRNA is preferably as follows:
Positive-sense strand (5'-3') CCUCAGAGCCUGAACUGGCUU
Antisense strand (5'-3') GCCAGUUCAGGCUCUGAGGUU,
But it is not limited to above-mentioned specific siRNA.
Further, the reagent of inhibition circ_3234 expression further includes negative control:
Positive-sense strand (5'-3') UUCUCCGAACGUGUCACGUUU
Antisense strand (5'-3') ACGUGACACGUUCGGAGAAUU,
But it is not limited to above-mentioned specific negative control.
Third object of the present invention is to provide a kind of preparations for treating nasopharyngeal carcinoma, including inhibit circular rna circ_ The reagent of 3234 expression, the circular rna circ_3234 sequence is as shown in SEQ ID NO.1.
Further, the reagent of inhibition circular rna circ_3234 expression includes but is not limited to siRNA.
Further, the siRNA is preferably as follows:
Positive-sense strand (5'-3') CCUCAGAGCCUGAACUGGCUU
Antisense strand (5'-3') GCCAGUUCAGGCUCUGAGGUU,
But it is not limited to above-mentioned specific siRNA.
Further, the reagent of inhibition circ_3234 expression further includes negative control:
Positive-sense strand (5'-3') UUCUCCGAACGUGUCACGUUU
Antisense strand (5'-3') ACGUGACACGUUCGGAGAAUU,
But it is not limited to above-mentioned specific negative control.
Treatment of nasopharyngeal carcinoma preparation of the present invention further includes reagent needed for transfection siRNA.
Currently, siRNA has evolved into the important tool of gene functional research.It is sent out to probe into circ_3234 in tumour Raw developing effect, the present invention devise a pair of of siRNA according to the splicing site of circ_3234, utilize Hiperfect reagent SiRNA and siNC (control) is transiently transfected to the expression of the silencing circ_3234 into HONE1, HNE2 and CNE2 cell line.Turn Continue to cultivate 36 hours collection cells after dye, using the expression of Real-Time Fluorescent Quantitative PCR Technique detection circ_3234 to examine The transfection efficiency of siRNA is surveyed, while detecting the expression of circ_3234, it is found that the siRNA of design can significantly inhibit circ_ 3234 expression.
The present invention confirms above-mentioned conclusion by largely testing: i.e. the reagent of inhibition circ_3234 expression can be used in making Standby treatment of nasopharyngeal carcinoma preparation.These tests include: the external migration for being overexpressed circ_3234 and promoting nasopharyngeal carcinoma cell, external heavy The migration of the expression inhibiting nasopharyngeal carcinoma of silent circ_3234；The external invasion for being overexpressed circ_3234 and promoting nasopharyngeal carcinoma cell, body Outer silencing circ_3234 inhibits the invasion of nasopharyngeal carcinoma cell.
Since siRNA has good silencing efficiency.After ensuring that circ_3234 is disturbed, the present invention is in silencing The experiment of the cell Transwell and scratch Healing Experiments are carried out in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 of circ_3234, Relative to NC control group, the invasion migration velocity of siRNA group cell obviously slows down, i.e. silencing circ_3234 inhibits nasopharyngeal carcinoma The invasion of cell migrate.Inhibit circ_3234 that can delay the nasopharynx metastasis of cancer, there is far-reaching clinical meaning and important popularization Application prospect.
Detailed description of the invention
Fig. 1 is over-express vector map.
Fig. 2 is that qRT-PCR detects the circ_3234 overexpression effect in Nasopharyngeal Carcinoma Cell Line；
QRT-PCR detection circ_3234 in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 is overexpressed effect with β- Actin is used as reference that pcDNA3.1 (+) group is standardized as 1, * P < 0.05, P < 0.001 * * P < 0.01, * * *.
