CN108186665A - Interfere application of the reagent of long-chain non-coding RNA PVT1 expression in nasopharyngeal carcinoma auxiliary treatment preparation is prepared - Google Patents
Interfere application of the reagent of long-chain non-coding RNA PVT1 expression in nasopharyngeal carcinoma auxiliary treatment preparation is prepared Download PDFInfo
- Publication number
- CN108186665A CN108186665A CN201810003154.4A CN201810003154A CN108186665A CN 108186665 A CN108186665 A CN 108186665A CN 201810003154 A CN201810003154 A CN 201810003154A CN 108186665 A CN108186665 A CN 108186665A
- Authority
- CN
- China
- Prior art keywords
- shrna
- pvt1
- expression
- nasopharyngeal carcinoma
- silicon particles
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Pathology (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Hospice & Palliative Care (AREA)
- Pharmacology & Pharmacy (AREA)
- Oncology (AREA)
- Epidemiology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of applications for interfering the reagent of long-chain non-coding RNA PVT1 expression in nasopharyngeal carcinoma auxiliary treatment preparation is prepared.The present invention is transferred to the interference carrier of targeting PVT1 in Nasopharyngeal Carcinoma Cell Line CNE2 and 5 8F, after the expression for inhibiting PVT1, apoptotic cell ratio significantly increases, and illustrates the reagent of long-chain non-coding RNA PVT1 expression is interfered to can be used in nasopharyngeal carcinoma auxiliary treatment, has significant clinical treatment meaning.
Description
Technical field
The invention belongs to oncomolecularbiology fields, and in particular to the reagent of interference long-chain non-coding RNA PVT1 expression
Application process in nasopharyngeal carcinoma auxiliary treatment preparation is prepared.
Background technology
The Human Genome Project and its subsequent DNA element encyclopedia plan (The Encyclopedia of DNA
Elements Project, ENCODE) achievement in research shows that protein coding gene sequence only accounts for the 1- of human genomic sequence
3%, and in human genome the transcribed sequences of the overwhelming majority for long-chain non-coding RNA (Long non-coding RNA,
lncRNA).LncRNA is universally present in various biologies, and with the raising of biological complex degree, lncRNA in genome
The ratio of sequence also correspondingly increases, and prompts lncRNA significant during biological evolution.With lncRNA constantly quilts
It was found that their function is gradually interpreted, scientists find that lncRNA actively participates in vital movement different layers extensively
In the function controlling in face, the field brand-new as one has become the new forward position in international life science field and hot spot.
LncRNA can be as the signal (signal) of functional protein, induction (guide), bait (decoy) or stent
(scaffold) various ways such as molecule, in chromatin reconstruct, genetic transcription, translation and the multiple levels such as protein modified regulation and control base
The expression of cause, and irreplaceable role is being played including developing, being immunized, during the basic physiologicals such as reproduction, it is prior
It is that expression and the functional disturbance of lncRNA are closely connected with a variety of diseases of the mankind including malignant tumour one
It rises.Therefore, the function of lncRNA is furtherd investigate, is disclosed by the lncRNA hereditary information transfer modes mediated and expression regulation net
Network not only can annotate and illustrate again the structure and function of genome from the angle other than protein coding gene, deeply find
The essence and rule of vital movement are expected to recognize from a new visual angle a variety of mankind's common diseases including tumour
Pathogenesis, and the Clinics and Practices for these diseases provide new molecular marker and therapy target.
Nasopharyngeal carcinoma is common head-neck malignant tumor occurred frequently, and metastasic cervical lymph nodes easily occur, and prognosis is poor, radiation
Treatment is current nasopharyngeal carcinoma clinically main therapeutic scheme, and part Nasopharyngeal Carcinoma Patients are resisted since cancer cell has radiation
(Radioresistance), that is, insensitive to radiotherapy, radioactive ray cannot kill tumour cell completely, and remaining is swollen
Oncocyte finally recurs, and transfer leads to the death of patient.It participates in research shows that the occurrence and development of this tumour are polygenes, is more
Step, multistage complex process, LncRNA may also play important role during the occurrence and development of nasopharyngeal carcinoma, together
When lncRNA may also take part in the regulation and control of nasopharyngeal carcinoma cell reflex sensitivity.We utilize lncRNA chips recently, construct
The express spectra of lncRNA in Biopsies from Patients with Nasopharyngeal Carcinoma and normal reference sample has therefrom screened some differential expressions in nasopharyngeal carcinoma
LncRNAs, through enlarged sample real-time fluorescence quantitative PCR verify, it was demonstrated that lncRNA PVT1 are on nasopharyngeal carcinoma is notable
It adjusts, shows that the detection preparation for the lncRNA can be used for the auxiliary diagnosis of nasopharyngeal carcinoma.Then, we further increase sample
This, in the nasopharyngeal carcinoma paraffin that 94 have Clinical Follow-up data achieves sample, passes through in situ hybridization (in situ
Hybridization method) has detected the expression of PVT1, it is found that the high patient of PVT1 expression is easier generation radiotherapy and supports
Anti-, life span is shorter than the lncRNA and expresses low patient, therefore can be used for nose for the detection preparation of the lncRNA
The effect of pharynx cancer, predicts and Index for diagnosis.
We target short hairpin RNA (short-hairpin RNA, shRNAs) sequence of PVT1 by designing and synthesizing,
The rna interference vector of targeting PVT1 is constructed, is transfected into human nasopharyngeal epithelioma 1, and confirms that the expression of targeting interference PVT1 can
The radiation sensitivity of nasopharyngeal carcinoma cell is remarkably reinforced.The silicon that the rna interference vector of PVT1 is loaded to polylysine modification is received
Nanoparticulate Carriers for Gene Delivery is made in rice grain, the nano silicon particles of polylysine modification can protect the rna interference vector of PVT1
It degrades from nuclease, extends action time, and have higher transfection efficiency.Therefore it is targeted for the interference preparation of the lncRNA
Inhibit expression of the lncRNA in nasopharyngeal carcinoma cell that nasopharyngeal carcinoma cell can be induced more sensitive to radiotherapy, so as to conduct
Novel radiation treatment sensitizer, for the auxiliary treatment of nasopharyngeal carcinoma.
Invention content
Reagent the object of the present invention is to provide interference long-chain non-coding RNA PVT1 expression is controlled in preparation nasopharyngeal carcinoma auxiliary
Treat the application in preparation;The sequence of the long-chain non-coding RNA such as SEQ NO:Shown in 1.
3 interfered target sequences needed for the reagent of the interference long-chain non-coding RNA PVT1 expression are as follows:
shRNA-1:GGACTTGAGAACTGTCCTTA
shRNA-2:GCTTCTCCTGTTGCTGCTAGT
shRNA-3:GCTCCACCCAGAAGCAATTCA.
The reagent of the interference long-chain non-coding RNA PVT1 expression is interfered using RNA prepared by interfered target sequence
Short hairpin RNA expression vector.
For 3 interfered target sequences and carrier, the oligonucleotides that design can form hairpin structure is single-stranded and its reversed
Complementary series, they can form DNA double chain of the both ends respectively with restriction enzyme site cohesive end after annealing;Particular sequence
It is as follows:shRNA-1:
shRNA-2:
shRNA-3:
The preparation method of the short hairpin RNA expression vector for RNA interference is specific as follows:
1) design of shRNA
First according to long-chain non-coding RNA PVT1, shRNA target spots are found, 3 target sequences are as follows:
shRNA-1:GGACTTGAGAACTGTCCTTA
shRNA-2:GCTTCTCCTGTTGCTGCTAGT
shRNA-3:GCTCCACCCAGAAGCAATTCA
Using the widely used Scramble sequences for not having any target spot in human genome as negative control, sequence
Row are as follows:
Scramble:GACACGCGACTTGTACCAC
2) for this 3 target sequences and Scramble sequences and OligoEngine companies pSUPER carriers, design
Can be formed hairpin structure oligonucleotides is single-stranded and its reverse complementary sequence, they can form both ends band limitation respectively after annealing
The DNA double chain of property restriction enzyme site BglII and HindIII cohesive end;Each oligonucleotide sequence that need to specifically synthesize and they
The DNA double chain that pairing is formed after retracting is as follows:
shRNA-1:
shRNA-2:
shRNA-3:
Scramble
3) shRNA vector constructions
Above-mentioned 3 shRNA of chemical synthesis and 8 single-stranded oligo sequences of control, by synthetic oligo oligo
Annealing buffer are dissolved into 20 μM, and complementary single strand respectively takes 10 μ l to mix;Then by oligo mixtures 95 in PCR instrument
DEG C heating 5 minutes, then cooled to room temperature forms double-strand oligo segments;
With Bgl II and Hind III double digestion pSUPER plasmids, the carrier segments of 3.1kb are recycled, by the viscosity after annealing
The DNA of end and the carrier of digestion recycling are according to 3:The ratio mixing of the amount of 1 substance, with T4 ligases, 16 DEG C of connections are overnight;
Transformed E .coil competence selects transformant, bacterium colony PCR and sequencing identification, then built with Cla I and I digestions of EcoR
PSUPER plasmids, 2% agarose DNA gel electrophoresis, using blank pSUPER as blank control, judgement inserts target fragment
Positive colony, the pcSUPER plasmid transformed competence colibacillus Escherichia coli comprising PVT1 interference sequences that will be obtained, to expand plasmid.
The expression vector is loaded to, nanosphere is made on the nano silicon particles of polylysine modification.
The nano silicon particles of polylysine modification be with OP-10, hexamethylene, ammonium hydroxide microemulsion self-assembling technique into
The synthesis of row nano silicon particles, and can be repaiied using the surface of nano silicon particles with ion electrostatic interaction progress poly-D-lysine surface
Decorations, are prepared.
Prepare the nano silicon particles of polylysine modification:
1) OP-10, hexamethylene and ammonium hydroxide are mixed, the positive different ester of silicic acid is added in after being stirred at room temperature uniformly, continue to stir to poly-
It closes and completes, add in equal-volume acetone, ultrasonic disperse centrifuges, and distilled water washs three times, is collected by centrifugation and is deposited in 80 DEG C of dryings, grinds
The thin nano silicon particles for obtaining particle size range 10-50nm;Wherein H2O and OP-10 and H2The molar ratio of O and the different ester of positive silicic acid for 2~
10th, ammonia concn is 1.6~28%, molar concentration of the different ester of positive silicic acid in hexamethylene is 0.1~3mol/L;
2) nano silicon particles are resuspended in 0.6M NaCO by 0.1~10mg/ml3In solution, ultrasonic disperse, centrifugation is abandoned
Clearly, then by sediment by 0.1~10mg/ml it is resuspended in the PBS of pH 7.4, ultrasonic disperse adds polylysine, final concentration of
4~15nmol/mL, abundant mixing, room temperature, which is mixed, shakes;Centrifugation, abandons supernatant, precipitates and be resuspended in distilled water by 0.1~10mg/ml,
Obtain the nano silicon particles of polylysine modification.
By the nano silicon particles ultrasonic disperse of polylysine modification, every milliliter of nano particle suspension adds in 10~50ug long
The interference carrier of chain non-coding RNA PVT1, mixing, is stored at room temperature and makes it combine.
The present invention is transferred to the interference carrier of targeting PVT1 in Nasopharyngeal Carcinoma Cell Line CNE2 and 5-8F, inhibits the expression of PVT1
Afterwards, apoptotic cell ratio significantly increases, and it is auxiliary that the reagent for illustrating long-chain non-coding RNA PVT1 is interfered to express can be used in nasopharyngeal carcinoma
Treatment is helped, there is significant clinical treatment meaning.
Description of the drawings
Fig. 1 is that Real-Time Fluorescent Quantitative PCR Technique verifies expression of the lncRNA PVT1 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium
Situation, expression of the PVT1 in nasopharyngeal carcinoma (T) in normal nasopharyngeal epithelium (N) than significantly improving.
Fig. 2 is that in situ hybridization detects expressions of the PVT1 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium,
Expression is relatively low in normal nasopharyngeal epithelium (NPE) (has only detected high table in 6 normal nasopharyngeal epithelial tissues
Reach, detection expression is low in remaining 27 or does not express), and in 63.8% nasopharyngeal carcinoma (60 in 94 tissues of nasopharyngeal carcinoma)
Detect the high expression of PVT1;P<0.001.
The expression that Fig. 3 is PVT1 in nasopharyngeal carcinoma is related to Radiotherapy for Nasopharyngeal Carcinoma sensibility,
In the Nasopharyngeal Carcinoma Patients that 92 have Clinical Follow-up data, 44 resist for radiotherapy (Radioresistant, i.e., pair
Radiotherapy is not sensitive enough), 48 are sensitive (Radiosensitive) for radiotherapy, in patient (29) nose of radiotherapy sensitivity group 60.4%
PVT1 low expressions in pharynx cancer tissue, and the high expression of PVT1 is detected in radiotherapy resistance group only 11.4% (5);P<
0.001。
Fig. 4 is the relationship of expression Yu the Nasopharyngeal Carcinoma Patients prognosis of PVT1 in nasopharyngeal carcinoma,
The high expression of PVT1 is related to the poor prognosis of Nasopharyngeal Carcinoma Patients in nasopharyngeal carcinoma, i.e. the trouble of PVT1 high expression (high)
The total life span of person (Over-all survival, left) and recurrence-free survival time (Relapse-free sruvival,
It is right) it will be significantly lower than PVT1 low expressions or the patient (Low) not expressed.
Fig. 5 is the interference carrier that PVT1 is imported in nasopharyngeal carcinoma cell, can significantly inhibit PVT1 in nasopharyngeal carcinoma cell
Expression,
After importing the interference carrier (siPVT1) of targeting PVT1 in Nasopharyngeal Carcinoma Cell Line CNE2 and 5-8F, real-time fluorescence is fixed
Amount PCR method has detected the expression of PVT1 in nasopharyngeal carcinoma cell, and the expression of PVT1 is significantly inhibited.Negative control
(NC) it is scramble interference carriers.
Fig. 6 be in nasopharyngeal carcinoma cell import PVT1 interference carrier inhibit PVT1 expression after, cell to radiotherapy more
Add sensitivity,
The interference carrier (siPVT1) that targeting PVT1 is imported in Nasopharyngeal Carcinoma Cell Line CNE2 and 5-8F inhibits the expression of PVT1
Afterwards, cell receives the radioactive ray irradiation of 0,2,4,6,8Gy dosage respectively, and subsequent cell continues culture 12 days, clones Colony forming
Experiment shows to compare with negative control (NC transfects the cell of scramble interference carriers), after inhibiting PVT1 expression, CNE2 and 5-
The plastidogenetic colony numbers of 8F significantly reduce, and show that cell is more sensitive to radiotherapy.
Fig. 7 is after the interference carrier inhibition PVT1 expression of PVT1 is imported in nasopharyngeal carcinoma cell, and Apoptosis dramatically increases,
Radioactive ray radiation-induced apoptosis of tumor cells is the main reason for radiotherapy plays killing tumor cell, thin in nasopharyngeal carcinoma
The interference carrier of targeting PVT1, after the expression for inhibiting PVT1, flow cytomery nasopharyngeal carcinoma are transferred in born of the same parents system CNE2 and 5-8F
The apoptosis situation of cell, the nasopharyngeal carcinoma cell for finding that PVT1 is inhibited to express by radioactive ray after being irradiated, the ratio of apoptotic cell
Example is significantly raised, further demonstrates and inhibits the expression of PVT1 that can have the function that radio therapy sensitization.
Specific embodiment
It further illustrates the present invention, is not intended to limit the present invention below in conjunction with specific embodiment.
Embodiment 1, quantitative real-time PCR detection confirm that PVT1 is raised in nasopharyngeal carcinoma
1. materials and methods:
Collect 32 normal nasopharyngeal epithelial tissues and 61 tissues of nasopharyngeal carcinoma, extracted total RNA, 2 μ g RNA through reverse transcription into
After cDNA, real-time fluorescence quantitative PCR is carried out.PVT1 forward primers for 5 '-TGG CTG AGA GGG TTG AGA TC-3 ' such as
SEQ NO:Shown in 2 and reverse primer 5 '-GCT GTA TGT GCC AAG GTC AC-3 ' such as SEQ NO:Shown in 3.
GAPDH forward primers for control are 5 '-ACCACAGTCCATGCCATCAC-3 ' such as SEQ NO:Shown in 4 and
Reverse primer 5 '-TCCACCACCCTGTTGCTGTA-3 ', such as SEQ NO:Shown in 5.
Real-time fluorescence quantitative PCR reaction system
Real-time fluorescence quantitative PCR reaction step
The amplification curve and melting curve of real-time fluorescence quantitative PCR, the expression intensity root of each gene are confirmed after reaction
After CT values (threshold cycle values), reference gene (GAPDH) markization, examined and calculated using group t-test
P values.
2. result
PVT1 does not express or expresses very low, and the high expression P in tissues of nasopharyngeal carcinoma in normal control tissue<0.001
(Fig. 1)
Embodiment 2, in situ hybridization detection find expressions of the PVT1 in nasopharyngeal carcinoma and its with patient's prognosis and radiotherapy
The correlation of sensibility
1. MATERIALS METHODS
1.1 design and synthesize hybridization probe
In order to which using the expression of in-situ hybridization method detection PVT1, we devise detects PVT1 in situ hybridization
The oligonucleotide probe of expression and each 3 of two groups of in situ hybridization oligonucleotide probes of positive control.
For the oligonucleotide probe of in situ hybridization detection PVT1 expression:
PVT1 probes 1:5 '-GGTCGGACTAGAAAACCGGTCTTCCTCTAATTTT-3 ' such as SEQ NO:Shown in 6,
PVT1 probes 2:5 '-GAGACTGTAAAAACTTCTCAGGTCTTAGGA-3 ' such as SEQ NO:Shown in 7,
PVT1 probes 3:5 '-CTCATAAAACTCTAACCTCTTAATTCTCGGTCAG-3 ' such as SEQ NO:Shown in 8.
Positive control probe (detection house-keeping gene GAPDH):
GAPDH probes 1:5'-CCACTTTACCAGAGTTAAAAGCAGCCCTGG-3', such as SEQ NO:Shown in 9,
GAPDH probes 2:5'-CAGTAGAGGCAGGGATGATGTTCTGGAGAG-3', such as SEQ NO:Shown in 10,
GAPDH probes 3:5'-GTCAGAGGAGACCACCTGGTGCTCAGTGTA-3', such as SEQ NO:Shown in 11.
Each gene specific oligonucleotides probe sequence of above-mentioned design is synthesized using chemical synthesis process.
1.2 oligonucleotide probe labelling kits and in situ hybridization detection reagent
Digoxin oligonucleotides tailing reagent (Dig Oligonucleitide Tailing Kit 2ndGeneration,
Roche companies), anti-digoxin-horseradish peroxidase complex detection kit (Anti-Digoxigenin-POD, Fab
Fragments, Roche company), the TSA signal amplifying systems (TSA of enhancing detection of expression signal in situTM Biotin
System, NEL700 kit, PerkinElmer companies), DAB staining kits (Beijing Zhong Shan companies), 20x sodium citrates
Buffer solution (saline sodium citrate, SSC), dextran sulfate (Dextran sulphate), deionized formamide
(Deionized Formamide), polyadenylic acid (polyadenylic acid, Poly A), poly deoxyadenylic acid
(polydeoxyadenylic acid, Poly dA) is denaturalized frog essence DNA (the denatured and sheared of shearing
Salmon sperm DNA, ssDNA), yeast transfer RNA (yeast t-RNA, tRNA), dithiothreitol (DTT) (DTT), 50x Deng Han
Family name's buffer solution (Denhardts ' s solution), phosphate buffer (PBS buffer), pepsin K, bovine serum albumin(BSA)
(BSA), triethanolamine (TEA), TNB Buffer (0.1M Tris-HCl, pH7.5,0.15M NaCL, 0.5%Blocking
Reagent), TNT Buffer (0.1M Tris-HCl, pH7.5,0.15MNaCL, 0.05%Tween 20), acetic anhydride block
Reagent (Blocking reagent agent, Roche companies).
1.3 other main agents and material
Absolute ethyl alcohol, 90% alcohol, 70% alcohol, 50% alcohol, turpentine oil, distilled water, PBS buffer solution (pH7.2~
7.4, NaCl 137mmol/L, KCl 2.7mmol/L, Na2HPO44.3mmol/L, KH2PO41.4mmol/L);3% methanol-
Hydrogen peroxide solution (80% methanol and the configuration of 30% hydrogen peroxide);0.01mol/L citrate buffers (citrate buffer,
CB, pH6.0 ± 0.1,9ml 0.1M citric acid solutions and 41ml 0.1M sodium citrate solutions add in interim in 450ml distilled water
With postponing correction work liquid pH value again);0.1% trypsase;Haematoxylin;1% hydrochloride alcohol (1ml concentrated hydrochloric acids+99ml 70%
Alcohol is configured);Mounting glue (PTS Cure Mount II);Special coverslip (480 × 240mm2) customize in Zhengzhou glass apparatus
Factory.Leica low melting points (58 DEG C) paraffin, domestic beeswax, absolute alcohol, dimethylbenzene, 10% neutrality paraformaldehyde (0.01mol/L,
PH7.4, DEPC distilled water and PBS buffer solution are prepared), haematoxylin, Yihong, neutral mounting natural gum, coverslip, glass slide.
1.4 label probe
Oligonucleotide probe label is carried out using 3-tailing DIG Olignucleutide Kit, reaction system is such as
Under.
100pmol oligonucleotide+ddH2O=9 μ l (control:control oligonucleutide 5μ
l+ddH2O 4μl)
Mixing slightly centrifuges.37 DEG C of water-bath 30min add 2 μ l EDTA (0.2M, PH 8.0) stopped reactions.
It is purified after 1.5 oligonucleotide probes label
In order to increase the purity of label probe, marked probe need to be purified, concrete operations are as follows:
1) 100% cold ethyl alcohol (- 20 DEG C) of+2.5 μ l 4M LiCL+75 μ l of probe reaction mixture (22 μ l)
2) -70 DEG C of precipitations 60min, or-20 DEG C of 2h.
3) 13.000 × g, 4 DEG C of centrifugation 15min.
4) supernatant is abandoned, is washed with 70% ice-cold (V/V) ethyl alcohol of 50 μ l.
5) 4 DEG C of 13.000xg centrifuge 5min.
6) supernatant, 4 DEG C of dryings of vacuum are abandoned.
7) with the molten probe of aseptic double-distilled water weight.
1.6 in situ hybridizations detection achieves the expression of PVT1 in paraffin section
Paraffin section hybridizes pre-treatment
1) paraffin section of 4 DEG C of preservations is placed in 58 DEG C of roasting piece 30min, melted surface paraffin.
2) dimethylbenzene dewaxes 3 × 5min successively.
3) step ethanol wash, 100% 2 × 2min of alcohol → 95%, 1 × 5min of alcohol → 70%, 1 × 5min of alcohol →
50% 1 × 5min of alcohol → 2 × 3min of DEPC water washings → DEPC-PBS washs 2 × 5min.
4) 300 μ l pepsins K (10 μ g/ml) are added dropwise on slice, 37 DEG C digest 20min.
5) it is sliced and washs 1min, stopped reaction into PBS (0.1M PBS+2mg/ml glutamic acid).
6) it is sliced into 0.2N HCL, reacts 20-30min in 37 DEG C, increase the permeability of tissue.
7) slice fixes 10min, room temperature afterwards with 4% paraformaldehyde (0.1M PBS dissolvings).
8) in order to increase tissue positive intensity for hybridization, acetyl processing is carried out to slice.It is sliced into 0.25% acetic anhydride
Buffer I (0.1M triethanolamines), room temperature 10min.
9) 1M PBS wash 2 × 5min.
Prehybridization and hybridization
Prehybridization:The prehybridization solution of -20 DEG C of preservations is first placed in 37 DEG C of incubation 60min, and the dosage of prehybridization solution is 50 μ l,
Parafilm is carried out lid and is sliced, prehybridization 2 hours in 37 DEG C of wet box.(prehybridization solution composition includes:2XSSC, 10%Dextran
Sulphate, 1X Denhardt ' s solution, 50mM Phosphate Buffer (PH 7.0), 50mM DTT, 250 μ l,
100 μ g/ml poly A, 5 μ g/ml poly dA, 250 μ g/ml yeast t-RNA, 500 μ g/ml ssDNA, 47%
Deionized formamide)。
1) parafilm is removed, gets rid of prehybridization solution, slice is placed in 5min in 2 × SSC.
2) hybridization reaction:37 DEG C of hybridized overnights (18-20h).Each slice adds in 250 μ l hybridization solutions and is carried out with parafilm
Lid.Corresponding probe is added in prehybridization solution just becomes hybridization solution.Hybridization solution is prepared in prehybridization, is placed 37 DEG C of incubations, is made
Probe is completely dissolved in hybridization solution, this experiment is mixed with a plurality of oligonucleotide probe, is matched by each probe 500ng/ml concentration
Probe hybridization solution is made.Digoxin tailing labelling kit label probe concentration calculation basis:The concentration of each probe by its with
Colour developing is compared and the label reaction theory spy of the naked probe of 30 bases of 100pmol during detection reaction when the positive quantifies probe
Needle yield goes out the concentration of label probe for two kinds of standards progress COMPREHENSIVE CALCULATINGs of 900ng.
3) post-hybridization washing, slice immerse 2 × SSC, 10min, throw off parafilm.It is washed successively in shake on shaking table, 2 ×
SSC (0.5%SDS), 2 × 15min → 0.25 × SSC (0.5%SDS), 2 × 15min.
Color developing detection is reacted after hybridization
1) digoxigenin-probe and mRNA combination compounds are detected using Anti-Digoxigenin-POD;TSA amplification systems
Enhance the positive signal of in situ hybridization reaction solution reaction, DAB colour developings.
2) slice is gone in TNT buffer solutions, 3 × 5min.
3) TNB is added dropwise and blocks buffer solution, 300 μ l/TMAs, room temperature, 30min.
4) extra blocking agent is sucked, 1:100 diluted Anti-Digoxigenin-POD (TBS+0.1%Triton X-
100+1% blocking agents), room temperature 4 hours.
5) TNT Buffer (0.1M Tris-CL, pH7.5,0.15M NaCL, 0.05%Tween 20) are washed,
3x5min。
6) signal amplification reagent Biotinyl Tyamid, 300 μ l/TMAs, (Biotinyl Tyramid are added dropwise on slice
Store liquid:Biotinyl Tyramid are dissolved in 0.2ml DMSO, Biotinyl Tyramid working solutions:1 × dilution, 1:50
Dilute Biotinyl Tyramid storages liquid), room temperature 10 minutes.
7) TNT is washed, 3 × 5min.
8) SA-HRP (strepto- avidin-horseradish peroxidase), 300 μ l/TMAs, room temperature 30min are added dropwise in slice.
9) TNT is washed, 3 × 5min.
10) distilled water washing, 1 × 1min.
11) DAB develops the color, and chromogenic reaction is controlled under microscope.
12) haematoxylin is redyed,
13) alcohol step is dehydrated, chip drying.
14) mounting glue, the coverslip cover plate of dimension, crosslinking slice 1min under ultraviolet lamp is added dropwise.
1.7 results judge and standard
Application Optics microscope is observed under low power and high power lens respectively, looks first at the positive expression of target RNA
Signal is in the intracellular positioning of object observing:Positioned at nucleus, cytoplasm or cell membrane.
It is carried out respectively with two kinds of standards of the intensity of the detection rna expression position positive signal and the cell number of positive expression again
Comprehensive score, criterion are:(1) judge according to positive cell dyeing intensity:A. cell dye-free remembers 0 point;B. cell is dyed
Light brown is weakly positive, remembers 1 point;C. cell dyes brown and dyes dark-brown without background coloration or cell and have the light brown back of the body
Scape is moderate positive, remembers 2 points;D. cell dyes dark-brown and is strong positive without background coloration, remembers 3 points.(2) according to positive cell
Express number score:A. no positive cell expression, remembers 0 point;B. positive expression cell number≤25% remembers 1 point;C.25% < is positive thin
Born of the same parents' number < 50% remembers 2 points;D. positive expression cell number >=50% remembers 3 points.
It is respective by one of above-mentioned standard respectively by two pathology experts in order to reduce the subjective factor of appraisal result as possible
Judged and scored, then the two is scored and is multiplied, result is:1. 0 point of person is finally calculated as 0 point, it is believed that feminine gender expression;2. 1 point
1 point is finally calculated as with 2 points of persons, it is believed that weakly positive is expressed;3. 3 points and 4 points of persons are finally calculated as 2 points, it is believed that moderate positive is expressed;④
6, which assign to 9 points of persons, is finally calculated as 3 points, it is believed that strong positive is expressed.
1.8 analyses and statistical software
Statistical analysis is carried out to experimental result using SPSS13.0 statistical softwares, compares use χ two-by-two2Test or Fisher
Exact test, correlation analysis use Spearmen correlation methods;P < 0.05 are that difference is statistically significant.
Survivorship curve analysis is using Kaplan-Meier method and log-rank test;Multi-variables analysis uses Cox ' s
proportional hazards model;P < 0.05 are that difference is statistically significant.
2 results
Expression of 2.1 PVT1 in nasopharyngeal carcinoma raising more notable than expression in normal control tissue, and and radiation sensitivity
It is related
PVT1 (60/94) in 63.8% tissues of nasopharyngeal carcinoma has high expression, and only in 18.2% (33 normal structures
6 in sample) normal nasopharyngeal epithelial tissue in have high expression (Fig. 2), between the two with apparent significant difference (P<
0.001).In 94 Nasopharyngeal Carcinoma Patients, 92 have a Clinical Follow-up data, 44 resist for radiotherapy (Radioresistant, i.e.,
It is not sensitive enough to radiotherapy), 48 are sensitive (Radiosensitive) for radiotherapy, in the patient (29) of radiotherapy sensitivity group 60.4%
PVT1 low expressions in tissues of nasopharyngeal carcinoma, and the high expression of PVT1 is detected in radiotherapy resistance group only 11.4% (5);P<
0.001.(Fig. 3)
The Nasopharyngeal Carcinoma Patients prognosis of 2.2 PVT1 high expression is poor
We have carried out Effect of follow-up visit by telephone to 92 Nasopharyngeal Carcinoma Patients, inquired in detail they start time, treatment,
Recurrence is whether there is, whether there is and suffers from other diseases, recurrence and death time etc. again, and register life span and state, and to nasopharyngeal carcinoma
The survival analysis that the expression of PVT1 and the life span of patient and state carry out in tissue finds that PVT1 high expression patients are averagely raw
Depositing the time is significantly shorter than PVT1 low expressions or the patient not expressed (Fig. 4).It is one relevant with nasopharyngeal carcinoma prognosis to illustrate PVT1
Molecular labeling, lncRNA expression is high, patient's poor prognosis.
Embodiment 3, the expression of structure shRNA carrier interference PVT1
1. MATERIALS METHODS
1.1 reagents and kit
Restriction enzyme Hind III, Bgl II, EcoR I and Cla I, T4DNA ligase etc. are public purchased from TakaRa
Department;
TRIZOLTMReagent(Invitrogen);
Plasmid extraction kit (#D6943-01, OMEGA);
Plastic recovery kit (#M5212, OMEGA);
Reverse Transcriptase kit (#A3500, Promega);
Antibiotic G418 (Ameresc).
The design of 1.2shRNA
First by the Block-It RNAi designer softwares of PVT1 sequence inputting Invitrogen companies, finding should
It is as follows to select the corresponding target sequence of best 3 for the shRNA best targets of lncRNA:
shRNA-1:GGACTTGAGAACTGTCCTTA such as SEQ NO:Shown in 12,
shRNA-2:GCTTCTCCTGTTGCTGCTAGT such as SEQ NO:Shown in 13,
shRNA-3:GCTCCACCCAGAAGCAATTCA such as SEQ NO:Shown in 14,
Using the widely used Scramble sequences for not having any target spot in human genome as negative control, sequence
Row are as follows:
Scramble:5 '-GACACGCGACTTGTACCAC-3 ' such as SEQ NO:Shown in 15.
For this 3 lncRNA target sequences and Scramble sequences, according to OligoEngine companies pSUPER carriers
Specification, design can be formed hairpin structure oligonucleotides is single-stranded and its reverse complementary sequence, they can form two after annealing
Hold the DNA double chain respectively with restriction enzyme site BglII and HindIII cohesive end.Each few nucleosides that need to specifically synthesize
The DNA double chain formed after acid sequence and their pairing annealing is as follows:
shRNA-1:
Such as SEQ NO:16th, shown in 17,
shRNA-2:
Such as SEQ NO:18th, shown in 19,
shRNA-3:
Such as SEQ NO:20th, shown in 21,
Scramble
Such as SEQ NO:22nd, shown in 23.
After the DNA annealing of two complementary pairings, the left side is the cohesive end of restriction enzyme Bgl II, and the right is Hind
The cohesive end of III.
1.3shRNA vector construction
The corresponding 8 single-stranded oligo sequences of above-mentioned 4 shRNA of chemical synthesis, by synthetic oligo oligo
Annealingbuffer is dissolved into 20 μM, and complementary single strand respectively takes 10 μ l to mix.Then by oligo mixtures 95 DEG C in PCR instrument
Heating 5 minutes, then cooled to room temperature, forms double-strand oligo segments.
With Bgl II and Hind III double digestion pSUPER plasmids, the carrier segments of 3.1kb are recycled, by the viscosity after annealing
The DNA of end and the carrier of digestion recycling are according to 3:The ratio mixing of 1 amount of substance, with T4 ligases, 16 DEG C of connections are overnight.Turn
Change E.coil competence, select transformant, bacterium colony PCR and sequencing identification, then built with Cla I and I digestions of EcoR
PSUPER plasmids, 2% agarose DNA gel electrophoresis, using blank pSUPER as blank control, judgement inserts target fragment
Positive colony, for the expression of PVT1 in interference cell after positive colony sequencing verification.
1.4 cell culture and transfection
Nasopharyngeal Carcinoma Cell Line CNE2 and 5-8F are purchased from Central South University's cell centre, and RPMI 1640 used in cell culture trains base
And fetal calf serum and trypsase used in vitellophag are U.S.'s Gibco Products.
The good Nasopharyngeal Carcinoma Cell Line CNE2 and 5-8F of growth conditions is pressed 2 × 105A cells/well is inoculated in 6 orifice plates,
6 orifice plates are placed in 37 DEG C, 5%CO2In incubator, cell growth to be cultivated to 50-70% density can start shRNA expression and carry
The transfection of body;Transfection process is as follows:
The lipofectamine 2000 of the 3 μ l mixing in 100 μ l serum free mediums is added in sterile EP pipes to stand
5min;
The shRNA expression vectors of structure are added in 100 μ l serum free mediums;Then it is included with above-mentioned
The 100 mild mixings of μ l serum free mediums of lipofectamine, are stored at room temperature 30 minutes, DNA are made to be formed with liposome compound
Body;
Cell is washed with D-Hank's liquid 3 times;
800 μ l serum free mediums (antibiotic-free) will be added in said mixture, are added in 6 orifice plates after mild mixing
1 hole;
6 orifice plates are placed in CO2In incubator, 37 DEG C are cultivated 6 hours, then abandon supernatant, are added in complete medium and are continued to train
It supports 48 hours.
The effect of 1.5 real-time quantitative PCRs detection shRNA interference lncRNA expression:
Nasopharyngeal carcinoma cell extracted total RNA after various shRNA carriers are transfected, 2 μ g RNA through reverse transcription into after cDNA, into
Row real-time fluorescence quantitative PCR.PVT1 primers are 5 '-TGG CTG AGA GGG TTG AGA TC-3 ' and 5 '-GCTGTA TGT
GCC AAG GTC AC-3’。
For control GAPDH primers for 5 '-ACCACAGTCCATGCCATCAC-3 ' and 5 '-
TCCACCACCCTGTTGCTGTA-3’,
Real-time fluorescence quantitative PCR reaction system
Real-time fluorescence quantitative PCR reaction step
The amplification curve and melting curve of real-time fluorescence quantitative PCR, the expression intensity root of each gene are confirmed after reaction
After CT values (threshold cycle values), reference gene (GAPDH) markization, examined and calculated using group t-test
P values.
2. result
After these three shRNA carriers transfection nasopharyngeal carcinoma cell CNE2 and 5-8F, can significantly it lower in nasopharyngeal carcinoma cell
The expression (Fig. 5) of PVT1.
Embodiment 4, the nano particle for preparing load shRNA interference carriers inhibit the expression of PVT1 in nasopharyngeal carcinoma cell
1. MATERIALS METHODS
1.1 prepare the coated nano silicon particles of poly-D-lysine
The coated nano silicon particles of poly-D-lysine are carried out with OP10/ hexamethylenes/ammonia microemulsion self-assembling technique
The synthesis of nano silicon particles (silica nanoparticle, SiNP), and can and pass through ion using the surface of nano silicon particles
Electrostatic interaction prepares the nano silicon particles of polylysine modification;The nano particle can be prepared by following methods:
1) OP-10, hexamethylene and ammonium hydroxide are mixed, adds in the positive different ester of silicic acid (TEOS) after being stirred at room temperature uniformly, continue to stir
Mix to polymerization and complete, add in equal-volume acetone, ultrasonic disperse, centrifugation, distilled water washs three times, be collected by centrifugation be deposited in 80 DEG C it is dry
It is dry, it is finely ground to obtain nano silicon particles (SiNP).Wherein H2O and OP-10 and H2The molar ratio of O and TEOS is 2~10, ammonia concn is
1.6~28%, molar concentrations of the TEOS in hexamethylene is 0.1~3mol/L.
2) SiNP is resuspended in 0.6M NaCO by 0.1~10mg/ml3In solution, supernatant is abandoned in ultrasonic disperse, centrifugation, then
Sediment is resuspended in by 0.1~10mg/ml in PBS (pH 7.4), ultrasonic disperse, add polylysine (final concentration of 4~
15nmol/mL), abundant mixing, room temperature, which is mixed, shakes;Centrifugation, abandons supernatant, and precipitation is resuspended in distilled water, obtains poly-D-lysine and repair
The nano silicon particles of decorations.Final concentration of 4~15nmol/mL of poly-D-lysine.
1) by modified nano silicon particles ultrasonic disperse, in mass ratio 5~30:1 with the targeting PVT1's described in embodiment 3
Rna interference vector mixes, and is stored at room temperature and makes it combine.
1.2 cell culture and transfection
Growth conditions good nasopharyngeal carcinoma cell 5-8F, HK2 and HNE2 are pressed 2 × 105A cells/well is inoculated in 6 orifice plates
In, 6 orifice plates are placed in 37 DEG C, 5%CO2In incubator, cell growth to be cultivated to 50-70% density can start PVT1 eukaryons
The transfection of expression vector;Transfection process is as follows:
The silicon of the polylysine modification of carrying PVT1 eukaryon expression plasmids that 100 μ l are prepared is added in sterile EP pipes
Nano particle suspension, with the 100 mild mixings of μ l serum free mediums;Cell is washed with D-Hank's liquid 3 times;By said mixture
It is middle to add in 800 μ l serum free mediums (antibiotic-free), add in 1 hole in 6 orifice plates after mild mixing;6 orifice plates are placed in CO2
In incubator, 37 DEG C are cultivated 6 hours, then abandon supernatant, are added in complete medium and are continued overnight incubation.With carrying Scramble sequences
The nano silicon particles of the polylysine modification of row are as experiment contrast.
1.3 radiation sensitivities experiment 1 --- Clone formation
Influence of the PVT1 expression to nasopharyngeal carcinoma cell radiation sensitivity is inhibited to be confirmed with the experiment of clone's colony.It transfects
PVT1shRNA interference carriers or the nasopharyngeal carcinoma cell of control vector (scramble) are inoculated in 6 orifice plates, give 0,2,4,6 respectively,
Cell, is then placed in incubator and continues culture 12 days by the radioactive ray irradiation of 8 Gy, removes culture medium, and living cells is with 0.5%
Violet staining, take pictures under the microscope, observe and count Clone formation situation.
1.4 radiation sensitivities experiment 2 --- detection Apoptosis
Radioactive ray radiation-induced apoptosis of tumor cells is the main reason for radiotherapy plays killing tumor cell.It transfects
PVT1shRNA interference carriers or the nasopharyngeal carcinoma cell of control vector (scramble) are inoculated in 6 orifice plates, after cell is adherent, point
0 (being equivalent to blank control) is not given or the irradiation of 6Gy radioactive ray, vitellophag after 48 hours use apoptosis test regent
Fluorescent dye in box (be purchased from BD companies) is incubated altogether with cell, then with flow cytomery, and is analyzed each group cell and is withered
Die situation.
2. result
After 2.1 interference carriers that PVT1 is imported in nasopharyngeal carcinoma cell inhibit PVT1, cell irradiates radioactive ray quicker
Sense
Colony formation confirms, the interference carrier of targeting PVT1, suppression are transferred in Nasopharyngeal Carcinoma Cell Line CNE2 and 5-8F
After the expression of PVT1 processed, after the irradiation of the radioactive ray of same dose, the number that can be survived and grow up to cell clone significantly reduces,
Show that cell is more sensitive to radioactive ray (Fig. 6).
After 2.2 interference carriers that PVT1 is imported in nasopharyngeal carcinoma cell inhibit PVT1 expression, Apoptosis ratio increases
The interference carrier of targeting PVT1 is transferred in Nasopharyngeal Carcinoma Cell Line CNE2 and 5-8F, after the expression for inhibiting PVT1, is withered
Dying cell proportion significantly increases (Fig. 7).
Sequence table
<110>Central South University
<120>Interfere application of the reagent of long-chain non-coding RNA PVT1 expression in nasopharyngeal carcinoma auxiliary treatment preparation is prepared
<160> 23
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1957
<212> RNA
<213>Homo sapiens (Homo sapiens)
<400> 1
cuccgggcag agcgcgugug gcggccgagc acaugggccc gcgggccggg cgggcucggg 60
gcggccggga cgaggagggg cgacgacgag cugcgagcaa agaugugccc cgggaccccc 120
ggcaccuucc aguggauuuc cuugcggaaa ggauguuggc ggucccugug accuguggag 180
acacggccag aucugcccuc cagccugauc uuuuggccag aaggagauua aaaagaugcc 240
ccucaagaug gcugugccug ucagcugcau ggagcuucgu ucaaguauuu ucugagccug 300
auggauuuac agugaucuuc aguggucugg ggaauaacgc ugguggaacc augcacugga 360
augacacacg cccggcacau uucaggauac uaaaaguggu uuuaagggag gcuguggcug 420
aaugccucau ggauucuuac agcuuggaug uccauggggg acgaaggacu gcagcuggcu 480
gagaggguug agaucucugu uuacuuagau cucugccaac uuccuuuggg ucucccuaug 540
gaauguaaga ccccgacucu uccuggugaa gcaucugaug cacguuccau ccggcgcuca 600
gcugggcuug agcugaccau acucccugga gccuucuccc gaggugcgcg ggugaccuug 660
gcacauacag ccaucaugau gguacuuuaa guggaggcug aaucaucucc ccuuugagcu 720
gcuuggcacg uggcucccuu gguguucccc uuuuacugcc aggacacuga gauuuggaga 780
gagucucacu cuguggucca ggcugaagua caguggcaug aucccagguc acugcaaccc 840
ccaccucccg gguucaagug auccuccugc cucagccucc cgaguagcug guauuacagg 900
cgugugccac aaagccuggc uaaguuuugu auuuuuagua gagacggggu uucaccaugu 960
uggccagguu ggucucgaac uccugaccuc aagugaucca cucacuuugg ccuuucaacg 1020
ugcugggauu acaggcgaga gucaccgcac ccggacgacu cugacauuuu ugaagagucc 1080
agaauccugu uacaccuggg auuuaggcac uuucaaucug aaaaaauaca uauccuuuca 1140
gcacucugga cggacuugag aacuguccuu acgugaccua aagcuggagu auuuugagau 1200
uggagaauua agagccaguc uuggugcucu guguucaccu gguucaucug aggagcugca 1260
ucuacccugc ccaugccaua gauccugccc uguuugcuuc uccuguugcu gcuaguggac 1320
augagaagga cagaauaacg ggcucccaga uucacaagcc ccaccaagag gaucacccca 1380
ggaacgcuug gaggcugagg aguucacuga ggcuacugca ucuugagacu caggaugaag 1440
acccagcuug gggcugucaa agaggccuga agaggcagaa caccccagag gagccugggg 1500
ccaccaccca gcaucacugu gggaaaacgg cagcaggaaa uguccucucg ccugcgugcu 1560
ccaccucggu ccacgccuuc ccuccuucug gaagccuugc cugaccacug gccugccccu 1620
ucuaugggaa ucacuacuga ccuugcagcu uauuauagac uuauauguuu uuugcauguc 1680
ugacacccau gacuccaccu ggaccuuaug gcuccaccca gaagcaauuc agcccaacag 1740
gaggacagcu ucaacccauu acgauuucau cucugcccca accacucagc agcaagcacc 1800
uguuaccugu ccacccccac cccuuccccc aaacugccuu ugaaaaaucc cuaaccuaug 1860
agcuuugaau aagaugagua cgaacuucau cgcccacgug gcguggccgg ccucgugucu 1920
auuaaauucu uuuucuacua aaaaaaaaaa aaaaaaa 1957
<210> 2
<211> 20
<212> DNA
<213>Unknown (Unknown)
<400> 2
tggctgagag ggttgagatc 20
<210> 3
<211> 20
<212> DNA
<213>Unknown (Unknown)
<400> 3
gctgtatgtg ccaaggtcac 20
<210> 4
<211> 20
<212> DNA
<213>Unknown (Unknown)
<400> 4
accacagtcc atgccatcac 20
<210> 5
<211> 20
<212> DNA
<213>Unknown (Unknown)
<400> 5
tccaccaccc tgttgctgta 20
<210> 6
<211> 34
<212> DNA
<213>Unknown (Unknown)
<400> 6
ggtcggacta gaaaaccggt cttcctctaa tttt 34
<210> 7
<211> 30
<212> DNA
<213>Unknown (Unknown)
<400> 7
gagactgtaa aaacttctca ggtcttagga 30
<210> 8
<211> 34
<212> DNA
<213>Unknown (Unknown)
<400> 8
ctcataaaac tctaacctct taattctcgg tcag 34
<210> 9
<211> 30
<212> DNA
<213>Unknown (Unknown)
<400> 9
ccactttacc agagttaaaa gcagccctgg 30
<210> 10
<211> 30
<212> DNA
<213>Unknown (Unknown)
<400> 10
cagtagaggc agggatgatg ttctggagag 30
<210> 11
<211> 30
<212> DNA
<213>Unknown (Unknown)
<400> 11
gtcagaggag accacctggt gctcagtgta 30
<210> 12
<211> 20
<212> DNA
<213>Unknown (Unknown)
<400> 12
ggacttgaga actgtcctta 20
<210> 13
<211> 21
<212> DNA
<213>Unknown (Unknown)
<400> 13
gcttctcctg ttgctgctag t 21
<210> 14
<211> 21
<212> DNA
<213>Unknown (Unknown)
<400> 14
gctccaccca gaagcaattc a 21
<210> 15
<211> 19
<212> DNA
<213>Unknown (Unknown)
<400> 15
gacacgcgac ttgtaccac 19
<210> 16
<211> 63
<212> DNA
<213>Unknown (Unknown)
<400> 16
gatccccgga cttgagaact gtccttattc aagagagtaa ggacagttct caagtccttt 60
tta 63
<210> 17
<211> 64
<212> DNA
<213>Unknown (Unknown)
<400> 17
gggcctgaac tcttgacagg aatgaagttc tctcattcct gtcaagagtt caggaaaaat 60
tcga 64
<210> 18
<211> 64
<212> DNA
<213>Unknown (Unknown)
<400> 18
gatccccgct tctcctgttg ctgctagttt caagagaact agcagcaaca ggagaagctt 60
ttta 64
<210> 19
<211> 64
<212> DNA
<213>Unknown (Unknown)
<400> 19
gggcgaagag gacaacgacg atcaaagttc tcttgatcgt cgttgtcctc ttcgaaaaat 60
tcga 64
<210> 20
<211> 64
<212> DNA
<213>Unknown (Unknown)
<400> 20
gatccccgct ccacccagaa gcaattcatt caagagatga attgcttctg ggtggagctt 60
ttta 64
<210> 21
<211> 64
<212> DNA
<213>Unknown (Unknown)
<400> 21
gggcgaggtg ggtcttcgtt aagtaagttc tctacttaac gaagacccac ctcgaaaaat 60
tcga 64
<210> 22
<211> 60
<212> DNA
<213>Unknown (Unknown)
<400> 22
gatccccgac acgcgacttg taccacttca agagagtggt acaagtcgcg tgtcttttta 60
<210> 23
<211> 60
<212> DNA
<213>Unknown (Unknown)
<400> 23
gggctgtgcg ctgaacatgg tgaagttctc tcaccatgtt cagcgcacag aaaaattcga 60
Claims (9)
1. interfere application of the reagent of long-chain non-coding RNA PVT1 expression in nasopharyngeal carcinoma auxiliary treatment preparation is prepared;The long-chain
The sequence of non-coding RNA such as SEQ NO:Shown in 1.
2. application process according to claim 1, which is characterized in that the interference long-chain non-coding RNA PVT1 expression
Reagent needed for 3 interfered target sequences it is as follows:
shRNA-1:GGACTTGAGAACTGTCCTTA
shRNA-2:GCTTCTCCTGTTGCTGCTAGT
shRNA-3:GCTCCACCCAGAAGCAATTCA.
3. application process according to claim 2, which is characterized in that the interference long-chain non-coding RNA PVT1 expression
Reagent be using interfered target sequence prepare RNA interference short hairpin RNA expression vector.
4. application process according to claim 3, which is characterized in that for 3 interfered target sequences and carrier, if
Meter can be formed hairpin structure oligonucleotides is single-stranded and its reverse complementary sequence, they can form both ends band limit respectively after annealing
The DNA double chain of property restriction enzyme site cohesive end processed;Particular sequence is as follows:
shRNA-1:
5’-GATCCCC GGACTTGAGAACTGTCCTTA TTCAAGAGA GTAAGGACAGTTCTCAAGTCC TTTTTA-3’
3’-GGG CCTGAACTCTTGACAGGAATG AAGTTCTCT CATTCCTGTCAAGAGTTCAGG AAAAATTCGA-
5’shRNA-2:
5’-GATCCCC GCTTCTCCTGTTGCTGCTAGT TTCAAGAGA ACTAGCAGCAACAGGAGAAGC TTTTTA-
3’
3’-GGG CGAAGAGGACAACGACGATCA AAGTTCTCT TGATCGTCGTTGTCCTCTTCG AAAAATTCGA-
5’shRNA-3:
5’-GATCCCC GCTCCACCCAGAAGCAATTCA TTCAAGAGA TGAATTGCTTCTGGGTGGAGC TTTTTA-
3’
3’-GGG CGAGGTGGGTCTTCGTTAAGT AAGTTCTCT ACTTAACGAAGACCCACCTCG AAAAATTCGA-
5’。
5. application process according to claim 3, which is characterized in that the short hairpin RNA expression for RNA interference
The preparation method of carrier is specific as follows:
1) design of shRNA
First according to long-chain non-coding RNA PVT1, shRNA target spots are found, 3 target sequences are as follows:
shRNA-1:GGACTTGAGAACTGTCCTTA
shRNA-2:GCTTCTCCTGTTGCTGCTAGT
shRNA-3:GCTCCACCCAGAAGCAATTCA
There is no the Scramble sequences of any target spot in human genome as negative control using widely used, sequence is such as
Under:
Scramble:GACACGCGACTTGTACCAC
It 2) can shape for this 3 target sequences and Scramble sequences and OligoEngine companies pSUPER carriers, design
Oligonucleotides into hairpin structure is single-stranded and its reverse complementary sequence, they can form both ends band restriction enzyme respectively after annealing
The DNA double chain of enzyme site BglII and HindIII cohesive end;Each oligonucleotide sequence that need to specifically synthesize and their pairings
The DNA double chain formed after retracting is as follows:
shRNA-1:
5’-GATCCCC GGACTTGAGAACTGTCCTTA TTCAAGAGA GTAAGGACAGTTCTCAAGTCC TTTTTA-3’
3’-GGG CCTGAACTCTTGACAGGAATG AAGTTCTCT CATTCCTGTCAAGAGTTCAGG AAAAATTCGA-
5’shRNA-2:
5’-GATCCCC GCTTCTCCTGTTGCTGCTAGT TTCAAGAGA ACTAGCAGCAACAGGAGAAGC TTTTTA-
3’
3’-GGG CGAAGAGGACAACGACGATCA AAGTTCTCT TGATCGTCGTTGTCCTCTTCG AAAAATTCGA-
5’shRNA-3:
5’-GATCCCC GCTCCACCCAGAAGCAATTCA TTCAAGAGA TGAATTGCTTCTGGGTGGAGC TTTTTA-
3’
3’-GGG CGAGGTGGGTCTTCGTTAAGT AAGTTCTCT ACTTAACGAAGACCCACCTCG AAAAATTCGA-
5’Scramble
5’-GATCCCC GACACGCGACTTGTACCAC TTCAAGAGA GTGGTACAAGTCGCGTGTC TTTTTA-3’
3’-GGG CTGTGCGCTGAACATGGTG AAGTTCTCT CACCATGTTCAGCGCACAG AAAAATTCGA-5’
3) shRNA vector constructions
Above-mentioned 3 shRNA of chemical synthesis and 8 single-stranded oligo sequences of control, by synthetic oligo oligo
Annealing buffer are dissolved into 20 μM, and complementary single strand respectively takes 10 μ l to mix;Then by oligo mixtures 95 in PCR instrument
DEG C heating 5 minutes, then cooled to room temperature forms double-strand oligo segments;
With Bgl II and Hind III double digestion pSUPER plasmids, the carrier segments of 3.1kb are recycled, by the cohesive end after annealing
DNA and digestion recycling carrier according to 3:The ratio mixing of the amount of 1 substance, with T4 ligases, 16 DEG C of connections are overnight;Conversion
E.coil competence selects transformant, bacterium colony PCR and sequencing identification, then the pSUPER built with Cla I and I digestions of EcoR
Plasmid, 2% agarose DNA gel electrophoresis using blank pSUPER as blank control, judge to insert positive gram of target fragment
The pcSUPER plasmid transformed competence colibacillus Escherichia coli comprising PVT1 interference sequences that are grand, will obtaining, to expand plasmid.
6. application process according to claim 3, which is characterized in that the expression vector is loaded into poly-D-lysine
Nanosphere is made on the nano silicon particles of modification.
7. application process according to claim 6, which is characterized in that
The nano silicon particles of polylysine modification are to carry out silicon with the microemulsion self-assembling technique of OP-10, hexamethylene, ammonium hydroxide
The synthesis of nano particle, and poly-D-lysine surface modification can be carried out with ion electrostatic interaction using the surface of nano silicon particles,
It is prepared.
8. application process according to claim 7, which is characterized in that prepare the nano silicon particles of polylysine modification:
1) OP-10, hexamethylene and ammonium hydroxide are mixed, the positive different ester of silicic acid is added in after being stirred at room temperature uniformly, continue stirring to having polymerize
Into, equal-volume acetone is added in, ultrasonic disperse centrifuges, and distilled water washs three times, is collected by centrifugation and is deposited in 80 DEG C of dryings, finely ground
The nano silicon particles of particle size range 10-50nm;Wherein H2O and OP-10 and H2The molar ratio of O and the different ester of positive silicic acid is 2~10, ammonia
Water concentration is 1.6~28%, molar concentration of the different ester of positive silicic acid in hexamethylene is 0.1~3mol/L;
2) nano silicon particles are resuspended in 0.6M NaCO by 0.1~10mg/ml3In solution, supernatant is abandoned in ultrasonic disperse, centrifugation, then
Sediment is resuspended in by 0.1~10mg/ml in the PBS of pH 7.4, ultrasonic disperse, adds polylysine, final concentration of 4~
15nmol/mL, abundant mixing, room temperature, which is mixed, shakes;Centrifugation, abandons supernatant, precipitates and be resuspended in distilled water by 0.1~10mg/ml, obtain
The nano silicon particles of polylysine modification.
9. application process according to claim 7 or 8, which is characterized in that by the nano silicon particles of polylysine modification
Ultrasonic disperse, every milliliter of nano particle suspension add in the interference carrier of 10~50ug long-chain non-coding RNAs PVT1, mixing, room temperature
Standing makes it combine.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810003154.4A CN108186665B (en) | 2018-01-02 | 2018-01-02 | Reagent for interfering expression of long-chain non-coding RNA PVT1 and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810003154.4A CN108186665B (en) | 2018-01-02 | 2018-01-02 | Reagent for interfering expression of long-chain non-coding RNA PVT1 and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN108186665A true CN108186665A (en) | 2018-06-22 |
CN108186665B CN108186665B (en) | 2020-03-20 |
Family
ID=62587512
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810003154.4A Active CN108186665B (en) | 2018-01-02 | 2018-01-02 | Reagent for interfering expression of long-chain non-coding RNA PVT1 and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108186665B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109762823A (en) * | 2019-03-04 | 2019-05-17 | 中南大学 | Circ_1892 and its preparing application in treatment of nasopharyngeal carcinoma preparation and treatment preparation |
Citations (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1268855A2 (en) * | 2000-03-15 | 2003-01-02 | Epigenomics AG | Diagnosis of diseases associated with tumor suppressor genes and oncogenes |
WO2004079014A3 (en) * | 2003-03-04 | 2005-03-31 | Arcturus Bioscience Inc | Signatures of er status in breast cancer |
US20080032943A1 (en) * | 2005-11-04 | 2008-02-07 | Johji Inazawa | Method for detecting cancer and a method for suppressing cancer |
CN105018498A (en) * | 2015-05-12 | 2015-11-04 | 中南大学 | Application method of lnc RNA (long-chain non-coding ribonucleic acid) AFAP1-AS1 |
CN105936904A (en) * | 2015-06-04 | 2016-09-14 | 佛山市第人民医院 | LncRNA molecule ENST00000438553 and application thereof in auxiliary diagnosis of nasopharyngeal carcinoma |
CN106047875A (en) * | 2015-06-04 | 2016-10-26 | 佛山市第人民医院 | LncRNA (long noncoding RNA) molecule and application of lncRNA molecule in auxiliary diagnosis of NPC (nasopharyngeal carcinoma) |
CN106047880A (en) * | 2016-08-18 | 2016-10-26 | 暨南大学 | PVT1 siRNA-1055 for inhibiting blood tumor cell proliferation and application thereof |
US20170130230A1 (en) * | 2015-11-05 | 2017-05-11 | Research Foundation Of The City University Of New York | Methods of using pvt1 exon 9 to diagnose and treat prostate cancer |
CN106754914A (en) * | 2016-11-28 | 2017-05-31 | 江苏省人民医院 | A kind of long non-coding RNA and its application in diagnosis/treatment preeclampsia |
-
2018
- 2018-01-02 CN CN201810003154.4A patent/CN108186665B/en active Active
Patent Citations (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1268855A2 (en) * | 2000-03-15 | 2003-01-02 | Epigenomics AG | Diagnosis of diseases associated with tumor suppressor genes and oncogenes |
WO2004079014A3 (en) * | 2003-03-04 | 2005-03-31 | Arcturus Bioscience Inc | Signatures of er status in breast cancer |
US20080032943A1 (en) * | 2005-11-04 | 2008-02-07 | Johji Inazawa | Method for detecting cancer and a method for suppressing cancer |
CN105018498A (en) * | 2015-05-12 | 2015-11-04 | 中南大学 | Application method of lnc RNA (long-chain non-coding ribonucleic acid) AFAP1-AS1 |
CN105936904A (en) * | 2015-06-04 | 2016-09-14 | 佛山市第人民医院 | LncRNA molecule ENST00000438553 and application thereof in auxiliary diagnosis of nasopharyngeal carcinoma |
CN106047875A (en) * | 2015-06-04 | 2016-10-26 | 佛山市第人民医院 | LncRNA (long noncoding RNA) molecule and application of lncRNA molecule in auxiliary diagnosis of NPC (nasopharyngeal carcinoma) |
US20170130230A1 (en) * | 2015-11-05 | 2017-05-11 | Research Foundation Of The City University Of New York | Methods of using pvt1 exon 9 to diagnose and treat prostate cancer |
CN106047880A (en) * | 2016-08-18 | 2016-10-26 | 暨南大学 | PVT1 siRNA-1055 for inhibiting blood tumor cell proliferation and application thereof |
CN106754914A (en) * | 2016-11-28 | 2017-05-31 | 江苏省人民医院 | A kind of long non-coding RNA and its application in diagnosis/treatment preeclampsia |
Non-Patent Citations (3)
Title |
---|
LABBATE A ET AL: "ACCESSION NO:NR_003367 XM_001129539 XM_928984,Homo sapiens Pvt1 oncogene (non-protein coding) (PVT1),long non-coding RNA", 《GENBANK》 * |
TERESA COLOMBO ET AL: ""PVT1: A Rising Star among Oncogenic Long Noncoding RNAs", 《BIOMED RESEARCH INTERNATIONAL》 * |
朱琳燕: "《临床肿瘤化学药物的治疗》", 31 March 2016 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109762823A (en) * | 2019-03-04 | 2019-05-17 | 中南大学 | Circ_1892 and its preparing application in treatment of nasopharyngeal carcinoma preparation and treatment preparation |
Also Published As
Publication number | Publication date |
---|---|
CN108186665B (en) | 2020-03-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN105233304B (en) | Applications of the long-chain non-coding RNA LOC553103 on nasopharyngeal carcinoma cell inhibitor is prepared | |
CN105018498A (en) | Application method of lnc RNA (long-chain non-coding ribonucleic acid) AFAP1-AS1 | |
CN106929508B (en) | SaRNA for activating PTPRO gene expression and transport vector thereof | |
CN104878009A (en) | Interference preparation based on long non-coding RNA AFAP1-AS1 and application method of interference preparation | |
CN105200152B (en) | Applications of the long-chain non-coding RNA LOC553103 on nasopharyngeal carcinoma prognosis preparation is prepared | |
CN104878100A (en) | Application of long-chain non-coding RNA AFAP1-AS1 in preparation of auxiliary diagnosis and prognosis judgment preparations for lung cancer | |
CN106884016A (en) | The expression vector of long-chain non-coding RNA LINC00472, tumor suppression reagent and its application | |
CN105602951B (en) | The interference preparation of long-chain non-coding RNA LOC284454 and its application | |
CN105506154B (en) | In situ hybridization detects the application of long-chain non-coding RNA LOC284454 reagent in tissues of nasopharyngeal carcinoma | |
CN106492228B (en) | The application of the siRNA of long-chain non-coding RNA LINC00673 and inhibitory preparation | |
CN108186665A (en) | Interfere application of the reagent of long-chain non-coding RNA PVT1 expression in nasopharyngeal carcinoma auxiliary treatment preparation is prepared | |
CN108220436A (en) | Detect application of the reagent of long-chain non-coding RNA PVT1 expression quantity in nasopharyngeal carcinoma diagnosis reagent is prepared | |
CN107937544A (en) | Application of the reagent of in situ hybridization detection long-chain non-coding RNA PVT1 expression quantity in nasopharyngeal carcinoma diagnosis reagent is prepared | |
CN105200156B (en) | Long-chain non-coding RNA LOC553103 application | |
CN105154446B (en) | The application process of the microRNA BART10 antisense oligonucleotides of Epstein-Barr virus coding | |
CN106319044B (en) | Biomarker and its application of a kind of nasopharyngeal carcinoma auxiliary diagnosis or outcome prediction | |
CN108559744A (en) | Interfere application of the reagent of long-chain non-coding RNA PVT1 expression in preparing nasopharyngeal carcinoma radiotherapy sensitizer | |
CN108048572A (en) | Detect application of the reagent of long-chain non-coding RNA PVT1 expression quantity in nasopharyngeal carcinoma prognostic agent is prepared | |
CN106480196B (en) | A kind of application of long-chain non-coding RNA LINC00152 | |
CN105267987B (en) | Applications of the long-chain non-coding RNA LOC553103 on stomach cancer cell inhibitor is prepared | |
CN105483273B (en) | Detect the application of the reagent of long-chain non-coding RNA LOC284454 expression quantity in patients with nasopharyngeal carcinoma | |
CN104894244B (en) | Long-chain non-coding RNA AFAP1 AS1 primer, detection reagent and its application | |
CN106337084B (en) | The in situ hybridization detection reagent and its application of long-chain non-coding RNA LINC01420 | |
CN106511368B (en) | The application of the siRNA of long-chain non-coding RNA LINC00152 and inhibitory preparation | |
CN106381339B (en) | The application process of long-chain non-coding RNA LINC00152 in situ hybridization probes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |