CN109908351A - Circ_ADARB1 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation - Google Patents

Abstract

The invention belongs to oncomolecularbiology technical fields, and in particular to circ_ADARB1 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation.We have found that circ_ADARB1 is likely to become the potential target spot for the treatment of of nasopharyngeal carcinoma for the first time.Since siRNA has good silencing efficiency, the present invention, which is used, interferes circ_ADARB1 for the splicing site design siRNA at circular rna headtotail, scratch Healing Experiments, matrigel invasion experiment are carried out in Nasopharyngeal Carcinoma Cell Line HNE2 and CNE2, relative to control group, siRNA strikes the invasion of low circ_ADARB1 group cell and transfer ability obviously weakens, i.e. silencing circ_ADARB1 inhibits the invasion of nasopharyngeal carcinoma cell to shift.Show to inhibit circ_ADARB1 that can treat nasopharyngeal carcinoma, there is far-reaching clinical meaning and important popularization and application foreground.

Description

Circ_ADARB1 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation

Technical field

The invention belongs to oncomolecularbiology technical fields, and in particular to a kind of inhibition circular rna circ_ADARB1 Reagent and its preparing the application in treatment of nasopharyngeal carcinoma preparation.

Background technique

Circular rna (Circular RNA) is a big research hotspot, they are one kind by Pre-mRNA (precursor Messenger RNA, pre-mRNA) one kind for being reversely spliced to form do not have 5 ' end caps and 3 ' end poly (A) tails Bar and with covalent bond formed ring structure non-coding RNA molecule.There are the stability, conservative, specificity of height, and contains Measure high feature.CircRNA is mainly derived from the exon 1 of protein coding gene, can also be by including sub-district, the area UTR, base Because between area, non-coding RNA site and known to the antisense site of transcript formed.

CircRNA forming process can be divided into two major classes, i.e. exon cyclisation is (exon circularization) and interior Containing subring (intron circularization).The circRNA in the proposition such as Jeck exon source (exoniccircRNA, ecircRNA) can be divided into lasso trick driving cyclisation (lariat-driven circularization) and Introne pairing driving cyclisation (intron-pairing-driven circularization) two kinds of generation types, lasso trick drive Rotating ring is exon 3 ' it holds as 5 ' end acceptor splicing site (splice of donor splicing site (splice donor) attack Receptor), the area Alu covalent bond and form lasso structure, excision introne is formed after lasso structure carries out internal splicing circRNA；Introne pairing driving cyclisation is after two introne base pair complementarities form cyclic structure, to wipe out introne shape At circRNA.Introne itself can also be cyclized in fact, can form the circRNA (circular in introne source intronic RNA,ciRNA)。

Nasopharyngeal carcinoma (nasopharyngeal carcinoma, NPC) belongs to head and neck neoplasm, originates from pharynx nasalis epithelium group It knits.It falls ill generally at the rear cornucopia of pharynx nasalis (Luo Senmiaole nest, Fossa of Rosenm ü ller), nasopharynx herein Cancer cell easily invades neighbouring tissue and organ.Since the occurrence and development of nasopharyngeal carcinoma are the familial inheritance and body cell something lost by accumulating Pass mutation and epigenetics be mutated caused by multistage complexity gene regulation process, be related to proto-oncogene and tumor suppressor gene The epigenetic regulation etc. that activation and silencing and ncRNA are participated in.So the specific molecular mechanism of nasopharyngeal carcinoma occurrence and development It is still not clear, and due to Tumor Heterogeneity and individual difference, the curative effect of traditional radiotherapy equipment system is not significant.Therefore logical It crosses circRNA and probes into itself and nasopharyngeal carcinoma occurrence and development mechanism, be further the diagnosis of nasopharyngeal carcinoma, and control nasopharyngeal cardnoma proliferation, Invasion and transfer will be significant.

We detect the circ_ADARB1 of a length 290bp.It is reversed by ADARB1 gene 2,3 exons The circular rna being spliced to form.It is found by experiment that the circular rna exists with the occurrence and development of nasopharyngeal carcinoma to be associated with, it is possible to as Nasopharyngeal carcinoma diagnosis marker, and the target spot for the treatment of.

Summary of the invention

Present invention finds the circ_ADARB1 of a size 290bp, and have found its existing pass between nasopharyngeal carcinoma System, it is possible to the target spot as nasopharyngeal carcinoma diagnosis marker and treatment.

The first purpose of the invention is to provide a kind of reagents for inhibiting circ_ADARB1 to prepare treatment of nasopharyngeal carcinoma preparation In application, the sequence of the circ_ADARB1 is as shown in SEQ No.1.

Further, the preparation of the inhibition circular rna circ_ADARB1 includes siRNA.

Further, the siRNA is as follows:

Positive-sense strand (5'-3') GCCAGAGUGGAGCCUUUCAUU

Antisense strand (5'-3') UGAAAGGCUCCACUCUGGCUU,

But it is not limited to above-mentioned specific siRNA.

Further, the reagent of the inhibition circ_ADARB1 further includes negative control:

Positive-sense strand (5'-3') UUCUCCGAACGUGUCACGUUU

Antisense strand (5'-3') ACGUGACACGUUCGGAGAAUU.

But it is not limited to above-mentioned specific negative control.

A second object of the present invention is to provide a kind of preparations for treating nasopharyngeal carcinoma, including inhibit circular rna circ_ The preparation of ADARB1, the circular rna circ_ADARB1 sequence is as shown in SEQ ID NO.1.

Further, the preparation of the inhibition circular rna circ_ADARB1 includes siRNA.

Further, the siRNA is as follows:

Positive-sense strand (5'-3') GCCAGAGUGGAGCCUUUCAUU

Antisense strand (5'-3') UGAAAGGCUCCACUCUGGCUU

But it is not limited to above-mentioned specific siRNA.

Further, the reagent of the inhibition circ_ADARB1 further includes negative control:

Positive-sense strand (5'-3') UUCUCCGAACGUGUCACGUUU

Antisense strand (5'-3') ACGUGACACGUUCGGAGAAUU.

But the present invention is not limited only to above-mentioned negative control.

Treatment of nasopharyngeal carcinoma preparation further includes reagent needed for transfection siRNA.

Currently, siRNA has evolved into the important tool of gene functional research.In order to probe into circ_ADARB1 in tumour Effect in occurrence and development, we are devised a pair of of siRNA according to the splicing site of circ_ADARB1, are tried using Hiperfect SiRNA and siNC (control) is transiently transfected the expression of the silencing circ_ADARB1 into CNE2 and HNE2 cell line by agent.Transfection After continue cultivate 36 hours collections cells, using Real-Time Fluorescent Quantitative PCR Technique detect circ_ADARB1 expression to examine The transfection efficiency of siRNA is surveyed, while detecting the expression of circ_ADARB1, it is found that the siRNA of design can be significantly inhibited The expression of circ_ADARB1.

The present invention confirms above-mentioned conclusion by largely testing: i.e. the reagent of inhibition circ_ADARB1 can be used in preparing Treatment of nasopharyngeal carcinoma preparation.These tests include: that external overexpression circ_ADARB1 test discovery can promote nasopharyngeal carcinoma cell to increase It grows, external silencing circ_ADARB1 then inhibits the proliferation of nasopharyngeal carcinoma cell；The external circ_ADARB1 that is overexpressed promotes nasopharyngeal carcinoma The migration of cell, external silencing circ_ADARB1 inhibit the migration of nasopharyngeal carcinoma cell；The external circ_ADARB1 that is overexpressed promotes The invasion of nasopharyngeal carcinoma cell, the expression of external silencing circ_ADARB1 influence the invasion of nasopharyngeal carcinoma.

Since siRNA has good silencing efficiency.After ensuring that circ_ADARB1 is disturbed, we are in silencing MTT experiment is carried out in the Nasopharyngeal Carcinoma Cell Line CNE2 and HNE2 of circ_ADARB1, relative to NC (control) group, siRNA group is thin The growth rate of born of the same parents obviously slows down, i.e. the proliferation that silencing circ_ADARB1 inhibits nasopharyngeal carcinoma cell.Inhibit circ_ ADARB1 can treat nasopharyngeal carcinoma, have far-reaching clinical meaning and important popularization and application foreground.

Detailed description of the invention

Fig. 1 is the expression water that qRT-RCR detects circ_ADARB1 in tissues of nasopharyngeal carcinoma and non-tumour rhinitis epithelial tissue It is flat；

The expression analysis of circ_ADARB1 is using β-actin as reference by non-tumour nasopharyngeal epithelium organizational standard It is non-tumour nasopharyngeal epithelium tissue, sample number 12 for 1, N；T is tissues of nasopharyngeal carcinoma, and sample number 22, n is sample size, It is examined using t, P < 0.05 has statistical significance.

Fig. 2 is the sequencing of Sanger method；

A.circ_ADARB1 is reversely spliced by ADARB1 gene 2,3 exons, and E indicates exon (exon), under The joint sequence of underlined sequence expression head and the tail；The schematic diagram that b.circRNA is formed；C. the peak figure of sequencing result, black arrow table Show headtotail from there.

Fig. 3 is over-express vector map.

Fig. 4 is the expression that qRT-RCR detects circ_ADARB1 in Nasopharyngeal Carcinoma Cell Line；

QRT-PCR as the result is shown circ_ADARB1 normal nasopharyngeal epithelial cell NP69 and nasopharyngeal carcinoma cell CNE2, Expression in HNE2, HONE1, circ_ADARB1 expression are analyzed using β-actin as reference, by the normal inflammation of immortalization Property nasopharyngeal epithelial cells NP69 is standardized as 1, * P < 0.05, * * P < 0.01, * * * P < 0.001, P < 0.0001 * * * *.

Fig. 5 is that qRT-PCR detects circ_ADARB1 overexpression effect and cyclic efficiency in Nasopharyngeal Carcinoma Cell Line；

A and c.qRT-PCR detection circ_ADARB1 in Nasopharyngeal Carcinoma Cell Line CNE2, HNE2 is overexpressed effect and cyclization Efficiency；B and d.qRT-PCR detection is overexpressed circ_ADARB1 to ADARB1 mRNA in Nasopharyngeal Carcinoma Cell Line CNE2, HNE2 Horizontal influence；Using β-actin as referring to by pcDNA3.1 (+) group be standardized as 1, ns represent it is nonsensical, * P < 0.05, * P < 0.0001 * P < 0.01, * * * P < 0.001, * * * *.

Fig. 6 is the silence efficiency that qRT-PCR technology detects circ_ADARB1siRNA in Nasopharyngeal Carcinoma Cell Line；

The silence efficiency of a and c.qRT-PCR detection circ_ADARB1siRNA in Nasopharyngeal Carcinoma Cell Line CNE2, HNE2； The b and d.qRT-PCR detection shadow of silencing circ_ADARB1 to ADARB1mRNA level in Nasopharyngeal Carcinoma Cell Line CNE2, HNE2 It rings；Circ_ADARB1 expression is analyzed using β-actin as reference, and NCsiRNA group, which is standardized as 1, ns representative, not to be had Meaning, P < 0.0001 * P < 0.05, * * P < 0.01, * * * P < 0.001, * * * *.

Fig. 7 is the external influence for being overexpressed circ_ADARB1 and being proliferated to nasopharyngeal carcinoma cell；

A-b.qRT-PCR detection circ_ADARB1 in Nasopharyngeal Carcinoma Cell Line CNE2, HNE2 is overexpressed efficiency；C-d. right The MTT experiment that above-mentioned cell carries out detects ability of cell proliferation, and circ_ADARB1 expression is analyzed using β-actin as reference, By pcDNA3.1 (+) group be standardized as 1, ns represent it is nonsensical, * P < 0.05, * * P < 0.01, * * * P < 0.001, * * * * P < 0.0001。

Fig. 8 is the influence that external silencing circ_ADARB1 is proliferated nasopharyngeal carcinoma cell；

A-b.qRT-PCR detection circ_ADARB1 in Nasopharyngeal Carcinoma Cell Line CNE2, HNE2 strikes poor efficiency；C-d. to upper It states cell and carries out MTT experiment detection ability of cell proliferation, circ_ADARB1 expression is analyzed using β-actin as reference, will NCsiRNA group is standardized as 1, ns and represents nonsensical, P < 0.0001 * P < 0.05, * * P < 0.01, * * * P < 0.001, * * * *.

Fig. 9 is that qRT-PCR detects circ_ADARB1 overexpression efficiency in scratch experiment cell；

A-b. human nasopharyngeal epithelioma 1 CNE2, HNE2 transfection efficiency used in scratch experiment is tested with qRT-PCR and is detected, circ_ ADARB1 expression is analyzed using β-actin as reference, and pcDNA3.1 (+) group is standardized as 1, * P < 0.05, and * * P < 0.01, * P < 0.0001 * * P < 0.001, * * * *.

Figure 10 is the influence for being overexpressed circ_ADARB1 to nasopharyngeal carcinoma cell CNE2, HNE2 scratch Healing Experiments；

A-b. nasopharyngeal carcinoma CNE2 and HNE2 cell transfecting pcDNA3.1 (+) zero load, pcDNA3.1 (+)/has_circ_ ADARB1, the scratch after cell density reaches 100% were taken pictures in observation in the 0th, 12,24 hour.

Figure 11 is nasopharyngeal carcinoma CNE2, the HNE2 cell scratch experiment statistical chart for being overexpressed circ_ADARB1；

A-b. 6 perimetry scratch widths are randomly selected for every group, 0 hour scratch width is standardized as 1, is taken statistics Figure；It is each to test in triplicate, using Student's t-test method statistic.*P<0.05,**P<0.01,***P< 0.001, * P < 0.0001 * * *.

Figure 12 is that qRT-PCR detects circ_ADARB1 jamming effectiveness in scratch experiment cell；

A-b. human nasopharyngeal epithelioma 1 CNE2, HNE2 transfection efficiency used in scratch experiment is tested with qRT-PCR and is detected, circ_ ADARB1 expression is analyzed using β-actin as reference, and NC siRNA group is standardized as 1, * P < 0.05, P < 0.01 * *, P < 0.0001 * * P < 0.001, * * * *.

Figure 13 is the influence for interfering circ_ADARB1 to nasopharyngeal carcinoma cell CNE2, HNE2 scratch Healing Experiments；

A-b. nasopharyngeal carcinoma CNE2 and HNE2 cell transfecting NC siRNA/si-circ_ADARB1, reaches to cell density Scratch after 100% was taken pictures in observation in the 0th, 12,24 hour.

Figure 14 is nasopharyngeal carcinoma CNE2, the HNE2 cell scratch experiment statistical chart for interfering circ_ADARB1；

A-b. 6 perimetry scratch widths are randomly selected for every group, 0 hour scratch width is standardized as 1, is taken statistics Figure；It is each to test in triplicate, using Student's t-test method statistic.*P<0.05,**P<0.01,***P< 0.001, * P < 0.0001 * * *.

Figure 15 is the overexpression effect that qRT-PCR detects circ_ADARB1 in the experiment of the cell Transwell matrigel invasion Rate；

The cell a-b.Transwell matrigel invasion is tested human nasopharyngeal epithelioma 1 CNE2, HNE2 transfection efficiency used and is used QRT-PCR experiment detection, circ_ADARB1 expression is analyzed using β-actin as reference, by pcDNA3.1 (+) group standard Turn to 1, * P < 0.05, P < 0.0001 * * P < 0.01, * * * P < 0.001, * * * *.

Figure 16 is the influence for being overexpressed circ_ADARB1 to Nasopharyngeal Carcinoma Cell Line CNE2, HNE2 invasive ability；

CNE2, the HNE2 and respective cellular control unit for being overexpressed circ_ADARB1 respectively carry out the cell Transwell Matrigel invasion experiment.

Figure 17 is the cell the Transwell matrigel invasion experiment statistics figure for being overexpressed circ_ADARB1；

Every group randomly selects 3 cell visuals field and carries out cell count, and take statistics figure；Each experiment in triplicate, uses Student's t-test method statistic；Using β-actin as reference, pcDNA3.1 (+) group is standardized as P < 0.05 1, *, P < 0.0001 * P < 0.01, * * * P < 0.001, * * * *.

Figure 18 is the jamming effectiveness that qRT-PCR detects circ_ADARB1 in the experiment of the cell Transwell matrigel invasion；

The cell a-b.Transwell matrigel invasion is tested human nasopharyngeal epithelioma 1 CNE2, HNE2 transfection efficiency used and is used QRT-PCR experiment detection, circ_ADARB1 expression analyze using β-actin as reference, by NC group be standardized as 1, * P < 0.05, * P < 0.0001 * P < 0.01, * * * P < 0.001, * * * *.

Figure 19 is the influence for interfering circ_ADARB1 to Nasopharyngeal Carcinoma Cell Line CNE2, HNE2 invasive ability；

CNE2, the HNE2 and respective cellular control unit for interfering circ_ADARB1 respectively carry out the cell Transwell base Matter glue Matrigel.

Figure 20 is the cell the Transwell matrigel invasion experiment statistics figure for interfering circ_ADARB1；

Every group randomly selects 3 cell visuals field and carries out cell count, and take statistics figure；Each experiment in triplicate, uses Student's t-test method statistic；Using β-actin as reference, NC group is standardized as 1, * P < 0.05, * * P < 0.01, * P < 0.0001 * * P < 0.001, * * * *.

Specific embodiment

It is intended to further illustrate the present invention below in conjunction with specific embodiment, is not intended to limit the present invention.

It is attached swollen that normal inflammatory nasopharyngeal epithelium tissue and tissues of nasopharyngeal carcinoma sample used in the present invention are all from Central South University The first visit patient of tumor hospitalize, without chemicotherapy and operative treatment.After fresh tissues of nasopharyngeal carcinoma is collected, it is immediately placed in liquid nitrogen It is saved in tank, all experiment tissue samples acquisitions of relevant clinical data for then collecting all patients obtain Central South University's human relations It manages committology and patient agrees to.

Tri- plants of Nasopharyngeal Carcinoma Cell Lines of CNE2, HNE2, HONE1 used in the present invention are that Tumour Inst., Zhongnan Univ.'s molecule is lost Laboratory is passed to be saved.Cell culture condition are as follows: containing 10% fetal calf serum (FBS) and 1% dual anti-(penicillin, streptomysin) RPMI1640 fluid nutrient medium, 37 DEG C, 95% humidity, 5%CO₂Adherent growth in the constant incubator of concentration.

The primer of circular rna of the present invention is different from the design of linear rna primer, is designed according to splicing site two sides, The Photographing On-line on the website Primer3.0, final primer synthetic work are ordered goods by sending Email, and the commission section of holding up is raw The synthesis of object company Changsha combining unit.

(1)β-actin

Upstream primer: 5 '-TCACCAACTGGGACGACATG-3 ', sequence is as shown in SEQ ID NO.2；

Downstream primer: 5 '-GTCACCGGAGTCCATCACGAT-3 ', sequence is as shown in SEQ ID NO.3.

(2) circular rna circ_ADARB1 real-time quantitative PCR primer

Upstream primer: 5 '-ACCCTCATTCATCCAGCGAG-3 ', sequence is as shown in SEQ ID NO.4；

Downstream primer: 5 '-GCCAGTGTGTCTCCTTCAGT-3 ', sequence is as shown in SEQ ID NO.5；

(3) circ_ADARB1 overall length primer is expanded

Upstream primer: 5 '-CCATCGATAGTGGAGCCTTTCAGGCTG-3 ', sequence is as shown in SEQ ID NO.6.

Downstream primer: 5 '-TCCCCGCGGCTGGCTGGCAAGGCG-3 ', sequence is as shown in SEQ ID NO.7.

The present invention expresses to specifically strike low circular rna without influencing its glm gene, is designed according to splicing site SiRNA, targeted silent circ_ADARB1.

Circ_ADARB1 siRNA sequence:

Positive-sense strand (5'-3') GCCAGAGUGGAGCCUUUCAUU, sequence is as shown in SEQ ID NO.8.

Antisense strand (5'-3') UGAAAGGCUCCACUCUGGCUU, sequence is as shown in SEQ ID NO.9.

Negative control:

Positive-sense strand (5'-3') UUCUCCGAACGUGUCACGUUU, sequence is as shown in SEQ ID NO.10.

Antisense strand (5'-3') ACGUGACACGUUCGGAGAAUU, sequence is as shown in SEQ ID NO.11.

Test result of the present invention is all made of statistical analysis: t, which is examined, to be used to evaluate the difference between two groups.Chi-square Test is used To assess gene expression or not express in terms of the clinical parameters such as gender, age, tumor stage, clinical stages and transfer case Difference.Survival analysis is examined using in terms of Kaplan-Meier.For indicating significance,statistical, all p values make for p < 0.05 Use two-sided test.Statistical analysis is carried out using SPSS 13.0 and Graphpad7.0 software.

Expression of the embodiment 1:circ_ADARB1 in tissues of nasopharyngeal carcinoma and cell

1, according to master sample acquisition scheme, we collect Nasopharyngeal Carcinoma Patients tissue samples 34 from Hunan Provincial Tumour Hospital Example.All cases are that (time interval: in January, 2016 was to 2016 11 by the first visit patient of Hunan Provincial Tumour Hospital's Head and neck tumour Month).Make a definite diagnosis nasopharyngeal carcinoma 22 through pathology department, nasopharynx inflammatory patients 12 (excluded tumor disease, no active infectious disease, Serious immunity disease and other major diseases).

Record complete personal information and clinical data during acquisition, including name, gender, the age, outpatient service number, Number, histological type, case by stages and EBV infection conditions etc., are detailed in Excel electrical form screenshot in hospital.All samples Patient's permission is all obtained in acquisition, and signs written agreement with patient, establishes the more complete sample storehouse of data.

2, nasopharyngeal carcinoma or normal inflammatory nasopharyngeal tissue RNA are extracted

(1) preparation: mortar is soaked in 3% hydrogen peroxide (H after being cleaned with detergent₂O₂) in 4 hours or more, wash away For several times, primary with distillation washing, with masking foil covering mortar when taking-up (help to be heated evenly, prevent from polluting), it is placed in 180 DEG C It is done in drying box 8 hours or more roasting.After reaching the dry roasting time, drying box is closed, takes out and grinds when box temperature degree to be dried is down to room temperature Alms bowl deposits in clean area.

(2) liquid nitrogen grinding: being added Liquid nitrogen precooler in mortar, then clamps the pharynx nasalis tissue saved in cryopreservation tube, fastly Speed grinding, grinds on one side, continuously adds a small amount of liquid nitrogen on one side, then grind, and clays into power shape until by nasopharyngeal tissue.According to best Ratio, i.e., every 50-100mg is normal or NPC sample (nasopharyngeal carcinoma sample) adds 1ml Trizol.In our experimentations, a nose Pharynx cancer tissue samples about 200mg or so, it is therefore desirable to 2ml Trizol.Then it is further ground, is placed in 4 DEG C of refrigerator about 5-10min allows tissue to crack completely.2ml Tube is transferred to when pyrolysis product is melted into pink liquid.Each sample can With separation to 2 Tube, save to -80 DEG C.

(3) aqueous phase separation: Tissue lysates of every 1000 μ l containing trizol add the chloroform of 4 DEG C of 200 μ l pre-coolings, concussion About 30s is mixed.Low temperature environment is placed after five minutes, and 25 minutes centrifugally operateds (12,000rpm, 4 DEG C) are carried out.Centrifugation finishes, Liquid in pipe can be observed and be divided into 3 layers, there are RNA in the hyaline layer of upper layer, middle layer is membranaceous white precipitate, lower layer's pink. Therefore, the upper strata aqueous phase containing RNA is further drawn into 1.5ml Tube, with 100 μ l rifle gentle aspirations, avoids being drawn onto as far as possible Middle layer and lower layer's substance, cause RNA to pollute.

(4) RNA precipitate: being added the isometric about 500 μ l of isopropanol of 1:1 in supernatant, and movement is gently turned upside down mixed It is even for several times, be placed in -20 DEG C of refrigerator put 30 minutes after, be centrifuged 30 minutes (4 DEG C, 12,000rpm), it is seen that tube bottom has RNA precipitate, use The suction of 100 μ l liquid-transfering guns discards supernatant, as far as possible reservation RNA precipitate.

(5) RNA is washed: 75% ethyl alcohol that 1ml is prepared with no enzyme water, mild turned upside down is added in every pipe RNA precipitate sample Centrifuge tube, to wash RNA precipitate.It is then centrifuged for 5 minutes (4 DEG C, 7,600rpm), is discarded supernatant as far as possible with the liquid-transfering gun of 100 μ l, Room temperature is dried 10~15 minutes.

(6) re-dissolve RNA and save: 15-30 μ l DECP water is added in every pipe sample, is stored in -80 DEG C.

3, cell total rna extracts

Preparation: after sterilizing without RNase water, 75% ethyl alcohol (no RNase prepare), chloroform, isopropanol, 1 × PBS, No enzyme tip are managed with EP, and high speed low temperature centrifugal machine is cooled to 4 DEG C in advance, and experiment will first test table top and liquid-transfering gun with 75% before starting Alcohol wipe.

(1) cell for taking RNA to be extracted, is cleaned twice with 1 × PBS or D-hanks；

Every hole adds 500 μ lTrizol lysates in (2) 12 orifice plates, lysis at room temperature 1-2 minutes, is gently blown down with liquid-transfering gun thin Born of the same parents, upper and lower gentle inversion 10 times are stored at room temperature 5 minutes；

(3) chloroform (pressing 1mlTrizol:0.2ml chloroform: 0.5ml isopropanol) of 100 μ l is added, firmly shakes 15-30s, It places 5 minutes on ice；

(4) 4 DEG C, 12000rpm/20min；

(5) it takes upper strata aqueous phase in the Tube pipe of pre-cooling, 250 μ l isopropanols is added, it is mixed with eddy mixer or liquid-transfering gun Even (- 20 DEG C > 1h)；

(6) 4 DEG C, 12000rpm/30min, abandon supernatant；

(7) 75% ethyl alcohol (pre-cooling) 1ml is added, mixes；

(8) 4 DEG C, 7600rpm/5min；Abandoning supernatant, repetition step 8,9；

(9) wink from 10s, as far as possible exhaustion supernatant, is inverted 10 minutes dry；

(10) 20-30 μ l DEPC water is added, surveys RNA concentration and OD value.

4, gene circRNA reverse transcription PCR reacts

(according to 5 × All-In-OneRTMasterMix of abm company (withAccuRTGenomicDNARemovalKit) The description of test handbook of (#G492) operates)

Configure following reaction system:

Machine response procedures are as follows on reverse transcription PCR:

25 DEG C of 10min,

42 DEG C of 15min,

85℃ 5min。

To which after reaction, -20 DEG C of preservation products are spare.

5, real-time fluorescence quantitative PCR

Reverse transcription reaction product is first diluted 5 times, then according to abm company EvaGreen qPCR MasterMix (MasterMix-R) description of test handbook operation, configures following reaction system:

Response procedures are as follows on real-time fluorescence quantitative PCR machine: (Cycle × 39)

Bio-RadIQ5 real-time fluorescence quantitative PCR instrument carry out it is above-mentioned after the reaction was completed, and reference gene β-actin markization, With 2-^ΔΔThe relative expression quantity of CT value displaying target gene, determines the differential expression of gene.It is examined using unpaired t-test It tests and calculates p value.

As a result: collecting many cases tissues of nasopharyngeal carcinoma and normal inflammatory nasopharyngeal epithelium tissue, had detected using qRT-PCR technology The expression of circ_ADARB1.The results show that circ_ADARB1 exists compared with 12 normal inflammatory nasopharyngeal epithelium tissues Obvious high expression in 22 tissues of nasopharyngeal carcinoma, circ_ADARB1 expression is about normal inflammatory nasopharynx in nasopharyngeal carcinoma group The difference of 4 times of epithelium, two groups of data has statistical significance (p=0.0044), the result is shown in Figure 1.In addition, we also have detected Expression of the circ_ADARB1 in normal nasopharyngeal epithelial cell (NP69) and nasopharyngeal carcinoma cell (CNE2, HNE2, HONE1), as a result It shows, the expression of circ_ADARB1 is apparently higher than normal nasopharyngeal epithelial cell NP69 in nasopharyngeal carcinoma cell (result is shown in Fig. 4).Cause This, circARHGAP12 high expression, circ_ADARB1 in tissues of nasopharyngeal carcinoma and cell may have the occurrence and development of nasopharyngeal carcinoma There is important biological function, there are the potentiality as nasopharyngeal carcinoma diagnosis molecular labeling.

What embodiment 2:sanger sequencing proved to be formed is circular rna

In order to prove circ_ADARB1 formed be circular rna and it is nonlinear, by the qRT-PCR product in Fig. 1 return It receives, company is sent to carry out sanger sequencing (Qing Ke company).The sequence that company returns is compared with DNASTAR software, Chromas software sees peak figure, judges the quality of sequencing.The results show that a.circ_ADARB1 is by the 2,3 of ARHGAP12 in Fig. 2 Exon head and the tail are spliced to form, and E indicates exon (exon), and underlined sequences indicate the joint sequence of head and the tail；b.circRNA The schematic diagram of formation；C. the peak figure of sequencing result, black arrow indicate headtotail from there.

Embodiment 3: circ_ADARB1 is overexpressed effect detection in Nasopharyngeal Carcinoma Cell Line

We select restriction enzyme site first, and circ_ADARB1 full length sequence is put into the online website NEB cutter 2.0 Analysis, display ClaI and SacII restriction enzyme site are the site being not present in circ_ADARB1 full length sequence, while Single existing DNA restriction enzyme in pcDNA3.1 plasmid vector.Building is overexpressed body accordingly；Fig. 3 is the table excessively drawn Up to Vector map.

In order to detect the cyclic efficiency of circ_ADARB1, we are true by the pcDNA3.1/circ_ADARB1 of building first Core over-express vector is expressed in nasopharyngeal carcinoma cell.Good third and fourth generation nasopharyngeal carcinoma cell CNE2 of upgrowth situation and HNE2 kind is into 12 orifice plates, when cell fusion degree reaches 60%-80%, with liposome method lipofectamine 3000 Endotoxin-free plasmid pcDNA3.1 empty carrier and pcDNA3.1/circ_ADARB1 over-express vector transiently transfect nasopharyngeal carcinoma cell CNE2 and HNE2 continues to cultivate to after 48 hours.Cell is collected, detects circ_ using Real-Time Fluorescent Quantitative PCR Technique The expression of ADARB1 and cyclic efficiency.QPCR turns the results show that compared with pcDNA3.1 empty plasmid group cell The expression that pcDNA3.1/circ_ADARB1 is overexpressed circ_ADARB1 in the cell of plasmid group significantly increases, and Its in CNE2 and HNE2 cell line expresses multiple at 1000 times or more, sees Fig. 5, as a result has statistical significance.But The expression of ADARB1 mRNA does not change significantly, and can illustrate to transfect circ_ADARB1 to the mRNA water of ADARB1 Flat not influence, the function in subsequent experimental result is played by circ_ADARB1 rather than ADARB1 gene.

Embodiment 4: the effect detection that silencing circ_ADARB1 is expressed in Nasopharyngeal Carcinoma Cell Line

The SI sequence of circ_ADARB1 is devised according to splicing site, siRNA is that a kind of length is 21-25 nucleotide, It complementary with cognate rna can combine, selective degradation purpose RNA, thus the double stranded rna molecule for inhibiting it to express.Currently, siRNA Have evolved into the important tool of gene functional research.In order to probe into effect of the circ_ADARB1 in tumor development, I SiRNA is devised according to the splicing site of circ_ADARB1, using Hiperfect reagent by siRNA and siNC (blank pair According to) transiently transfect into CNE2 and HNE2 cell line silencing circ_ADARB1 expression.Continue to collect for culture 48 hours after transfection Cell detects the transfection efficiency of siRNA using the expression of Real-Time Fluorescent Quantitative PCR Technique detection circ_ADARB1, Confirmation this time strikes inefficient fruit and reaches 50% or more, and the mRNA expression of ADARB1 is not affected, and can illustrate to transfect Circ_ADARB1 does not influence the mRNA level in-site of ADARB1, and the function in subsequent experimental result is played by circ_ADARB1 Rather than ADARB1 gene.As a result see Fig. 6.

Embodiment 5: the external circ_ADARB1 that is overexpressed promotes nasopharyngeal carcinoma cell proliferation

We use liposome method lipofectamine 3000 endotoxin-free plasmid pcDNA3.1 and pcDNA3.1/ first Circ_ADARB1 over-express vector transiently transfects nasopharyngeal carcinoma cell CNE2 and HNE2, after continuing culture 48 hours, utilizes qRT- PCR ensures that circ_ADARB1 after expression raising, carries out MTT experiment, verify its cell proliferation in Nasopharyngeal Carcinoma Cell Line Influence.Based on first to the 5th day testing result, we simultaneously had found pcDNA3.1 empty plasmid group and pcDNA3.1/ circ_ ADARB1 is overexpressed the cell Proliferation between plasmid group, and there are notable differences, are overexpressed circ_ADARB1 to condition of in vitro culture Under nasopharyngeal carcinoma cell proliferation have facilitation.(result is shown in Fig. 7)

Embodiment 6: external silencing circ_ADARB1 inhibits the proliferation of nasopharyngeal carcinoma cell

SiRNA and siNC (blank control) is transiently transfected into CNE2 and HNE2 cell line using Hiperfect reagent The expression of silencing circ_ADARB1.Continue to cultivate 48 hours collection cells after transfection, be examined using Real-Time Fluorescent Quantitative PCR Technique The expression of circ_ADARB1 is surveyed to detect the transfection efficiency of siRNA.The results show that siRNA is imitated with good silencing Fruit.After ensuring that circ_ADARB1 is disturbed, we silencing circ_ADARB1 Nasopharyngeal Carcinoma Cell Line CNE2 and MTT experiment is carried out in HNE2, verifies the influence of its cell proliferation.Based on first to the 5th day testing result, relative to NC The growth rate of group, siRNA group cell obviously slows down, i.e. silencing circ_ADARB1 inhibits the proliferation of nasopharyngeal carcinoma cell.Pass through The verifying of positive and negative both direction, we can say that circ_ADARB1 has rush to the nasopharyngeal carcinoma cell proliferation under condition of in vitro culture Into effect.(result is shown in Fig. 8)

Embodiment 7: cell scratch healing migration experiment

(1) photo cell platform: the D-Hank ' s of 1000 μ l/10 μ l Tip, autoclave sterilization, ruler, 1000 μ l/10 μ l Liquid-transfering gun, marker etc., ultraviolet irradiation 30 minutes in super-clean bench are placed on after disinfecting in alcohol again；

(2) siRNA and NC group or transfected plasmids are transfected respectively to cell length to 50%~70% or so；

(3) 10 μ l pipette tips second day beginning scratch after cell covers with tiling board bottom: are compared into ruler perpendicular to 6 orifice plates bottom Portion simply quickly carries out cross or well stroke trace, not tilt, strength is consistent, to ensure scratch broadband as far as possible；

(4) it inhales and discards culture solution, gently washed with D-hanks 3 times, it is thin to wash off the fragment due to caused by scratch as far as possible Born of the same parents；

(5) 1640 culture mediums of 1% dual anti-2% fetal calf serum are added；

(6) scratch width beside cross at this time is photographed to record, 0h is denoted as；

(7) 6 orifice plates are put back into incubator culture, is spaced 12 hours and takes out, shoots the position of clapped picture when 0h, be denoted as 12h；

(8) same position is clapped again when being spaced for 24 hours, until scratch healing, arranges all pictures, and for statistical analysis.

The external migration for being overexpressed circ_ADARB1 and promoting nasopharyngeal carcinoma cell

After determining that ring-type circ_ADARB1 has facilitation to the proliferative capacity of nasopharyngeal carcinoma cell, we are again in nasopharynx Scratch experiment is carried out in cancerous cell line, to verify circ_3480 to the migration of Nasopharyngeal Carcinoma Cell Line either with or without influence.Utilize rouge Endotoxin-free plasmid pcDNA3.1 and pcDNA3.1/has_circ_ADARB1 are crossed table by plastid method lipofectamine 3000 Up to carrier transient transfection nasopharyngeal carcinoma cell CNE2 and HNE2, continue to cultivate to after 48 hours.Cell is collected, it is fixed using real-time fluorescence Measure the expression and cyclization efficiency of PCR technology detection circ_ADARB1.Circ_ADARB1 overexpression plasmid is being determined After being overexpressed good result, we have carried out cell scratch Healing Experiments in Nasopharyngeal Carcinoma Cell Line CNE2 and HNE2.Scratch healing Test multiple time points (CNE2 0h, 12h, for 24 hours in these cells；HNE2 is 0h, 12h, for 24 hours) confirm: relative to Unloaded pcDNA3.1 (+) plasmid group, the transfer ability that pcDNA3.1/circ_ADARB1 is overexpressed plasmid group cell are remarkably reinforced. Scratch width differs greatly, and has statistical significance.The above results show that being overexpressed circ_ in Nasopharyngeal Carcinoma Cell Line The expression of ADARB1 can promote the transfer ability of nasopharyngeal carcinoma cell CNE2 and HNE2 in vitro.(result see Fig. 9,10,11)

External silencing circ_ADARB1 inhibits the migration of nasopharyngeal carcinoma cell

SiRNA and NC is transiently transfected into the silencing circ_ into CNE2 and HNE2 cell line using Hiperfect reagent The expression of ADARB1.Continue to cultivate 48 hours collection cells after transfection, detects circ_ using Real-Time Fluorescent Quantitative PCR Technique The expression of ADARB1 is to detect the transfection efficiency of siRNA.The results show that siRNA has good silencing efficiency.True Protect after circ_ADARB1 is disturbed, we in the Nasopharyngeal Carcinoma Cell Line CNE2 and HNE2 of silencing circ_ADARB1 into Row scratch experiment verifies its influence to cell migration.Multiple time points of the scratch Healing Experiments in these cells, (CNE2 was 0h,12h,24h；HNE2 is 0h, 12h, for 24 hours) confirm: relative to NC group, the transfer ability of siRNA group cell obviously weakens. Scratch width difference is obvious, and has statistical significance.The above results show that circ_ADARB1 in silencing Nasopharyngeal Carcinoma Cell Line Expression, be able to suppress the transfer ability of nasopharyngeal carcinoma cell CNE2 and HNE2 in vitro.Being verified by positive and negative both direction proves, Circ_ADARB1 can promote the migration of nasopharyngeal carcinoma cell.(the result is shown in Figure 1 2,13,14)

Embodiment 8: cell transwell Matrigel

(1) matrigel prepares: mentioning the previous day is placed in 4 DEG C of refrigerators in -20 DEG C of BDMatrigel glue and is melted into liquid freezing Tip head, the EP pipe of releasing glue are placed in -20 DEG C overnight by state, and Matrigel glue will not mistake when spreading glue when operation in such second day Fast solidification；

(2) matrigel dilutes: BDMatrigel glue: anteserum-less substrate=1:8, i.e. 20 μ l matrigels add 160 μ l 1640 to train Base featheriness mixes；

(3) 100 μ l of the cell transwell is added in the matrigel diluted, then 80 μ l is sucked out along side, successively completed and be put into It is incubated for 2-3 hours in 37 DEG C of incubators, when it is white for seeing paving glue-line, shows that liquid Matrigel glue has been in solid-state；

(4) experimental cell after digestion transfection is washed 2 times with anteserum-less substrate, then outstanding thin using the training base weight of serum-free Born of the same parents, carry out cell count, and adjustment cell concentration is 2,0000 cell in every 200 μ l；

(5) 1640 culture mediums that 800 μ l contain 20%FBS are added to bottom chamber, tilts 24 orifice plates when being put into cell 45° angle generates bubble to avoid being put into during cell between cell and liquid level；

(6) every room adds indoor on the unified cell suspension to transwell counted of 200 μ l, and 24 orifice plates are put back to 37 DEG C In incubator, according to cell state and cell invasion speed, it is incubated for about 24~48 hours.

(7) 24 orifice plates are taken out, are washed twice with PBS or D-hanks, 4% paraformaldehyde embathes 10 minutes, washes 3 with clear water Time.

(8) it dyeing: being added drop-wise to the bottom of the cell transwell with 0.1% crystal violet, 5-10min is placed in room temperature peace and quiet, It is cleaned 2-3 times with PBS, the matrigel above cell is carefully wiped with cotton swab；

(9) it is added in 800 μ l, transwell upper chamber of distilled water in 24 orifice plates and about 200 μ l of distilled water is added, then existed It under inverted microscope, is observed, the different visuals field are taken pictures, and count with image J software aobvious with statistical analysis difference Work property.

The external invasion for being overexpressed circ_ADARB1 and promoting nasopharyngeal carcinoma cell

We have carried out the experiment of the cell Transwell matrigel invasion in Nasopharyngeal Carcinoma Cell Line CNE2 and HNE2, with observation It is overexpressed influence of the circ_ADARB1 to cell invasion ability.We are also with liposome method lipofectamine 3000 Endotoxin-free plasmid pcDNA3.1 and pcDNA3.1/circ_ADARB1 over-express vector is transiently transfected nasopharyngeal carcinoma cell CNE2 And HNE2, continue to cultivate to after 48 hours.Cell is collected, the table of Real-Time Fluorescent Quantitative PCR Technique detection circ_ADARB1 is utilized Up to horizontal and cyclic efficiency.After being determined that circ_ADARB1 is overexpressed the overexpression good result of plasmid, we connect cell For kind into the cell Transwell of paving matrigel, the number that discovery is overexpressed cell invasion to the small chamber lower surface of plasmid group is bright It is aobvious more than zero load group, and the trend of two plants of cell line results is consistent.Random shooting 3 opens photo and records cell number, Mei Yixi There is notable difference in born of the same parents system between two group data, and there is statistical significance.The above result shows that being overexpressed nasopharyngeal carcinoma cell The expression of circ_ADARB1 in system can promote the invasive ability of nasopharyngeal carcinoma cell CNE2 and HNE2 in vitro.(result is shown in figure 15,16,17)

The expression of external silencing circ_ADARB1 influences the invasion of nasopharyngeal carcinoma

Phenotype brought by overexpression circ_ADARB1 whether can be reversed to change in order to probe into after silencing circ_ADARB1 Become, we have carried out the experiment of the cell Transwell matrigel invasion in two plants of cell lines again, will using Hiperfect reagent Circ_ADARB1 siRNA and NC transiently transfect the expression of the silencing circ_ADARB1 into CNE2 and HNE2 cell line.After transfection Continue to cultivate 48 hours collection cells, using the expression of Real-Time Fluorescent Quantitative PCR Technique detection circ_ADARB1 to detect The transfection efficiency of siRNA.The results show that circ_ADARB1 siRNA has good silencing efficiency.Ensuring circ_ After ADARB1 is disturbed, we carry out in the Nasopharyngeal Carcinoma Cell Line CNE2 and HNE2 of silencing circ_ADARB1 The cell Transwell matrigel invasion experiment, the results show that siRNA group can swell what the small chamber lower surface of Transwell be observed Oncocyte number is considerably less than NC group, and the trend of two plants of cell line results is consistent.Random shooting 3 opens photo and records cell number Mesh has notable difference in each cell line, and has statistical significance between two group data.The above result shows that silencing nose The expression of circ_ADARB1 in pharynx cancer cell line is able to suppress the invasive ability of nasopharyngeal carcinoma cell CNE2 and HNE2 in vitro. Proved by positive and negative both direction, circular rna circ_ADARB1 can promote nasopharyngeal carcinoma cell invasion (the result is shown in Figure 18, 19,20)。

Sequence table

<110>Central South University

<120>circ_ADARB1 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 290

<212> RNA

<213>homo sapiens (Homo sapiens)

<400> 1

aaauugaaau ggccaaugag cacacccuca uucauccagc gagcauugag gacccccuag 60

aggccaggcc caugagugau gaagaucccg aggaugaaga cgccuugcca gccagagugg 120

agccuuucag gcuggcaugg agagcuuaag gggcaacuga aggagacaca cuggccaagc 180

gcggaguucu gcuuacuuca guccugcuga gauacucucu caguccgcuc gcaccgaagg 240

aagcugccuu gggaucagag cagacauaaa gcuagaaaaa uuucaagaug 290

<210> 2

<211> 20

<212> DNA

<213>unknown (Unknown)

<400> 2

tcaccaactg ggacgacatg 20

<210> 3

<211> 21

<212> DNA

<213>unknown (Unknown)

<400> 3

gtcaccggag tccatcacga t 21

<210> 4

<211> 20

<212> DNA

<213>unknown (Unknown)

<400> 4

accctcattc atccagcgag 20

<210> 5

<211> 20

<212> DNA

<213>unknown (Unknown)

<400> 5

gccagtgtgt ctccttcagt 20

<210> 6

<211> 27

<212> DNA

<213>unknown (Unknown)

<400> 6

ccatcgatag tggagccttt caggctg 27

<210> 7

<211> 24

<212> DNA

<213>unknown (Unknown)

<400> 7

tccccgcggc tggctggcaa ggcg 24

<210> 8

<211> 21

<212> RNA

<213>unknown (Unknown)

<400> 8

gccagagugg agccuuucau u 21

<210> 9

<211> 21

<212> RNA

<213>unknown (Unknown)

<400> 9

ugaaaggcuc cacucuggcu u 21

<210> 10

<211> 21

<212> RNA

<213>unknown (Unknown)

<400> 10

uucuccgaac gugucacguu u 21

<210> 11

<211> 21

<212> RNA

<213>unknown (Unknown)

<400> 11

acgugacacg uucggagaau u 21

Claims (8)

1. inhibiting application of the reagent of circular rna circ_ADARB1 expression in preparation treatment nasopharyngeal carcinoma preparation, the ring Shape RNA circ_ADARB1 sequence is as shown in SEQ ID NO.1.

2. application according to claim 1, which is characterized in that described inhibits circular rna circ_ADARB1 to express Reagent includes siRNA.

3. application according to claim 2, which is characterized in that the siRNA is as follows:

Positive-sense strand (5'-3') GCCAGAGUGGAGCCUUUCAUU

Antisense strand (5'-3') UGAAAGGCUCCACUCUGGCUU.

4. application according to claim 2, which is characterized in that the reagent of the inhibition circ_ADARB1 expression also wraps Include negative control:

Positive-sense strand (5'-3') UUCUCCGAACGUGUCACGUUU

Antisense strand (5'-3') ACGUGACACGUUCGGAGAAUU.

5. a kind of preparation for treating nasopharyngeal carcinoma, which is characterized in that the reagent including inhibiting circular rna circ_ADARB1 expression, The circular rna circ_ADARB1 sequence is as shown in SEQ ID NO.1.

6. the preparation for the treatment of nasopharyngeal carcinoma according to claim 5, which is characterized in that the inhibition circular rna circ_ The reagent of ADARB1 expression includes siRNA.

7. the preparation for the treatment of nasopharyngeal carcinoma according to claim 5, which is characterized in that the siRNA is as follows:

Positive-sense strand (5'-3') GCCAGAGUGGAGCCUUUCAUU

Antisense strand (5'-3') UGAAAGGCUCCACUCUGGCUU.

8. the preparation for the treatment of nasopharyngeal carcinoma according to claim 5, which is characterized in that the inhibition circ_ADARB1 table The reagent reached further includes negative control:

Positive-sense strand (5'-3') UUCUCCGAACGUGUCACGUUU

Antisense strand (5'-3') ACGUGACACGUUCGGAGAAUU.