Fig. 3 is the silence efficiency that qRT-PCR technology detects circ_3234siRNA in Nasopharyngeal Carcinoma Cell Line；
The silence efficiency of qRT-PCR detection circ_3234siRNA in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2； Circ_3234 expression analyze using β-actin as reference, by NC group be standardized as 1, ns represent it is nonsensical, * P < 0.05,**P<0.01,***P<0.001。
Fig. 4 is that qRT-PCR detects circ_3234 overexpression efficiency in scratch experiment cell；
A-c. human nasopharyngeal epithelioma 1 HONE1, HNE2 and CNE2 used in scratch experiment is overexpressed efficiency and is tested with qRT-PCR Detection, circ_3234 expression analyze using β-actin as reference, by pcDNA3.1 (+) group be standardized as 1, * P < 0.05,**P<0.01,***P<0.001。
Fig. 5 is the influence for being overexpressed circ_3234 to nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 scratch Healing Experiments；
A-c. Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 transfect pcDNA3.1 (+) is unloaded, pcDNA3.1 (+)/ Circ_3234, the scratch after cell density reaches 100% were taken pictures in observation in the 0th, 12,24 hour.
Fig. 6 is nasopharyngeal carcinoma HONE1, HNE2 and CNE2 the cell scratch experiment statistical chart for being overexpressed circ_3234；
A-c. 6 perimetry scratch widths are randomly selected for every group, 0 hour scratch width is standardized as 1, is taken statistics Figure；It is each to test in triplicate, using Student's t-test method statistic.*P<0.05, **P<0.01,***P< 0.001。
Fig. 7 is that qRT-PCR detects circ_3234 jamming effectiveness in scratch experiment cell；；
A-c. human nasopharyngeal epithelioma 1 HONE1, HNE2 and CNE2 jamming effectiveness used in scratch experiment is tested with qRT-PCR and is examined It surveys, circ_3234 expression is analyzed using β-actin as reference, NC group is standardized as 1, * P < 0.05, * * P < 0.01,***P<0.001。
Fig. 8 is the influence for interfering circ_3234 to nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 scratch Healing Experiments；
A-c. nasopharyngeal carcinoma HONE1, HNE2 and CNE2 cell transfecting NC siRNA/circ_3234siRNA, to cell density Scratch after reaching 100% was taken pictures in observation in the 0th, 12,24 hour.
Fig. 9 is nasopharyngeal carcinoma HONE1, HNE2 and CNE2 the cell scratch experiment statistical chart for interfering circ_3234；
A-c. 6 perimetry scratch widths are randomly selected for every group, 0 hour scratch width is standardized as 1, is taken statistics Figure；It is each to test in triplicate, using Student's t-test method statistic.*P<0.05,**P<0.01,***P<0.001.
Figure 10 is the overexpression efficiency that qRT-PCR detects circ_3234 in the experiment of the cell Transwell matrigel invasion；
The cell a-c.Transwell matrigel invasion is tested human nasopharyngeal epithelioma 1 HONE1, HNE2 and CNE2 used and is overexpressed Efficiency is tested with qRT-PCR and is detected, and circ_3234 expression is analyzed using β-actin as reference, by pcDNA3.1 (+) group It is standardized as 1, * P < 0.05, P < 0.001 * * P < 0.01, * * *.
Figure 11 is the influence for being overexpressed circ_3234 to Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 invasive ability；
HONE1, HNE2 and the CNE2 and respective cellular control unit for being overexpressed circ_3234 respectively are carried out The experiment of the cell Transwell matrigel invasion.
Figure 12 is the cell the Transwell matrigel invasion experiment statistics figure for being overexpressed circ_3234；
Every group randomly selects 3 cell visuals field and carries out cell count, and take statistics figure；Each experiment in triplicate, uses Student's t-test method statistic；Using β-actin as reference, pcDNA3.1 (+) group is standardized as P < 0.05 1, *, **P<0.01,***P<0.001。
Figure 13 is the jamming effectiveness that qRT-PCR detects circ_3234 in the experiment of the cell Transwell matrigel invasion；
The cell a-c.Transwell matrigel invasion tests human nasopharyngeal epithelioma 1 HONE1, HNE2 and CNE2 interference effect used Rate is tested with qRT-PCR and is detected, and circ_3234 expression is analyzed using β-actin as reference, and NC group is standardized as 1, * P <0.05,**P<0.01,***P<0.001。
Figure 14 is the influence for interfering circ_3234 to Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 invasive ability；
HONE1, HNE2 and the CNE2 and respective cellular control unit for interfering circ_3234 respectively carry out Transwell The experiment of cell matrigel invasion.
Figure 15 is the cell the Transwell matrigel invasion experiment statistics figure for interfering circ_3234；
Every group randomly selects 3 cell visuals field and carries out cell count, and take statistics figure；Each experiment in triplicate, uses Student's t-test method statistic；Using β-actin as reference, NC group is standardized as 1, * P < 0.05, * * P < 0.01,***P<0.001。
Specific embodiment
It is intended to further illustrate the present invention below in conjunction with specific embodiment, is not intended to limit the present invention.
Tri- plants of Nasopharyngeal Carcinoma Cell Lines of HONE1, HNE2 and CNE2 are Tumour Inst., Zhongnan Univ.'s molecule used in the present invention Genetic laboratory is saved.Cell culture condition are as follows: containing 10% fetal calf serum (FBS) and 1% dual anti-(penicillin, streptomysin) RPMI1640 fluid nutrient medium, 37 DEG C, 95% humidity, 5%CO2Adherent growth in the constant incubator of concentration.
The primer of circular rna of the present invention is different from the design of linear rna primer, is designed according to splicing site two sides, The Photographing On-line on the website Primer3.0, final primer synthetic work are ordered goods by sending Email, and the commission section of holding up is raw The synthesis of object company Changsha combining unit.
(1)β-actin
Upstream primer: shown in 5 '-TCACCAACTGGGACGACATG-3 ', SEQ ID NO.2；
Downstream primer: shown in 5 '-GTCACCGGAGTCCATCACGAT-3 ', SEQ ID NO.3.
(2) circular rna circ_3234 real-time quantitative PCR primer
Upstream primer: shown in 5 '-CAACAATCAGATGGCACCAG-3 ', SEQ ID NO.4；
Downstream primer: shown in 5 '-AATTCTTCCAAGCCCCTTTG-3 ', SEQ ID NO.5.
(3) circ_3234 overall length primer is expanded
Upstream primer: shown in 5 '-CCCATCGATAACTGGCATCAAATACTCACAAC-3 ', SEQ ID NO.6；
Downstream primer: shown in 5 '-TAACCGCGGCAGGCTCTGAGGAGAACAG-3 ', SEQ ID NO.7.
The present invention expresses to specifically strike low circular rna without influencing its glm gene, is designed according to splicing site SiRNA, targeted silent circ_3234.
Circ_3234siRNA sequence:
Shown in positive-sense strand (5'-3') CCUCAGAGCCUGAACUGGCUU, SEQ ID NO.8,
Shown in antisense strand (5'-3') GCCAGUUCAGGCUCUGAGGUU, SEQ ID NO.9.
Negative control:
Shown in positive-sense strand (5'-3') UUCUCCGAACGUGUCACGUUU, SEQ ID NO.10,
Shown in antisense strand (5'-3') ACGUGACACGUUCGGAGAAUU, SEQ ID NO.11.
Test result of the present invention is all made of statistical analysis: t, which is examined, to be used to evaluate the difference between two groups.P < 0.05 is used for Indicate significance,statistical, all p values use two-sided test.Statistical analysis is soft using SPSS 13.0 and Graphpad 5.0 Part carries out.
Embodiment 1: circ_3234 is overexpressed effect detection in Nasopharyngeal Carcinoma Cell Line
We select restriction enzyme site first, and circ_3234 full length sequence is put into the online website NEB cutter 2.0 point Analysis, display Sacll and Clal restriction enzyme site is the site being not present in circ_3234 full length sequence, while in pcDNA3.1 matter Single existing DNA restriction enzyme in grain carrier (being purchased from Sheng Gong bioengineering limited liability company).Table was constructed accordingly Up to carrier, Fig. 1 is seen.
In order to detect the cyclic efficiency of circ_3234, we are by the pcDNA3.1/circ_3234 eukaryon mistake of building first Expression vector is expressed in nasopharyngeal carcinoma cell.Good third and fourth generation nasopharyngeal carcinoma cell HONE1, the HNE2 of upgrowth situation With CNE2 kind into 12 orifice plates, when cell fusion degree reaches 60%-80%, with liposome method lipofectamine 3000 Endotoxin-free plasmid pcDNA3.1 empty carrier and pcDNA3.1/circ_3234 over-express vector are transiently transfected nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 continue to cultivate to after 48 hours.Cell is collected, detects circ_ using Real-Time Fluorescent Quantitative PCR Technique 3234 expression and cyclic efficiency.QPCR turns pcDNA3.1/ the results show that compared with pcDNA3.1 empty plasmid group cell Circ_3234 is overexpressed the expression of circ_3234 in the cell of plasmid group and significantly increases, and in HONE1, HNE2 and Its in CNE2 cell line expresses multiple at 300 times or more, sees Fig. 2, as a result has statistical significance.
Embodiment 2: the effect detection that silencing circ_3234 is expressed in Nasopharyngeal Carcinoma Cell Line
The siRNA sequence of circ_3234 is devised according to splicing site, siRNA is that a kind of length is 21-25 nucleosides Acid complementary with cognate rna can combine, selective degradation purpose RNA, thus the double-stranded RNA molecule for inhibiting it to express.Currently, SiRNA has evolved into the important tool of gene functional research.In order to probe into work of the circ_3234 in tumor development With we devise siRNA according to the splicing site of circ_3234, using Hiperfect reagent by siRNA and siNC (blank Control) transiently transfect into HONE1, HNE2 and CNE2 cell line silencing circ_3234 expression.Continue culture 48 after transfection Hour collects cell, and the transfection of siRNA is detected using the expression of Real-Time Fluorescent Quantitative PCR Technique detection circ_3234 Efficiency, confirmation transfect the expression of the circ_3234 after siRNA lower than circ_3234 expression after transfection siNC 60%.As a result see Fig. 3.
Embodiment 3: the healing migration experiment of cell scratch:
(1) photo cell platform: the D-Hank ' s of 1000 μ l/10 μ l Tip, autoclave sterilization, ruler, 1000 μ l/10 μ l Liquid-transfering gun, marker etc., ultraviolet irradiation 30 minutes in super-clean bench are placed on after disinfecting in alcohol again；
(2) siRNA and NC group or transfected plasmids are transfected respectively to cell length to 50%~70% or so；
(3) 10 μ l pipette tips second day beginning scratch after cell covers with tiling board bottom: are compared into ruler perpendicular to 6 orifice plates bottom Portion simply quickly carries out cross or well stroke trace, not tilt, strength is consistent, to ensure scratch width as far as possible；
(4) it inhales and abandons culture solution, gently washed with D-hanks 3 times, wash off the patched cell due to caused by scratch as far as possible；
(5) 1640 culture mediums of 1% dual anti-2% fetal calf serum are added；
(6) scratch width beside cross at this time is photographed to record, 0h is denoted as；
(7) 6 orifice plates are put back into incubator culture, is spaced 12 hours and takes out, shoots the position of clapped picture when 0h, be denoted as 12h；
(8) same position is clapped again when being spaced for 24 hours, until scratch healing, arranges all pictures, and for statistical analysis.
The external migration for being overexpressed circ_3234 and promoting nasopharyngeal carcinoma cell
After determining that circular rna circ_3234 has facilitation to the proliferative capacity of nasopharyngeal carcinoma cell, we are again in nasopharynx Scratch experiment is carried out in cancerous cell line, to verify circ_3234 to the migration of Nasopharyngeal Carcinoma Cell Line either with or without influence.Utilize rouge Plastid method lipofectamine 3000 is overexpressed endotoxin-free plasmid pcDNA3.1 and pcDNA3.1/has_circ_3234 Carrier transient transfection nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 continue to cultivate to after 48 hours.Collect cell, using in real time it is glimmering Fluorescent Quantitative PCR technology detects the expression and cyclization efficiency of circ_3234.Circ_3234 overexpression plasmid is being determined After being overexpressed good result, we have carried out cell scratch Healing Experiments in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2.It draws Multiple time points (HONE1 0h, 12h, for 24 hours of the trace Healing Experiments in these cells；HNE2 is 0h, 12h, for 24 hours；CNE2 is 0h, 12h, for 24 hours) confirm: relative to unloaded pcDNA3.1 (+) plasmid group, pcDNA3.1/circ_3234 is overexpressed plasmid group The transfer ability of cell is remarkably reinforced.Scratch width differs greatly, and has statistical significance.The above results show that being overexpressed The expression of circ_3234 in Nasopharyngeal Carcinoma Cell Line can promote the migration of nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 in vitro Ability.(result see Fig. 4,5,6)
External silencing circ_3234 inhibits the migration of nasopharyngeal carcinoma cell
SiRNA and NC is transiently transfected into the silencing into HONE1, HNE2 and CNE2 cell line using Hiperfect reagent The expression of circ_3234.Continue to cultivate 48 hours collection cells after transfection, detects circ_ using Real-Time Fluorescent Quantitative PCR Technique 3234 expression is to detect the transfection efficiency of siRNA.The results show that siRNA has good silencing efficiency.Ensuring After circ_3234 is disturbed, we carry out in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 of silencing circ_3234 Scratch experiment verifies its influence to cell migration.Multiple time points of the scratch Healing Experiments in these cells, (HONE1 was 0h,12h,24h；HNE2 is 0h, 12h, for 24 hours；CNE2 is 0h, 12h, for 24 hours) confirm: relative to NC group, siRNA group cell Transfer ability obviously weakens.Scratch width difference is obvious, and has statistical significance.The above results show that silencing nasopharyngeal carcinoma is thin The expression of circ_3234, is able to suppress the transfer ability of nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 in vitro in born of the same parents system.It is logical Crossing positive and negative both direction verifying proves that circ_3234 can promote the migration of nasopharyngeal carcinoma cell.(result see Fig. 7,8,9)
Embodiment 4: cell transwell Matrigel:
(1) matrigel prepares: mentioning the previous day is placed in 4 DEG C of refrigerators in -20 DEG C of BDMatrigel glue and is melted into liquid freezing Tip head, the EP pipe of releasing glue are placed in -20 DEG C overnight by state, and Matrigel glue will not mistake when spreading glue when operation in such second day Fast solidification；
(2) matrigel dilutes: BDMatrigel glue: anteserum-less substrate=1:8, i.e. 20 μ l matrigels add 160 μ l 1640 to train Base featheriness mixes；
(3) 100 μ l of the cell transwell is added in the matrigel diluted, then 80 μ l is sucked out along side, successively completed and be put into It is incubated for 2-3 hours in 37 DEG C of incubators, when it is white for seeing paving glue-line, shows that liquid Matrigel glue has been in solid-state；
(4) experimental cell after digestion transfection is washed 2 times with anteserum-less substrate, then outstanding thin using the training base weight of serum-free Born of the same parents, carry out cell count, and adjustment cell concentration is 20,000 cell in every 200 μ l；
(5) 1640 culture mediums that 800 μ l contain 20%FBS are added to bottom chamber, tilts 24 orifice plates when being put into cell 45° angle generates bubble to avoid being put into during cell between cell and liquid level；
(6) every room adds indoor on the unified cell suspension to transwell counted of 200 μ l, and 24 orifice plates are put back to 37 DEG C In incubator, according to cell state and cell invasion speed, it is incubated for about 24~48 hours.
(7) 24 orifice plates are taken out, are washed twice with PBS or D-hanks, 4% paraformaldehyde embathes 10 minutes, washes 3 with clear water Time.
(8) it dyeing: being added drop-wise to the bottom of the cell transwell with 0.1% crystal violet, 5-10min is placed in room temperature peace and quiet, It is cleaned 2-3 times with PBS, the matrigel above cell is carefully wiped with cotton swab；
(9) it is added in 800 μ l, transwell upper chamber of distilled water in 24 orifice plates and about 200 μ l of distilled water is added, then existed It under inverted microscope, is observed, the different visuals field are taken pictures, and count with image J software aobvious with statistical analysis difference Work property.
The external invasion for being overexpressed circ_3234 and promoting nasopharyngeal carcinoma cell
We have carried out the experiment of the cell Transwell matrigel invasion in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2, To observe the influence for being overexpressed circ_3234 to cell invasion ability.We are also with liposome method lipofectamine 3000 endotoxin-free plasmid pcDNA3.1 and pcDNA3.1/circ_3234 over-express vectors transiently transfect nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 continue to cultivate to after 48 hours.Cell is collected, detects circ_ using Real-Time Fluorescent Quantitative PCR Technique 3234 expression and cyclic efficiency.After being determined that circ_3234 is overexpressed the overexpression good result of plasmid, we will For cell inoculation into the cell Transwell of paving matrigel, discovery is overexpressed the cell invasion of plasmid group to small chamber lower surface Number is obviously more than zero load group, and the trend of three plants of cell line results is consistent.Random shooting 3 opens photo and records cell number, There is notable difference in each cell line between two group data, and there is statistical significance.The above result shows that being overexpressed nasopharynx The expression of circ_3234 in cancerous cell line can promote the invasion energy of nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 in vitro Power.(the result is shown in Figure 1 0,11,12)
The expression of external silencing circ_3234 influences the invasion of nasopharyngeal carcinoma
It is overexpressed phenotypic alternation brought by circ_3234 in order to probe into after silencing circ_3234 whether to reverse, I Matrigel invasion experiment in the cell Transwell has been carried out in two plants of cell lines again, using Hiperfect reagent by circ_ 3234siRNA and NC transiently transfects the expression of the silencing circ_3234 into HONE1, HNE2 and CNE2 cell line.It transfects subsequent 48 hours collection cells of continuous culture, using the expression of Real-Time Fluorescent Quantitative PCR Technique detection circ_3234 to detect The transfection efficiency of siRNA.The results show that circ_3234siRNA has good silencing efficiency.Ensuring that circ_3234 is done After disturbing, it is small that we carry out Transwell in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 of silencing circ_3234 Room matrigel invasion experiment, the results show that siRNA group can be in the tumor cell number that the small chamber lower surface of Transwell is observed Considerably less than NC group, and the trend of two plants of cell line results is consistent.Random shooting 6 opens photo and records cell number, Mei Yixi There is notable difference in born of the same parents system between two group data, and there is statistical significance.The above result shows that silencing Nasopharyngeal Carcinoma Cell Line The expression of middle circ_3234 is able to suppress the invasive ability of nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 in vitro.By positive and negative Both direction proves that circular rna circ_3234 can promote the invasion of nasopharyngeal carcinoma cell.(the result is shown in Figure 1 3,14,15).
Sequence table
<110>Central South University
<120>circ_3234 and its application in treatment of nasopharyngeal carcinoma preparation and treatment preparation are being prepared
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 377
<212> RNA
<213>homo sapiens (Homo sapiens)
<400> 1
agcauugauc ugguagccuu gcuccagaag ccuguuccuc acagucaagc cucagaagcc 60
aacuccuuug aaacuuccca acagcagggc uuuggccaag cccuugucuu cacaaauucg 120
caacacaaca aucagauggc accagggacu ggcagcucca cugccgucaa cuccuguucu 180
ccucagagcc ugaacuggca ucaaauacuc acaacauagc ucaggaucug ucaaacaaaa 240
guucuuaugg acucaaaggg gcuuggaaga auucugugga agaguggaca acagaagacu 300
ggacugaaga ucuuucugaa acaaaggucu ucacugccuc aucugcucca gcagagaauc 360
acaucuuacc ugggcaa 377
<210> 2
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 2
tcaccaactg ggacgacatg 20
<210> 3
<211> 21
<212> DNA
<213>unknown (Unknown)
<400> 3
gtcaccggag tccatcacga t 21
<210> 4
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 4
caacaatcag atggcaccag 20
<210> 5
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 5
aattcttcca agcccctttg 20
<210> 6
<211> 32
<212> DNA
<213>unknown (Unknown)
<400> 6
cccatcgata actggcatca aatactcaca ac 32
<210> 7
<211> 28
<212> DNA
<213>unknown (Unknown)
<400> 7
taaccgcggc aggctctgag gagaacag 28
<210> 8
<211> 21
<212> RNA
<213>unknown (Unknown)
<400> 8
ccucagagcc ugaacuggcu u 21
<210> 9
<211> 21
<212> RNA
<213>unknown (Unknown)
<400> 9
gccaguucag gcucugaggu u 21
<210> 10
<211> 21
<212> RNA
<213>unknown (Unknown)
<400> 10
uucuccgaac gugucacguu u 21
<210> 11
<211> 21
<212> RNA
<213>unknown (Unknown)
<400> 11
acgugacacg uucggagaau u 21

Claims (9)

1. a kind of circular rna circ_3234, sequence is as shown in SEQ ID NO.1.
2. inhibiting application of the reagent of circular rna circ_3234 expression in preparation treatment nasopharyngeal carcinoma preparation, the ring-type RNA circ_3234 sequence is as shown in SEQ ID NO.1.
3. application according to claim 2, which is characterized in that the examination for inhibiting circular rna circ_3234 expression Agent includes siRNA.
4. application according to claim 3, which is characterized in that the siRNA is as follows:
Positive-sense strand (5'-3') CCUCAGAGCCUGAACUGGCUU
Antisense strand (5'-3') GCCAGUUCAGGCUCUGAGGUU.
5. application according to claim 3, which is characterized in that the reagent of the described inhibition circ_3234 expression further includes Negative control:
Positive-sense strand (5'-3') UUCUCCGAACGUGUCACGUUU
Antisense strand (5'-3') ACGUGACACGUUCGGAGAAUU.
6. a kind of preparation for treating nasopharyngeal carcinoma, which is characterized in that the reagent including inhibiting circular rna circ_3234 expression, institute The circular rna circ_3234 sequence stated is as shown in SEQ ID NO.1.
7. the preparation for the treatment of nasopharyngeal carcinoma according to claim 6, which is characterized in that the inhibition circular rna circ_ The reagent of 3234 expression includes siRNA.
8. the preparation for the treatment of nasopharyngeal carcinoma according to claim 6, which is characterized in that the siRNA is as follows:
Positive-sense strand (5'-3') CCUCAGAGCCUGAACUGGCUU
Antisense strand (5'-3') GCCAGUUCAGGCUCUGAGGUU.
9. the preparation for the treatment of nasopharyngeal carcinoma according to claim 6, which is characterized in that the inhibition circ_3234 expression Reagent further include negative control:
Positive-sense strand (5'-3') UUCUCCGAACGUGUCACGUUU
Antisense strand (5'-3') ACGUGACACGUUCGGAGAAUU.
CN201910275579.5A 2019-04-08 2019-04-08 circ _3234, application thereof in preparation of nasopharyngeal carcinoma treatment preparation and treatment preparation Active CN109971760B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910275579.5A CN109971760B (en) 2019-04-08 2019-04-08 circ _3234, application thereof in preparation of nasopharyngeal carcinoma treatment preparation and treatment preparation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910275579.5A CN109971760B (en) 2019-04-08 2019-04-08 circ _3234, application thereof in preparation of nasopharyngeal carcinoma treatment preparation and treatment preparation

Publications (2)

Publication Number Publication Date
CN109971760A true CN109971760A (en) 2019-07-05
CN109971760B CN109971760B (en) 2021-04-06

Family

ID=67083348

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910275579.5A Active CN109971760B (en) 2019-04-08 2019-04-08 circ _3234, application thereof in preparation of nasopharyngeal carcinoma treatment preparation and treatment preparation

Country Status (1)

Country Link
CN (1) CN109971760B (en)

Also Published As

Publication number Publication date
CN109971760B (en) 2021-04-06

Similar Documents

Publication Publication Date Title
Yan et al. The umbilical cord mesenchymal stem cell‐derived exosomal lncRNA H19 improves osteochondral activity through miR‐29b‐3p/FoxO3 axis
CN108721319A (en) Inhibit application and preparation of the reagent of circ_CLASP2 in preparing treatment of nasopharyngeal carcinoma preparation
CN108660214A (en) Detect application and kit of the reagent of circ_CLASP2 in preparing nasopharyngeal carcinoma diagnosis preparation
Yang et al. CircRNA_100876 promote proliferation and metastasis of breast cancer cells through adsorbing microRNA-361-3p in a sponge form.
CN110129447A (en) Application of the PQBP1 in Diagnosis of Ovarian Cancer
Hou et al. RETRACTED: Oncogenic miR-27a delivered by exosomes binds to SFRP1 and promotes angiogenesis in renal clear cell carcinoma
CN109666674A (en) CircCDYL2 and its preparing application and diagnostic preparation in nasopharyngeal carcinoma diagnosis preparation
CN110066875B (en) Application of long-chain non-coding RNA lncLCIR-1 as lung cancer molecular marker
CN109971759A (en) Circ_ADARB1 and its preparing application and diagnostic preparation in nasopharyngeal carcinoma diagnosis preparation
CN108034655B (en) Application of long non-coding RNA and composition thereof in diagnosis/treatment of colorectal cancer
CN107312855B (en) Gene related to laryngeal squamous cell carcinoma and application thereof
CN107164554B (en) Application of ASPRV1 as biomarker in diagnosis and treatment of laryngeal squamous cell carcinoma
CN110358834B (en) Application of lncRNA, kit and medicine
CN109852692A (en) Circ_3480 and its preparing application and diagnostic reagent in nasopharyngeal carcinoma diagnosis preparation
CN109971760A (en) Circ_3234 and its preparing application in treatment of nasopharyngeal carcinoma preparation and treatment preparation
CN109762823A (en) Circ_1892 and its preparing application in treatment of nasopharyngeal carcinoma preparation and treatment preparation
CN114032236B (en) shRNA of TMEM2 and application thereof
CN110577952B (en) Application of siRNA interfering long non-coding RNA in preparation of medicine for treating breast cancer
CN109652556A (en) CircARHGAP12 and its preparing application and diagnostic preparation in nasopharyngeal carcinoma diagnosis preparation
CN109758472A (en) Circ_2157 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation
CN109847064A (en) Circ_3480 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation
CN109762818A (en) Circ_2157 and its preparing application and diagnostic reagent in nasopharyngeal carcinoma diagnosis preparation
CN109908351A (en) Circ_ADARB1 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation
CN109701025A (en) CircCDYL2 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation
CN109700825A (en) CircARHGAP12 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant