CN109762823A - Circ_1892 and its preparing application in treatment of nasopharyngeal carcinoma preparation and treatment preparation - Google Patents
Circ_1892 and its preparing application in treatment of nasopharyngeal carcinoma preparation and treatment preparation Download PDFInfo
- Publication number
- CN109762823A CN109762823A CN201910160209.7A CN201910160209A CN109762823A CN 109762823 A CN109762823 A CN 109762823A CN 201910160209 A CN201910160209 A CN 201910160209A CN 109762823 A CN109762823 A CN 109762823A
- Authority
- CN
- China
- Prior art keywords
- circ
- nasopharyngeal carcinoma
- cell
- preparation
- circular rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention belongs to oncomolecularbiology technical fields, and in particular to circ_1892 and its prepare application in treatment of nasopharyngeal carcinoma preparation and treatment preparation.After the present invention ensures that circ_1892 is over-expressed by building over-express vector in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2, carry out the experiment of the cell Transwell and scratch Healing Experiments, relative to control group, the invasion of overexpression group cell obviously slow down with migration velocity;On the contrary, relative to control group, the invasion of cell are obviously accelerated with migration velocity after passing through the expression that RNA perturbation technique lowers circ_1892 in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2.That is circ_1892 can inhibit the invasion of nasopharyngeal carcinoma cell to migrate.Show that nasopharyngeal carcinoma diffusion transfer can be delayed by being overexpressed circ_1892, have far-reaching clinical meaning and important popularization and application foreground.
Description
Technical field
The invention belongs to oncomolecularbiology technical fields, and in particular to a kind of circular rna circ_1892 and mistake
The reagent for expressing circular rna circ_1892 is preparing the application in treatment of nasopharyngeal carcinoma preparation with it.
Background technique
Circular rna (Circular RNA) is a research hotspot at present, and circRNA is mainly derived from protein coding gene
Exon 1, can also be by including sub-district, the area UTR, intergenic region, non-coding RNA site and the antisense position of known transcript
Point is formed.CircRNA is reversely spliced to form by Pre-mRNA (precursor messenger RNA, pre-mRNA)
One kind does not have 5 ' end cap and 3 ' end poly (A) tails and the non-coding RNAs point that ring structure is formed with covalent bond
Son.
CircRNA forming process can be divided into two major classes, i.e. exon cyclisation is (exon circularization) and interior
Containing the big mechanism of subring (intron circularization) two.The circRNA in the proposition such as Jeck exon source
(exonic circRNA, ecircRNA) can be divided into lasso trick driving cyclisation (lariat-driven circularization)
Driving cyclisation (intron-pairing-driven circularization) two kinds of generation types, lasso trick are matched with introne
Driving cyclisation is exon 3 ' it holds as 5 ' end acceptor splicing site (splice of donor splicing site (splice donor) attack
Receptor), the area Alu covalent bond and form lasso structure, excision introne is formed after lasso structure carries out internal splicing
circRNA;Introne pairing driving cyclisation is after two introne base pair complementarities form cyclic structure, to wipe out introne shape
At circRNA.Introne itself can also be cyclized in fact, can form introne source circRNA (circular
intronic RNA,ciRNA).CircRNA be one kind for being reversely spliced to form by Pre-mRNA do not have 5 ' end cap and
The non-coding RNA molecule of 3 ' end poly (A) tails and the closed ring structure formed in the form of covalent bond.There is the steady of height
Qualitative, conservative, specificity, and the feature that content is high.
CircRNA most had found that subsequent Hsu MT et al. uses electron microscope skill for the first time early in 1976 in RNA virus
Art has found the presence of circRNA in the nephrocyte matter of monkey.In 1996, circRNA was found in human cell, at present
Until known circRNA number have reached more than 30,000.CircRNA is also no longer regarded as the rna transcription sheet of mistake, and
It is to rise up slowly as the dazzling star in non-coding RNA research.It was found that more novel circRNA are as diagnosing tumor and in advance
Biomarker and its application afterwards, and the protection that can be got well as early as possible in patent field can be obviously improved China in the technology
The international competitiveness in field.
Nasopharyngeal carcinoma (nasopharyngeal carcinoma, NPC) belongs to head and neck neoplasm, originates from pharynx nasalis epithelium group
It knits.It falls ill generally at the rear cornucopia of pharynx nasalis (Luo Senmiaole nest, Fossa of Rosenm ü ller), nasopharynx herein
Cancer cell easily invades neighbouring tissue and organ.Since the occurrence and development of nasopharyngeal carcinoma are the familial inheritance and body cell something lost by accumulating
Pass mutation and epigenetics be mutated caused by multistage complexity gene regulation process, be related to proto-oncogene and tumor suppressor gene
The epigenetic regulation etc. that activation and silencing and ncRNA are participated in.So the specific molecular mechanism of nasopharyngeal carcinoma occurrence and development is still
It is indefinite, and due to Tumor Heterogeneity and individual difference, the curative effect of traditional radiotherapy equipment system is not significant.Therefore pass through
CircRNA probes into itself and nasopharyngeal carcinoma occurrence and development mechanism, is further the diagnosis of nasopharyngeal carcinoma, and controls nasopharyngeal cardnoma proliferation, invades
Attacking and shifting will be the hot spot studied.
We detect the circ_1892 of a length 378bp.It is found by experiment that the hair of the circular rna and nasopharyngeal carcinoma
There is association in hair tonic exhibition, it is possible to as nasopharyngeal carcinoma diagnosis marker, and the target spot for the treatment of.
Summary of the invention
Present invention finds the circ_1892 of a size 378bp, and have found its existing pass between nasopharyngeal carcinoma
System, it is possible to the target spot as nasopharyngeal carcinoma diagnosis marker and treatment.
Primary and foremost purpose of the invention is to provide a kind of new circular rna circ_1892, sequence such as SEQ ID NO.1 institute
Show.
A second object of the present invention is to provide a kind of reagents for being overexpressed circular rna circ_1892 to treat nose in preparation
Application in pharynx cancer preparation, the circular rna circ_1892 sequence is as shown in SEQ ID NO.1.
Further, the reagent of the overexpression circular rna circ_1892 includes but is not limited to be overexpressed circular rna
The plasmid vector of circ_1892.
Further, the plasmid vector of the overexpression circular rna circ_1892 is preferably by pcDNA3.1 plasmid
Vector construction, but it is not limited to the plasmid vector.
Further, the preferred restriction enzyme site when plamid vector construction of the overexpression circular rna circ_1892
For Sacll and Clal, but it is not limited to the two restriction enzyme sites.
Further, the reagent of the overexpression circular rna circ_1892 further includes negative control, i.e., unloaded matter
Grain.
Third object of the present invention is to provide a kind of preparations for treating nasopharyngeal carcinoma, including are overexpressed circular rna circ_
1892 reagent, the circular rna circ_1892 sequence is as shown in SEQ ID NO.1.
Further, the reagent of the overexpression circular rna circ_1892 includes but is not limited to be overexpressed circular rna
The plasmid vector of circ_1892.
Further, the plasmid vector of the overexpression circular rna circ_1892 utilizes pcDNA3.1 plasmid vector
Building, but it is not limited to the plasmid vector.
Further, the restriction enzyme site when plamid vector construction of the overexpression circular rna circ_1892 is
Sacll and Clal, but it is not limited to the two restriction enzyme sites.
Further, the reagent of the overexpression circular rna circ_1892 further includes negative control, i.e., unloaded matter
Grain.
The present invention is not limited only to the over-express vector and negative control of above-mentioned offer.
Treatment of nasopharyngeal carcinoma preparation of the present invention further includes reagent needed for transfection over-express vector.
In order to probe into effect of the circ_1892 in tumor development, the present invention is according to the sequence construct of circ_1892
Over-express vector, using liposome method lipofectamine 3000 by over-express vector and it is unloaded transiently transfect to HONE1,
Circ_1892 is overexpressed in HNE2 and CNE2 cell line.Continue to cultivate 36 hours collection cells after transfection, utilizes real-time fluorescence
Quantitative PCR technique detects the expression of circ_1892 to detect the transfection efficiency of over-express vector, while detecting circ_
1892 expression finds that the over-express vector of design can significantly improve the expression of circ_1892.
The present invention confirms above-mentioned conclusion by largely testing: i.e. the reagent of overexpression circ_1892 can be used in preparing
Treatment of nasopharyngeal carcinoma preparation.These tests include: the external migration for being overexpressed circ_1892 and inhibiting nasopharyngeal carcinoma cell, external silencing
The migration of circ_1892 promotion nasopharyngeal carcinoma cell;External overexpression circ_1892 test discovery can inhibit nasopharyngeal carcinoma cell to invade
It attacks, external silencing circ_1892 then promotes the invasion of nasopharyngeal carcinoma cell.
Since over-express vector has good overexpression effect.After ensuring that circ_1892 is over-expressed, the present invention exists
It has been overexpressed in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 of circ_1892 and has carried out the experiment of the cell Transwell and scratch
Healing Experiments, relative to NC control group, the invasion migration velocity of overexpression group cell obviously slows down, i.e. overexpression circ_1892
The invasion of nasopharyngeal carcinoma cell are inhibited to migrate.Nasopharyngeal carcinoma diffusion transfer can be delayed by being overexpressed circ_1892, have far-reaching face
Bed meaning and important popularization and application foreground.
Detailed description of the invention
Fig. 1 is over-express vector map.
Fig. 2 is that qRT-PCR detects the circ_1892 overexpression effect in Nasopharyngeal Carcinoma Cell Line;
QRT-PCR detection circ_1892 in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 is overexpressed effect with β-
Actin is used as reference that pcDNA3.1 (+) group is standardized as P < 0.001 1, * * P < 0.01, * * *.
Fig. 3 is the silence efficiency that qRT-PCR technology detects circ_1892siRNA in Nasopharyngeal Carcinoma Cell Line;
The silence efficiency of qRT-PCR detection circ_1892siRNA in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2;
Circ_1892 expression is analyzed using β-actin as reference, and NC group is standardized as 1, * P < 0.05, * * P < 0.01, * * * P
<0.001。
Fig. 4 is that qRT-PCR detects circ_1892 overexpression efficiency in scratch experiment cell;
A-c. human nasopharyngeal epithelioma 1 HONE1, HNE2 and CNE2 used in scratch experiment is overexpressed efficiency and tests inspection with qRT-PCR
It surveys, circ_1892 expression is analyzed using β-actin as reference, pcDNA3.1 (+) group is standardized as P < 0.05 1, *,
**P<0.01,***P<0.001。
Fig. 5 is the influence for being overexpressed circ_1892 to nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 scratch Healing Experiments;
A-c. Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 transfect pcDNA3.1 (+) is unloaded, pcDNA3.1 (+)/
Circ_1892, the scratch after cell density reaches 100% were taken pictures in observation in the 0th, 12,24 hour.
Fig. 6 is nasopharyngeal carcinoma HONE1, HNE2 and CNE2 the cell scratch experiment statistical chart for being overexpressed circ_1892;
A-c. 6 perimetry scratch widths are randomly selected for every group, 0 hour scratch width is standardized as 1, is taken statistics
Figure;It is each to test in triplicate, using Student's t-test method statistic, P < 0.001 * P < 0.05, * * P < 0.01, * * *.
Fig. 7 is that qRT-PCR detects circ_1892 jamming effectiveness in scratch experiment cell;;
A-c. human nasopharyngeal epithelioma 1 HONE1, HNE2 and CNE2 jamming effectiveness used in scratch experiment is tested with qRT-PCR and is examined
It surveys, circ_1892 expression is analyzed using β-actin as reference, NC group is standardized as 1, * P < 0.05, P < 0.01 * *,
***P<0.001。
Fig. 8 is the influence for interfering circ_1892 to nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 scratch Healing Experiments;
A-c. nasopharyngeal carcinoma HONE1, HNE2 and CNE2 cell transfecting NC siRNA/circ_1892siRNA, to cell density
Scratch after reaching 100% was taken pictures in observation in the 0th, 12,24 hour.
Fig. 9 is nasopharyngeal carcinoma HONE1, HNE2 and CNE2 the cell scratch experiment statistical chart for interfering circ_1892;
A-c. 6 perimetry scratch widths are randomly selected for every group, 0 hour scratch width is standardized as 1, is taken statistics
Figure;It is each to test in triplicate, using Student's t-test method statistic, P < 0.001 * P < 0.05, * * P < 0.01, * * *.
Figure 10 is the overexpression efficiency that qRT-PCR detects circ_1892 in the experiment of the cell Transwell matrigel invasion;
The cell a-c.Transwell matrigel invasion is tested human nasopharyngeal epithelioma 1 HONE1, HNE2 and CNE2 used and is overexpressed
Efficiency is tested with qRT-PCR and is detected, and circ_1892 expression is analyzed using β-actin as reference, by pcDNA3.1 (+) group
It is standardized as 1, * P < 0.05, P < 0.001 * * P < 0.01, * * *.
Figure 11 is the influence for being overexpressed circ_1892 to Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 invasive ability;
HONE1, HNE2 and the CNE2 and respective cellular control unit for being overexpressed circ_1892 respectively are carried out
The experiment of the cell Transwell matrigel invasion.
Figure 12 is the cell the Transwell matrigel invasion experiment statistics figure for being overexpressed circ_1892;
Every group randomly selects 3 cell visuals field and carries out cell count, and take statistics figure;Each experiment in triplicate, uses
Student's t-test method statistic;Using β-actin as reference, pcDNA3.1 (+) group is standardized as P < 0.05 1, *,
**P<0.01,***P<0.001。
Figure 13 is the jamming effectiveness that qRT-PCR detects circ_1892 in the experiment of the cell Transwell matrigel invasion;
The cell a-c.Transwell matrigel invasion tests human nasopharyngeal epithelioma 1 HONE1, HNE2 and CNE2 interference effect used
Rate is tested with qRT-PCR and is detected, and circ_1892 expression is analyzed using β-actin as reference, and NC group is standardized as 1, *
P<0.05,**P<0.01,***P<0.001。
Figure 14 is the influence for interfering circ_1892 to Nasopharyngeal Carcinoma Cell Line HONE1 and HNE2 invasive ability;
HONE1, HNE2 and the CNE2 and respective cellular control unit for interfering circ_1892 respectively carry out Transwell
The experiment of cell matrigel invasion.
Figure 15 is the cell the Transwell matrigel invasion experiment statistics figure for interfering circ_1892;
Every group randomly selects 3 cell visuals field and carries out cell count, and take statistics figure;Each experiment in triplicate, uses
Student's t-test method statistic;Using β-actin as reference, NC group is standardized as 1, * P < 0.05, * * P <
0.01,***P<0.001。
Specific embodiment
It is intended to further illustrate the present invention below in conjunction with specific embodiment, is not intended to limit the present invention.
Tri- plants of Nasopharyngeal Carcinoma Cell Lines of HONE1, HNE2 and CNE2 are Tumour Inst., Zhongnan Univ.'s molecule used in the present invention
Genetic laboratory is saved.Cell culture condition are as follows: containing 10% fetal calf serum (FBS) and 1% dual anti-(penicillin, streptomysin)
RPMI1640 fluid nutrient medium, 37 DEG C, 95% humidity, 5%CO2Adherent growth in the constant incubator of concentration.
The over-express vector of circular rna of the present invention is the sequence design according to circRNA, by circ_1892 full length sequence
The online web analytics of NEB cutter 2.0 are put into, display Sacll and Clal restriction enzyme site is in circ_1892 full length sequence
The site being not present, at the same it is single existing in pcDNA3.1 plasmid vector (being purchased from Sheng Gong bioengineering limited liability company)
DNA restriction enzyme.The over-express vector constructed accordingly.
(1)β-actin
Upstream primer: 5 '-TCACCAACTGGGACGACATG-3 ', as shown in SEQ ID NO.2,
Downstream primer: 5 '-GTCACCGGAGTCCATCACGAT-3 ', as shown in SEQ ID NO.3,
(2) circular rna circ_1892 real-time quantitative PCR primer
Upstream primer: 5 '-TTCTCAAATTGCAGCAGGAG-3 ', as shown in SEQ ID NO.4,
Downstream primer: 5 '-CACCAATTTCTGGAGGGTACA-3 ', as shown in SEQ ID NO.5,
(3) circ_1892 overall length primer is expanded
Upstream primer: 5 '-CCCATCGATAATAATTGTGTGCCCAAGAAGAT-3 ', as shown in SEQ ID NO.6,
Downstream primer: 5 '-TCCCCGCGGCCATTCACCATTATCCAGAATTTTC-3 ', as shown in SEQ ID NO.7,
Test result of the present invention is all made of statistical analysis: t, which is examined, to be used to evaluate the difference between two groups.P < 0.05 is used for
Indicate significance,statistical, all p values use two-sided test.Statistical analysis is soft using SPSS 13.0 and Graphpad 5.0
Part carries out.
Embodiment 1: circ_1892 is overexpressed effect detection in Nasopharyngeal Carcinoma Cell Line
We select restriction enzyme site first, and circ_1892 full length sequence is put into the online website NEB cutter 2.0 point
Analysis, display Sacll and Clal restriction enzyme site is the site being not present in circ_1892 full length sequence, while in pcDNA3.1 matter
Single existing DNA restriction enzyme in grain carrier (being purchased from Sheng Gong bioengineering limited liability company).Table was constructed accordingly
Up to carrier.
In order to detect the cyclic efficiency of circ_1892, we are by the pcDNA3.1/circ_1892 eukaryon mistake of building first
Expression vector is expressed in nasopharyngeal carcinoma cell.Good third and fourth generation nasopharyngeal carcinoma cell HONE1, the HNE2 of upgrowth situation
With CNE2 kind into 12 orifice plates, when cell fusion degree reaches 60%-80%, with liposome method lipofectamine 3000
Endotoxin-free plasmid pcDNA3.1 empty carrier and pcDNA3.1/circ_1892 over-express vector are transiently transfected nasopharyngeal carcinoma cell
HONE1, HNE2 and CNE2 continue to cultivate to after 48 hours.Cell is collected, detects circ_ using Real-Time Fluorescent Quantitative PCR Technique
1892 expression and cyclic efficiency.QPCR turns pcDNA3.1/ the results show that compared with pcDNA3.1 empty plasmid group cell
Circ_1892 is overexpressed the expression of circ_1892 in the cell of plasmid group and significantly increases, and in HONE1, HNE2 and
Its in CNE2 cell line expresses multiple at 50 times or more, sees Fig. 2, as a result has statistical significance.
Embodiment 2: the effect detection that silencing circ_1892 is expressed in Nasopharyngeal Carcinoma Cell Line
The siRNA sequence of circ_1892 is devised according to splicing site, siRNA is that a kind of length is 21-25 nucleosides
Acid complementary with cognate rna can combine, selective degradation purpose RNA, thus the double stranded rna molecule for inhibiting it to express.Currently,
SiRNA has evolved into the important tool of gene functional research.In order to probe into work of the circ_1892 in tumor development
With we devise siRNA according to the splicing site of circ_1892, using Hiperfect reagent by siRNA (sequence is seen below)
The expression of the silencing circ_1892 into HONE1, HNE2 and CNE2 cell line is transiently transfected with siNC (sequence is seen below).After transfection
Continue to cultivate 48 hours collection cells, using the expression of Real-Time Fluorescent Quantitative PCR Technique detection circ_1892 to detect
The transfection efficiency of siRNA, confirmation transfect the expression of the circ_1892 after siRNA lower than circ_1892 after transfection siNC
The 60% of expression.As a result see Fig. 3.
SiRNA used is as follows:
Positive-sense strand (5'-3') GAUAAUGGUGAAUGGAAUAUU, as shown in SEQ ID NO.8,
Antisense strand (5'-3') UAUUCCAUUCACCAUUAUCUU, as shown in SEQ ID NO.9,
Negative control (siNC):
Positive-sense strand (5'-3') UUCUCCGAACGUGUCACGUUU, as shown in SEQ ID NO.10,
Antisense strand (5'-3') ACGUGACACGUUCGGAGAAUU, as shown in SEQ ID NO.11.
Embodiment 3: the healing migration experiment of cell scratch:
(1) photo cell platform: the D-Hank ' s of 1000 μ l/10 μ l Tip, autoclave sterilization, ruler, 1000 μ l/10 μ l
Liquid-transfering gun, marker etc., ultraviolet irradiation 30 minutes in super-clean bench are placed on after disinfecting in alcohol again;
(2) siRNA and NC group or transfected plasmids are transfected respectively to cell length to 50%~70% or so;
(3) 10 μ l pipette tips second day beginning scratch after cell covers with tiling board bottom: are compared into ruler perpendicular to 6 orifice plates bottom
Portion simply quickly carries out cross or well stroke trace, not tilt, strength is consistent, to ensure scratch width as far as possible;
(4) it inhales and abandons culture solution, gently washed with D-hanks 3 times, wash off the patched cell due to caused by scratch as far as possible;
(5) 1640 culture mediums of 1% dual anti-2% fetal calf serum are added;
(6) scratch width beside cross at this time is photographed to record, 0h is denoted as;
(7) 6 orifice plates are put back into incubator culture, is spaced 12 hours and takes out, shoots the position of clapped picture when 0h, be denoted as
12h;
(8) same position is clapped again when being spaced for 24 hours, until scratch healing, arranges all pictures, and for statistical analysis.
The external migration for being overexpressed circ_1892 and inhibiting nasopharyngeal carcinoma cell
After determining that circular rna circ_1892 has inhibiting effect to the proliferative capacity of nasopharyngeal carcinoma cell, we are again in nasopharynx
Scratch experiment is carried out in cancerous cell line, to verify circ_1892 to the migration of Nasopharyngeal Carcinoma Cell Line either with or without influence.Utilize rouge
Plastid method lipofectamine 3000 is overexpressed endotoxin-free plasmid pcDNA3.1 and pcDNA3.1/has_circ_1892
Carrier transient transfection nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 continue to cultivate to after 48 hours.Collect cell, using in real time it is glimmering
Fluorescent Quantitative PCR technology detects the expression and cyclization efficiency of circ_1892.Circ_1892 overexpression plasmid is being determined
After being overexpressed good result, we have carried out cell scratch Healing Experiments in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2.It draws
Multiple time points (HONE1 0h, 12h, for 24 hours of the trace Healing Experiments in these cells;HNE2 is 0h, 12h, for 24 hours;CNE2 is
0h, 12h, for 24 hours) confirm: relative to unloaded pcDNA3.1 (+) plasmid group, pcDNA3.1/circ_1892 is overexpressed plasmid group
The transfer ability of cell is substantially reduced.Scratch width differs greatly, and has statistical significance.The above results show that being overexpressed
The expression of circ_1892 in Nasopharyngeal Carcinoma Cell Line is able to suppress the migration of nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 in vitro
Ability.(result see Fig. 4,5,6)
External silencing circ_1892 promotes the migration of nasopharyngeal carcinoma cell
SiRNA and NC is transiently transfected into the silencing into HONE1, HNE2 and CNE2 cell line using Hiperfect reagent
The expression of circ_1892.Continue to cultivate 48 hours collection cells after transfection, be detected using Real-Time Fluorescent Quantitative PCR Technique
The expression of circ_1892 is to detect the transfection efficiency of siRNA.The results show that siRNA has good silencing efficiency.?
After ensuring that circ_1892 is disturbed, we are Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 in silencing circ_1892
Middle carry out scratch experiment, verifies its influence to cell migration.Multiple time points of the scratch Healing Experiments in these cells
(HONE1 0h, 12h, for 24 hours;HNE2 is 0h, 12h, for 24 hours;CNE2 is 0h, 12h, for 24 hours) confirm: relative to NC group, siRNA
The transfer ability of group cell is remarkably reinforced.Scratch width difference is obvious, and has statistical significance.The above results show that silencing
The expression of circ_1892 in Nasopharyngeal Carcinoma Cell Line can promote the migration of nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 in vitro
Ability.Being verified by positive and negative both direction proves, circ_1892 can inhibit the migration of nasopharyngeal carcinoma cell.(result is shown in Fig. 7,8,
9)
Embodiment 4: cell transwell Matrigel:
(1) matrigel prepares: mentioning the previous day is placed in 4 DEG C of refrigerators in -20 DEG C of BDMatrigel glue and is melted into liquid freezing
Tip head, the EP pipe of releasing glue are placed in -20 DEG C overnight by state, and Matrigel glue will not mistake when spreading glue when operation in such second day
Fast solidification;
(2) matrigel dilutes: BDMatrigel glue: anteserum-less substrate=1:8, i.e. 20 μ l matrigels add 160 μ l 1640 to train
Base featheriness mixes;
(3) 100 μ l of the cell transwell is added in the matrigel diluted, then 80 μ l is sucked out along side, successively completed and be put into
It is incubated for 2-3 hours in 37 DEG C of incubators, when it is white for seeing paving glue-line, shows that liquid Matrigel glue has been in solid-state;
(4) experimental cell after digestion transfection is washed 2 times with anteserum-less substrate, then outstanding thin using the training base weight of serum-free
Born of the same parents, carry out cell count, and adjustment cell concentration is 20000 cells in every 200 μ l;
(5) 1640 culture mediums that 800 μ l contain 20%FBS are added to bottom chamber, tilts 24 orifice plates when being put into cell
45° angle generates bubble to avoid being put into during cell between cell and liquid level;
(6) every room adds indoor on the unified cell suspension to transwell counted of 200 μ l, and 24 orifice plates are put back to 37 DEG C
In incubator, according to cell state and cell invasion speed, it is incubated for about 24~48 hours.
(7) 24 orifice plates are taken out, are washed twice with PBS or D-hanks, 4% paraformaldehyde embathes 10 minutes, washes 3 with clear water
Time.
(8) it dyeing: being added drop-wise to the bottom of the cell transwell with 0.1% crystal violet, 5-10min is placed in room temperature peace and quiet,
It is cleaned 2-3 times with PBS, the matrigel above cell is carefully wiped with cotton swab;
(9) it is added in 800 μ l, transwell upper chamber of distilled water in 24 orifice plates and about 200 μ l of distilled water is added, then existed
It under inverted microscope, is observed, the different visuals field are taken pictures, and count with image J software aobvious with statistical analysis difference
Work property.
The external invasion for being overexpressed circ_1892 and inhibiting nasopharyngeal carcinoma cell
We have carried out the experiment of the cell Transwell matrigel invasion in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2,
To observe the influence for being overexpressed circ_1892 to cell invasion ability.We are also with liposome method lipofectamine
3000 endotoxin-free plasmid pcDNA3.1 and pcDNA3.1/circ_1892 over-express vectors transiently transfect nasopharyngeal carcinoma cell
HONE1, HNE2 and CNE2 continue to cultivate to after 48 hours.Cell is collected, detects circ_ using Real-Time Fluorescent Quantitative PCR Technique
1892 expression and cyclic efficiency.After being determined that circ_1892 is overexpressed the overexpression good result of plasmid, we will
For cell inoculation into the cell Transwell of paving matrigel, discovery is overexpressed the cell invasion of plasmid group to small chamber lower surface
Number is obviously fewer than zero load group, and the trend of three plants of cell line results is consistent.Random shooting 3 opens photo and records cell number,
There is notable difference in each cell line between two group data, and there is statistical significance.The above result shows that being overexpressed nasopharynx
The expression of circ_1892 in cancerous cell line is able to suppress the invasion energy of nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 in vitro
Power.(the result is shown in Figure 1 0,11,12)
The expression of external silencing circ_1892 influences the invasion of nasopharyngeal carcinoma
It is overexpressed phenotypic alternation brought by circ_1892 in order to probe into after silencing circ_1892 whether to reverse, I
Matrigel invasion experiment in the cell Transwell has been carried out in three plants of cell lines again, using Hiperfect reagent by circ_
1892siRNA and NC transiently transfects the expression of the silencing circ_1892 into HONE1, HNE2 and CNE2 cell line.It transfects subsequent
48 hours collection cells of continuous culture, using the expression of Real-Time Fluorescent Quantitative PCR Technique detection circ_1892 to detect
The transfection efficiency of siRNA.The results show that circ_1892siRNA has good silencing efficiency.Ensuring circ_1892 quilt
After interference is fallen, it is small that we carry out Transwell in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 of silencing circ_1892
Room matrigel invasion experiment, the results show that siRNA group can be in the tumor cell number that the small chamber lower surface of Transwell is observed
Significantly more than NC group, and the trend of three plants of cell line results is consistent.Random shooting 6 opens photo and records cell number, Mei Yixi
There is notable difference in born of the same parents system between two group data, and there is statistical significance.The above result shows that silencing Nasopharyngeal Carcinoma Cell Line
The expression of middle circ_1892 can promote the invasive ability of nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 in vitro.By just
Anti- both direction proves that circular rna circ_1892 is able to suppress the invasion of nasopharyngeal carcinoma cell.(the result is shown in Figure 1 3,14,15).
Sequence table
<110>Central South University
<120>circ_1892 and its application in treatment of nasopharyngeal carcinoma preparation and treatment preparation are being prepared
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 378
<212> RNA
<213>homo sapiens (Homo sapiens)
<400> 1
cuuuggucug ggucggccuc uaccuuugca cuuccuucgg agagcaucua agauuggaga 60
gguugauguc gagcaacaua cuuuggccaa auaccugaug gaacuaacua uguuggacua 120
ugacauggug cacuuuccuc cuucucaaau ugcagcagga gcuuuuugcu uagcacugaa 180
aauucuggau aauggugaau ggaauaauug ugugcccaag aagaugcugc agcugguugg 240
ugucacugcc auguuuauug caagcaaaua ugaagaaaug uacccuccag aaauugguga 300
cuuugcuuuu gugacugaca acacuuauac uaagcaccaa aucagacaga uggaaaugaa 360
gauucuaaga gcuuuaaa 378
<210> 2
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 2
tcaccaactg ggacgacatg 20
<210> 3
<211> 21
<212> DNA
<213>unknown (Unknown)
<400> 3
gtcaccggag tccatcacga t 21
<210> 4
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 4
ttctcaaatt gcagcaggag 20
<210> 5
<211> 21
<212> DNA
<213>unknown (Unknown)
<400> 5
caccaatttc tggagggtac a 21
<210> 6
<211> 32
<212> DNA
<213>unknown (Unknown)
<400> 6
cccatcgata ataattgtgt gcccaagaag at 32
<210> 7
<211> 34
<212> DNA
<213>unknown (Unknown)
<400> 7
tccccgcggc cattcaccat tatccagaat tttc 34
<210> 8
<211> 21
<212> RNA
<213>unknown (Unknown)
<400> 8
gauaauggug aauggaauau u 21
<210> 9
<211> 21
<212> RNA
<213>unknown (Unknown)
<400> 9
uauuccauuc accauuaucu u 21
<210> 10
<211> 21
<212> RNA
<213>unknown (Unknown)
<400> 10
uucuccgaac gugucacguu u 21
<210> 11
<211> 21
<212> RNA
<213>unknown (Unknown)
<400> 11
acgugacacg uucggagaau u 21
Claims (10)
1. a kind of circular rna circ_1892, sequence is as shown in SEQ ID NO.1.
2. being overexpressed application of the reagent of circular rna circ_1892 in preparation treatment nasopharyngeal carcinoma preparation, the circular rna
Circ_1892 sequence is as shown in SEQ ID NO.1.
3. application according to claim 2, which is characterized in that the reagent of the overexpression circular rna circ_1892
Plasmid vector including being overexpressed circular rna circ_1892.
4. application according to claim 3, which is characterized in that the plasmid of the overexpression circular rna circ_1892
Carrier utilizes pcDNA3.1 plamid vector construction.
5. application according to claim 3, which is characterized in that the plasmid of the overexpression circular rna circ_1892
Restriction enzyme site when vector construction is Sacll and Clal.
6. a kind of preparation for treating nasopharyngeal carcinoma, which is characterized in that the reagent including being overexpressed circular rna circ_1892, it is described
Circular rna circ_1892 sequence as shown in SEQ ID NO.1.
7. the preparation for the treatment of nasopharyngeal carcinoma according to claim 6, which is characterized in that the overexpression circular rna
The reagent of circ_1892 includes the plasmid vector for being overexpressed circular rna circ_1892.
8. the preparation for the treatment of nasopharyngeal carcinoma according to claim 7, which is characterized in that the overexpression circular rna
The plasmid vector of circ_1892 utilizes pcDNA3.1 plamid vector construction.
9. the preparation for the treatment of nasopharyngeal carcinoma according to claim 7, which is characterized in that the overexpression circular rna
The restriction enzyme site when plamid vector construction of circ_1892 is Sacll and Clal.
10. the preparation for the treatment of nasopharyngeal carcinoma according to claim 7, which is characterized in that the overexpression circular rna
The reagent of circ_1892 further includes negative control, i.e. empty plasmid.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910160209.7A CN109762823B (en) | 2019-03-04 | 2019-03-04 | circ _1892, application thereof in preparation of nasopharyngeal carcinoma treatment preparation and treatment preparation |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910160209.7A CN109762823B (en) | 2019-03-04 | 2019-03-04 | circ _1892, application thereof in preparation of nasopharyngeal carcinoma treatment preparation and treatment preparation |
Publications (2)
Publication Number | Publication Date |
---|---|
CN109762823A true CN109762823A (en) | 2019-05-17 |
CN109762823B CN109762823B (en) | 2020-05-22 |
Family
ID=66457597
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910160209.7A Active CN109762823B (en) | 2019-03-04 | 2019-03-04 | circ _1892, application thereof in preparation of nasopharyngeal carcinoma treatment preparation and treatment preparation |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN109762823B (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108186665A (en) * | 2018-01-02 | 2018-06-22 | 深圳市第二人民医院 | Interfere application of the reagent of long-chain non-coding RNA PVT1 expression in nasopharyngeal carcinoma auxiliary treatment preparation is prepared |
CN108721319A (en) * | 2018-05-28 | 2018-11-02 | 中南大学 | Inhibit application and preparation of the reagent of circ_CLASP2 in preparing treatment of nasopharyngeal carcinoma preparation |
-
2019
- 2019-03-04 CN CN201910160209.7A patent/CN109762823B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108186665A (en) * | 2018-01-02 | 2018-06-22 | 深圳市第二人民医院 | Interfere application of the reagent of long-chain non-coding RNA PVT1 expression in nasopharyngeal carcinoma auxiliary treatment preparation is prepared |
CN108721319A (en) * | 2018-05-28 | 2018-11-02 | 中南大学 | Inhibit application and preparation of the reagent of circ_CLASP2 in preparing treatment of nasopharyngeal carcinoma preparation |
Non-Patent Citations (1)
Title |
---|
NM_0031966: "has_circ_0001495", 《CIRCBASE》 * |
Also Published As
Publication number | Publication date |
---|---|
CN109762823B (en) | 2020-05-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Yan et al. | The umbilical cord mesenchymal stem cell‐derived exosomal lncRNA H19 improves osteochondral activity through miR‐29b‐3p/FoxO3 axis | |
CN108721319A (en) | Inhibit application and preparation of the reagent of circ_CLASP2 in preparing treatment of nasopharyngeal carcinoma preparation | |
Yang et al. | CircRNA_100876 promote proliferation and metastasis of breast cancer cells through adsorbing microRNA-361-3p in a sponge form. | |
CN108660214A (en) | Detect application and kit of the reagent of circ_CLASP2 in preparing nasopharyngeal carcinoma diagnosis preparation | |
CN110066875B (en) | Application of long-chain non-coding RNA lncLCIR-1 as lung cancer molecular marker | |
CN109666674A (en) | CircCDYL2 and its preparing application and diagnostic preparation in nasopharyngeal carcinoma diagnosis preparation | |
CN109762823A (en) | Circ_1892 and its preparing application in treatment of nasopharyngeal carcinoma preparation and treatment preparation | |
CN109971760A (en) | Circ_3234 and its preparing application in treatment of nasopharyngeal carcinoma preparation and treatment preparation | |
CN114032236B (en) | shRNA of TMEM2 and application thereof | |
CN110577952B (en) | Application of siRNA interfering long non-coding RNA in preparation of medicine for treating breast cancer | |
CN109758472A (en) | Circ_2157 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation | |
CN110157736B (en) | Method for promoting goat hair follicle stem cell proliferation | |
CN109847064A (en) | Circ_3480 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation | |
CN109762818A (en) | Circ_2157 and its preparing application and diagnostic reagent in nasopharyngeal carcinoma diagnosis preparation | |
CN109852692A (en) | Circ_3480 and its preparing application and diagnostic reagent in nasopharyngeal carcinoma diagnosis preparation | |
CN109908351A (en) | Circ_ADARB1 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation | |
CN109971759A (en) | Circ_ADARB1 and its preparing application and diagnostic preparation in nasopharyngeal carcinoma diagnosis preparation | |
CN109701025A (en) | CircCDYL2 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation | |
CN104911183A (en) | Transcription template of shRNA for inhibiting expression of pancreatic cancer TAK1 gene | |
CN109700825A (en) | CircARHGAP12 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation | |
CN117568476B (en) | Colorectal cancer diagnosis, metastasis prediction and immunotherapy prognosis evaluation circRNA marker and therapeutic drug | |
CN115786515B (en) | Application of PDPN in HER2 positive gastric cancer diagnosis and treatment of lapatinib resistance | |
CN109652556A (en) | CircARHGAP12 and its preparing application and diagnostic preparation in nasopharyngeal carcinoma diagnosis preparation | |
CN104342440A (en) | CDKL1 gene, siRNA thereof, and applications of gene and siRNA | |
CN116637123B (en) | Application of reagent for knocking down or down expression of C15orf39 gene in preparation of medicines for treating gastric cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |