CN108186665A

CN108186665A - Interfere application of the reagent of long-chain non-coding RNA PVT1 expression in nasopharyngeal carcinoma auxiliary treatment preparation is prepared

Info

Publication number: CN108186665A
Application number: CN201810003154.4A
Authority: CN
Inventors: 聂国辉; 谢妮; 熊炜; 苗北平; 肖志强; 曾朝阳; 何奕; 郭灿; 熊芳; 龚朝建; 张姗姗
Original assignee: Central South University; Shenzhen Second Peoples Hospital
Current assignee: Central South University; Shenzhen Second Peoples Hospital
Priority date: 2018-01-02
Filing date: 2018-01-02
Publication date: 2018-06-22
Anticipated expiration: 2038-01-02
Also published as: CN108186665B

Abstract

The invention discloses a kind of applications for interfering the reagent of long-chain non-coding RNA PVT1 expression in nasopharyngeal carcinoma auxiliary treatment preparation is prepared.The present invention is transferred to the interference carrier of targeting PVT1 in Nasopharyngeal Carcinoma Cell Line CNE2 and 5 8F, after the expression for inhibiting PVT1, apoptotic cell ratio significantly increases, and illustrates the reagent of long-chain non-coding RNA PVT1 expression is interfered to can be used in nasopharyngeal carcinoma auxiliary treatment, has significant clinical treatment meaning.

Description

The reagent of long-chain non-coding RNA PVT1 expression is interfered to prepare nasopharyngeal carcinoma auxiliary treatment Application in preparation

Technical field

The invention belongs to oncomolecularbiology fields, and in particular to the reagent of interference long-chain non-coding RNA PVT1 expression Application process in nasopharyngeal carcinoma auxiliary treatment preparation is prepared.

Background technology

The Human Genome Project and its subsequent DNA element encyclopedia plan (The Encyclopedia of DNA Elements Project, ENCODE) achievement in research shows that protein coding gene sequence only accounts for the 1- of human genomic sequence 3%, and in human genome the transcribed sequences of the overwhelming majority for long-chain non-coding RNA (Long non-coding RNA, lncRNA).LncRNA is universally present in various biologies, and with the raising of biological complex degree, lncRNA in genome The ratio of sequence also correspondingly increases, and prompts lncRNA significant during biological evolution.With lncRNA constantly quilts It was found that their function is gradually interpreted, scientists find that lncRNA actively participates in vital movement different layers extensively In the function controlling in face, the field brand-new as one has become the new forward position in international life science field and hot spot.

LncRNA can be as the signal (signal) of functional protein, induction (guide), bait (decoy) or stent (scaffold) various ways such as molecule, in chromatin reconstruct, genetic transcription, translation and the multiple levels such as protein modified regulation and control base The expression of cause, and irreplaceable role is being played including developing, being immunized, during the basic physiologicals such as reproduction, it is prior It is that expression and the functional disturbance of lncRNA are closely connected with a variety of diseases of the mankind including malignant tumour one It rises.Therefore, the function of lncRNA is furtherd investigate, is disclosed by the lncRNA hereditary information transfer modes mediated and expression regulation net Network not only can annotate and illustrate again the structure and function of genome from the angle other than protein coding gene, deeply find The essence and rule of vital movement are expected to recognize from a new visual angle a variety of mankind's common diseases including tumour Pathogenesis, and the Clinics and Practices for these diseases provide new molecular marker and therapy target.

Nasopharyngeal carcinoma is common head-neck malignant tumor occurred frequently, and metastasic cervical lymph nodes easily occur, and prognosis is poor, radiation Treatment is current nasopharyngeal carcinoma clinically main therapeutic scheme, and part Nasopharyngeal Carcinoma Patients are resisted since cancer cell has radiation (Radioresistance), that is, insensitive to radiotherapy, radioactive ray cannot kill tumour cell completely, and remaining is swollen Oncocyte finally recurs, and transfer leads to the death of patient.It participates in research shows that the occurrence and development of this tumour are polygenes, is more Step, multistage complex process, LncRNA may also play important role during the occurrence and development of nasopharyngeal carcinoma, together When lncRNA may also take part in the regulation and control of nasopharyngeal carcinoma cell reflex sensitivity.We utilize lncRNA chips recently, construct The express spectra of lncRNA in Biopsies from Patients with Nasopharyngeal Carcinoma and normal reference sample has therefrom screened some differential expressions in nasopharyngeal carcinoma LncRNAs, through enlarged sample real-time fluorescence quantitative PCR verify, it was demonstrated that lncRNA PVT1 are on nasopharyngeal carcinoma is notable It adjusts, shows that the detection preparation for the lncRNA can be used for the auxiliary diagnosis of nasopharyngeal carcinoma.Then, we further increase sample This, in the nasopharyngeal carcinoma paraffin that 94 have Clinical Follow-up data achieves sample, passes through in situ hybridization (in situ Hybridization method) has detected the expression of PVT1, it is found that the high patient of PVT1 expression is easier generation radiotherapy and supports Anti-, life span is shorter than the lncRNA and expresses low patient, therefore can be used for nose for the detection preparation of the lncRNA The effect of pharynx cancer, predicts and Index for diagnosis.

We target short hairpin RNA (short-hairpin RNA, shRNAs) sequence of PVT1 by designing and synthesizing, The rna interference vector of targeting PVT1 is constructed, is transfected into human nasopharyngeal epithelioma 1, and confirms that the expression of targeting interference PVT1 can The radiation sensitivity of nasopharyngeal carcinoma cell is remarkably reinforced.The silicon that the rna interference vector of PVT1 is loaded to polylysine modification is received Nanoparticulate Carriers for Gene Delivery is made in rice grain, the nano silicon particles of polylysine modification can protect the rna interference vector of PVT1 It degrades from nuclease, extends action time, and have higher transfection efficiency.Therefore it is targeted for the interference preparation of the lncRNA Inhibit expression of the lncRNA in nasopharyngeal carcinoma cell that nasopharyngeal carcinoma cell can be induced more sensitive to radiotherapy, so as to conduct Novel radiation treatment sensitizer, for the auxiliary treatment of nasopharyngeal carcinoma.

Invention content

Reagent the object of the present invention is to provide interference long-chain non-coding RNA PVT1 expression is controlled in preparation nasopharyngeal carcinoma auxiliary Treat the application in preparation；The sequence of the long-chain non-coding RNA such as SEQ NO:Shown in 1.

3 interfered target sequences needed for the reagent of the interference long-chain non-coding RNA PVT1 expression are as follows：

shRNA-1：GGACTTGAGAACTGTCCTTA

shRNA-2：GCTTCTCCTGTTGCTGCTAGT

shRNA-3：GCTCCACCCAGAAGCAATTCA.

The reagent of the interference long-chain non-coding RNA PVT1 expression is interfered using RNA prepared by interfered target sequence Short hairpin RNA expression vector.

For 3 interfered target sequences and carrier, the oligonucleotides that design can form hairpin structure is single-stranded and its reversed Complementary series, they can form DNA double chain of the both ends respectively with restriction enzyme site cohesive end after annealing；Particular sequence It is as follows：shRNA-1：

shRNA-2：

shRNA-3：

The preparation method of the short hairpin RNA expression vector for RNA interference is specific as follows：

1) design of shRNA

First according to long-chain non-coding RNA PVT1, shRNA target spots are found, 3 target sequences are as follows：

shRNA-1：GGACTTGAGAACTGTCCTTA

shRNA-2：GCTTCTCCTGTTGCTGCTAGT

shRNA-3：GCTCCACCCAGAAGCAATTCA

Using the widely used Scramble sequences for not having any target spot in human genome as negative control, sequence Row are as follows：

Scramble：GACACGCGACTTGTACCAC

2) for this 3 target sequences and Scramble sequences and OligoEngine companies pSUPER carriers, design Can be formed hairpin structure oligonucleotides is single-stranded and its reverse complementary sequence, they can form both ends band limitation respectively after annealing The DNA double chain of property restriction enzyme site BglII and HindIII cohesive end；Each oligonucleotide sequence that need to specifically synthesize and they The DNA double chain that pairing is formed after retracting is as follows：

shRNA-1：

shRNA-2：

shRNA-3：

Scramble

3) shRNA vector constructions

Above-mentioned 3 shRNA of chemical synthesis and 8 single-stranded oligo sequences of control, by synthetic oligo oligo Annealing buffer are dissolved into 20 μM, and complementary single strand respectively takes 10 μ l to mix；Then by oligo mixtures 95 in PCR instrument DEG C heating 5 minutes, then cooled to room temperature forms double-strand oligo segments；

With Bgl II and Hind III double digestion pSUPER plasmids, the carrier segments of 3.1kb are recycled, by the viscosity after annealing The DNA of end and the carrier of digestion recycling are according to 3:The ratio mixing of the amount of 1 substance, with T4 ligases, 16 DEG C of connections are overnight； Transformed E .coil competence selects transformant, bacterium colony PCR and sequencing identification, then built with Cla I and I digestions of EcoR PSUPER plasmids, 2% agarose DNA gel electrophoresis, using blank pSUPER as blank control, judgement inserts target fragment Positive colony, the pcSUPER plasmid transformed competence colibacillus Escherichia coli comprising PVT1 interference sequences that will be obtained, to expand plasmid.

The expression vector is loaded to, nanosphere is made on the nano silicon particles of polylysine modification.

The nano silicon particles of polylysine modification be with OP-10, hexamethylene, ammonium hydroxide microemulsion self-assembling technique into The synthesis of row nano silicon particles, and can be repaiied using the surface of nano silicon particles with ion electrostatic interaction progress poly-D-lysine surface Decorations, are prepared.

Prepare the nano silicon particles of polylysine modification：

1) OP-10, hexamethylene and ammonium hydroxide are mixed, the positive different ester of silicic acid is added in after being stirred at room temperature uniformly, continue to stir to poly- It closes and completes, add in equal-volume acetone, ultrasonic disperse centrifuges, and distilled water washs three times, is collected by centrifugation and is deposited in 80 DEG C of dryings, grinds The thin nano silicon particles for obtaining particle size range 10-50nm；Wherein H₂O and OP-10 and H₂The molar ratio of O and the different ester of positive silicic acid for 2~ 10th, ammonia concn is 1.6~28%, molar concentration of the different ester of positive silicic acid in hexamethylene is 0.1~3mol/L；

2) nano silicon particles are resuspended in 0.6M NaCO by 0.1~10mg/ml₃In solution, ultrasonic disperse, centrifugation is abandoned Clearly, then by sediment by 0.1~10mg/ml it is resuspended in the PBS of pH 7.4, ultrasonic disperse adds polylysine, final concentration of 4~15nmol/mL, abundant mixing, room temperature, which is mixed, shakes；Centrifugation, abandons supernatant, precipitates and be resuspended in distilled water by 0.1~10mg/ml, Obtain the nano silicon particles of polylysine modification.

By the nano silicon particles ultrasonic disperse of polylysine modification, every milliliter of nano particle suspension adds in 10~50ug long The interference carrier of chain non-coding RNA PVT1, mixing, is stored at room temperature and makes it combine.

The present invention is transferred to the interference carrier of targeting PVT1 in Nasopharyngeal Carcinoma Cell Line CNE2 and 5-8F, inhibits the expression of PVT1 Afterwards, apoptotic cell ratio significantly increases, and it is auxiliary that the reagent for illustrating long-chain non-coding RNA PVT1 is interfered to express can be used in nasopharyngeal carcinoma Treatment is helped, there is significant clinical treatment meaning.

Description of the drawings

Fig. 1 is that Real-Time Fluorescent Quantitative PCR Technique verifies expression of the lncRNA PVT1 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium Situation, expression of the PVT1 in nasopharyngeal carcinoma (T) in normal nasopharyngeal epithelium (N) than significantly improving.

Fig. 2 is that in situ hybridization detects expressions of the PVT1 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium,

Expression is relatively low in normal nasopharyngeal epithelium (NPE) (has only detected high table in 6 normal nasopharyngeal epithelial tissues Reach, detection expression is low in remaining 27 or does not express), and in 63.8% nasopharyngeal carcinoma (60 in 94 tissues of nasopharyngeal carcinoma) Detect the high expression of PVT1；P<0.001.

The expression that Fig. 3 is PVT1 in nasopharyngeal carcinoma is related to Radiotherapy for Nasopharyngeal Carcinoma sensibility,

In the Nasopharyngeal Carcinoma Patients that 92 have Clinical Follow-up data, 44 resist for radiotherapy (Radioresistant, i.e., pair Radiotherapy is not sensitive enough), 48 are sensitive (Radiosensitive) for radiotherapy, in patient (29) nose of radiotherapy sensitivity group 60.4% PVT1 low expressions in pharynx cancer tissue, and the high expression of PVT1 is detected in radiotherapy resistance group only 11.4% (5)；P< 0.001。

Fig. 4 is the relationship of expression Yu the Nasopharyngeal Carcinoma Patients prognosis of PVT1 in nasopharyngeal carcinoma,

The high expression of PVT1 is related to the poor prognosis of Nasopharyngeal Carcinoma Patients in nasopharyngeal carcinoma, i.e. the trouble of PVT1 high expression (high) The total life span of person (Over-all survival, left) and recurrence-free survival time (Relapse-free sruvival, It is right) it will be significantly lower than PVT1 low expressions or the patient (Low) not expressed.

Fig. 5 is the interference carrier that PVT1 is imported in nasopharyngeal carcinoma cell, can significantly inhibit PVT1 in nasopharyngeal carcinoma cell Expression,

After importing the interference carrier (siPVT1) of targeting PVT1 in Nasopharyngeal Carcinoma Cell Line CNE2 and 5-8F, real-time fluorescence is fixed Amount PCR method has detected the expression of PVT1 in nasopharyngeal carcinoma cell, and the expression of PVT1 is significantly inhibited.Negative control (NC) it is scramble interference carriers.

Fig. 6 be in nasopharyngeal carcinoma cell import PVT1 interference carrier inhibit PVT1 expression after, cell to radiotherapy more Add sensitivity,

The interference carrier (siPVT1) that targeting PVT1 is imported in Nasopharyngeal Carcinoma Cell Line CNE2 and 5-8F inhibits the expression of PVT1 Afterwards, cell receives the radioactive ray irradiation of 0,2,4,6,8Gy dosage respectively, and subsequent cell continues culture 12 days, clones Colony forming Experiment shows to compare with negative control (NC transfects the cell of scramble interference carriers), after inhibiting PVT1 expression, CNE2 and 5- The plastidogenetic colony numbers of 8F significantly reduce, and show that cell is more sensitive to radiotherapy.

Fig. 7 is after the interference carrier inhibition PVT1 expression of PVT1 is imported in nasopharyngeal carcinoma cell, and Apoptosis dramatically increases,

Radioactive ray radiation-induced apoptosis of tumor cells is the main reason for radiotherapy plays killing tumor cell, thin in nasopharyngeal carcinoma The interference carrier of targeting PVT1, after the expression for inhibiting PVT1, flow cytomery nasopharyngeal carcinoma are transferred in born of the same parents system CNE2 and 5-8F The apoptosis situation of cell, the nasopharyngeal carcinoma cell for finding that PVT1 is inhibited to express by radioactive ray after being irradiated, the ratio of apoptotic cell Example is significantly raised, further demonstrates and inhibits the expression of PVT1 that can have the function that radio therapy sensitization.

Specific embodiment

It further illustrates the present invention, is not intended to limit the present invention below in conjunction with specific embodiment.

Embodiment 1, quantitative real-time PCR detection confirm that PVT1 is raised in nasopharyngeal carcinoma

1. materials and methods：

Collect 32 normal nasopharyngeal epithelial tissues and 61 tissues of nasopharyngeal carcinoma, extracted total RNA, 2 μ g RNA through reverse transcription into After cDNA, real-time fluorescence quantitative PCR is carried out.PVT1 forward primers for 5 '-TGG CTG AGA GGG TTG AGA TC-3 ' such as SEQ NO:Shown in 2 and reverse primer 5 '-GCT GTA TGT GCC AAG GTC AC-3 ' such as SEQ NO:Shown in 3.

GAPDH forward primers for control are 5 '-ACCACAGTCCATGCCATCAC-3 ' such as SEQ NO:Shown in 4 and Reverse primer 5 '-TCCACCACCCTGTTGCTGTA-3 ', such as SEQ NO:Shown in 5.

Real-time fluorescence quantitative PCR reaction system

Real-time fluorescence quantitative PCR reaction step

The amplification curve and melting curve of real-time fluorescence quantitative PCR, the expression intensity root of each gene are confirmed after reaction After CT values (threshold cycle values), reference gene (GAPDH) markization, examined and calculated using group t-test P values.

2. result

PVT1 does not express or expresses very low, and the high expression P in tissues of nasopharyngeal carcinoma in normal control tissue<0.001 (Fig. 1)

Embodiment 2, in situ hybridization detection find expressions of the PVT1 in nasopharyngeal carcinoma and its with patient's prognosis and radiotherapy The correlation of sensibility

1. MATERIALS METHODS

1.1 design and synthesize hybridization probe

In order to which using the expression of in-situ hybridization method detection PVT1, we devise detects PVT1 in situ hybridization The oligonucleotide probe of expression and each 3 of two groups of in situ hybridization oligonucleotide probes of positive control.

For the oligonucleotide probe of in situ hybridization detection PVT1 expression：

PVT1 probes 1：5 '-GGTCGGACTAGAAAACCGGTCTTCCTCTAATTTT-3 ' such as SEQ NO:Shown in 6,

PVT1 probes 2：5 '-GAGACTGTAAAAACTTCTCAGGTCTTAGGA-3 ' such as SEQ NO:Shown in 7,

PVT1 probes 3：5 '-CTCATAAAACTCTAACCTCTTAATTCTCGGTCAG-3 ' such as SEQ NO:Shown in 8.

Positive control probe (detection house-keeping gene GAPDH)：

GAPDH probes 1：5'-CCACTTTACCAGAGTTAAAAGCAGCCCTGG-3', such as SEQ NO:Shown in 9,

GAPDH probes 2：5'-CAGTAGAGGCAGGGATGATGTTCTGGAGAG-3', such as SEQ NO:Shown in 10,

GAPDH probes 3：5'-GTCAGAGGAGACCACCTGGTGCTCAGTGTA-3', such as SEQ NO:Shown in 11.

Each gene specific oligonucleotides probe sequence of above-mentioned design is synthesized using chemical synthesis process.

1.2 oligonucleotide probe labelling kits and in situ hybridization detection reagent

Digoxin oligonucleotides tailing reagent (Dig Oligonucleitide Tailing Kit 2^ndGeneration, Roche companies), anti-digoxin-horseradish peroxidase complex detection kit (Anti-Digoxigenin-POD, Fab Fragments, Roche company), the TSA signal amplifying systems (TSA of enhancing detection of expression signal in situ^TM Biotin System, NEL700 kit, PerkinElmer companies), DAB staining kits (Beijing Zhong Shan companies), 20x sodium citrates Buffer solution (saline sodium citrate, SSC), dextran sulfate (Dextran sulphate), deionized formamide (Deionized Formamide), polyadenylic acid (polyadenylic acid, Poly A), poly deoxyadenylic acid (polydeoxyadenylic acid, Poly dA) is denaturalized frog essence DNA (the denatured and sheared of shearing Salmon sperm DNA, ssDNA), yeast transfer RNA (yeast t-RNA, tRNA), dithiothreitol (DTT) (DTT), 50x Deng Han Family name's buffer solution (Denhardts ' s solution), phosphate buffer (PBS buffer), pepsin K, bovine serum albumin(BSA) (BSA), triethanolamine (TEA), TNB Buffer (0.1M Tris-HCl, pH7.5,0.15M NaCL, 0.5%Blocking Reagent), TNT Buffer (0.1M Tris-HCl, pH7.5,0.15MNaCL, 0.05%Tween 20), acetic anhydride block Reagent (Blocking reagent agent, Roche companies).

1.3 other main agents and material

Absolute ethyl alcohol, 90% alcohol, 70% alcohol, 50% alcohol, turpentine oil, distilled water, PBS buffer solution (pH7.2~ 7.4, NaCl 137mmol/L, KCl 2.7mmol/L, Na₂HPO₄4.3mmol/L, KH₂PO₄1.4mmol/L)；3% methanol- Hydrogen peroxide solution (80% methanol and the configuration of 30% hydrogen peroxide)；0.01mol/L citrate buffers (citrate buffer, CB, pH6.0 ± 0.1,9ml 0.1M citric acid solutions and 41ml 0.1M sodium citrate solutions add in interim in 450ml distilled water With postponing correction work liquid pH value again)；0.1% trypsase；Haematoxylin；1% hydrochloride alcohol (1ml concentrated hydrochloric acids+99ml 70% Alcohol is configured)；Mounting glue (PTS Cure Mount II)；Special coverslip (480 × 240mm²) customize in Zhengzhou glass apparatus Factory.Leica low melting points (58 DEG C) paraffin, domestic beeswax, absolute alcohol, dimethylbenzene, 10% neutrality paraformaldehyde (0.01mol/L, PH7.4, DEPC distilled water and PBS buffer solution are prepared), haematoxylin, Yihong, neutral mounting natural gum, coverslip, glass slide.

1.4 label probe

Oligonucleotide probe label is carried out using 3-tailing DIG Olignucleutide Kit, reaction system is such as Under.

100pmol oligonucleotide+ddH₂O=9 μ l (control:control oligonucleutide 5μ l+ddH₂O 4μl)

Mixing slightly centrifuges.37 DEG C of water-bath 30min add 2 μ l EDTA (0.2M, PH 8.0) stopped reactions.

It is purified after 1.5 oligonucleotide probes label

In order to increase the purity of label probe, marked probe need to be purified, concrete operations are as follows：

1) 100% cold ethyl alcohol (- 20 DEG C) of+2.5 μ l 4M LiCL+75 μ l of probe reaction mixture (22 μ l)

2) -70 DEG C of precipitations 60min, or-20 DEG C of 2h.

3) 13.000 × g, 4 DEG C of centrifugation 15min.

4) supernatant is abandoned, is washed with 70% ice-cold (V/V) ethyl alcohol of 50 μ l.

5) 4 DEG C of 13.000xg centrifuge 5min.

6) supernatant, 4 DEG C of dryings of vacuum are abandoned.

7) with the molten probe of aseptic double-distilled water weight.

1.6 in situ hybridizations detection achieves the expression of PVT1 in paraffin section

Paraffin section hybridizes pre-treatment

1) paraffin section of 4 DEG C of preservations is placed in 58 DEG C of roasting piece 30min, melted surface paraffin.

2) dimethylbenzene dewaxes 3 × 5min successively.

3) step ethanol wash, 100% 2 × 2min of alcohol → 95%, 1 × 5min of alcohol → 70%, 1 × 5min of alcohol → 50% 1 × 5min of alcohol → 2 × 3min of DEPC water washings → DEPC-PBS washs 2 × 5min.

4) 300 μ l pepsins K (10 μ g/ml) are added dropwise on slice, 37 DEG C digest 20min.

5) it is sliced and washs 1min, stopped reaction into PBS (0.1M PBS+2mg/ml glutamic acid).

6) it is sliced into 0.2N HCL, reacts 20-30min in 37 DEG C, increase the permeability of tissue.

7) slice fixes 10min, room temperature afterwards with 4% paraformaldehyde (0.1M PBS dissolvings).

8) in order to increase tissue positive intensity for hybridization, acetyl processing is carried out to slice.It is sliced into 0.25% acetic anhydride Buffer I (0.1M triethanolamines), room temperature 10min.

9) 1M PBS wash 2 × 5min.

Prehybridization and hybridization

Prehybridization：The prehybridization solution of -20 DEG C of preservations is first placed in 37 DEG C of incubation 60min, and the dosage of prehybridization solution is 50 μ l, Parafilm is carried out lid and is sliced, prehybridization 2 hours in 37 DEG C of wet box.(prehybridization solution composition includes：2XSSC, 10%Dextran Sulphate, 1X Denhardt ' s solution, 50mM Phosphate Buffer (PH 7.0), 50mM DTT, 250 μ l, 100 μ g/ml poly A, 5 μ g/ml poly dA, 250 μ g/ml yeast t-RNA, 500 μ g/ml ssDNA, 47% Deionized formamide)。

1) parafilm is removed, gets rid of prehybridization solution, slice is placed in 5min in 2 × SSC.

2) hybridization reaction：37 DEG C of hybridized overnights (18-20h).Each slice adds in 250 μ l hybridization solutions and is carried out with parafilm Lid.Corresponding probe is added in prehybridization solution just becomes hybridization solution.Hybridization solution is prepared in prehybridization, is placed 37 DEG C of incubations, is made Probe is completely dissolved in hybridization solution, this experiment is mixed with a plurality of oligonucleotide probe, is matched by each probe 500ng/ml concentration Probe hybridization solution is made.Digoxin tailing labelling kit label probe concentration calculation basis：The concentration of each probe by its with Colour developing is compared and the label reaction theory spy of the naked probe of 30 bases of 100pmol during detection reaction when the positive quantifies probe Needle yield goes out the concentration of label probe for two kinds of standards progress COMPREHENSIVE CALCULATINGs of 900ng.

3) post-hybridization washing, slice immerse 2 × SSC, 10min, throw off parafilm.It is washed successively in shake on shaking table, 2 × SSC (0.5%SDS), 2 × 15min → 0.25 × SSC (0.5%SDS), 2 × 15min.

Color developing detection is reacted after hybridization

1) digoxigenin-probe and mRNA combination compounds are detected using Anti-Digoxigenin-POD；TSA amplification systems Enhance the positive signal of in situ hybridization reaction solution reaction, DAB colour developings.

2) slice is gone in TNT buffer solutions, 3 × 5min.

3) TNB is added dropwise and blocks buffer solution, 300 μ l/TMAs, room temperature, 30min.

4) extra blocking agent is sucked, 1:100 diluted Anti-Digoxigenin-POD (TBS+0.1%Triton X- 100+1% blocking agents), room temperature 4 hours.

5) TNT Buffer (0.1M Tris-CL, pH7.5,0.15M NaCL, 0.05%Tween 20) are washed, 3x5min。

6) signal amplification reagent Biotinyl Tyamid, 300 μ l/TMAs, (Biotinyl Tyramid are added dropwise on slice Store liquid：Biotinyl Tyramid are dissolved in 0.2ml DMSO, Biotinyl Tyramid working solutions：1 × dilution, 1:50 Dilute Biotinyl Tyramid storages liquid), room temperature 10 minutes.

7) TNT is washed, 3 × 5min.

8) SA-HRP (strepto- avidin-horseradish peroxidase), 300 μ l/TMAs, room temperature 30min are added dropwise in slice.

9) TNT is washed, 3 × 5min.

10) distilled water washing, 1 × 1min.

11) DAB develops the color, and chromogenic reaction is controlled under microscope.

12) haematoxylin is redyed,

13) alcohol step is dehydrated, chip drying.

14) mounting glue, the coverslip cover plate of dimension, crosslinking slice 1min under ultraviolet lamp is added dropwise.

1.7 results judge and standard

Application Optics microscope is observed under low power and high power lens respectively, looks first at the positive expression of target RNA Signal is in the intracellular positioning of object observing：Positioned at nucleus, cytoplasm or cell membrane.

It is carried out respectively with two kinds of standards of the intensity of the detection rna expression position positive signal and the cell number of positive expression again Comprehensive score, criterion are：(1) judge according to positive cell dyeing intensity：A. cell dye-free remembers 0 point；B. cell is dyed Light brown is weakly positive, remembers 1 point；C. cell dyes brown and dyes dark-brown without background coloration or cell and have the light brown back of the body Scape is moderate positive, remembers 2 points；D. cell dyes dark-brown and is strong positive without background coloration, remembers 3 points.(2) according to positive cell Express number score：A. no positive cell expression, remembers 0 point；B. positive expression cell number≤25% remembers 1 point；C.25% ＜ is positive thin Born of the same parents' number ＜ 50% remembers 2 points；D. positive expression cell number >=50% remembers 3 points.

It is respective by one of above-mentioned standard respectively by two pathology experts in order to reduce the subjective factor of appraisal result as possible Judged and scored, then the two is scored and is multiplied, result is：1. 0 point of person is finally calculated as 0 point, it is believed that feminine gender expression；2. 1 point 1 point is finally calculated as with 2 points of persons, it is believed that weakly positive is expressed；3. 3 points and 4 points of persons are finally calculated as 2 points, it is believed that moderate positive is expressed；④ 6, which assign to 9 points of persons, is finally calculated as 3 points, it is believed that strong positive is expressed.

1.8 analyses and statistical software

Statistical analysis is carried out to experimental result using SPSS13.0 statistical softwares, compares use χ two-by-two²Test or Fisher Exact test, correlation analysis use Spearmen correlation methods；P ＜ 0.05 are that difference is statistically significant. Survivorship curve analysis is using Kaplan-Meier method and log-rank test；Multi-variables analysis uses Cox ' s proportional hazards model；P ＜ 0.05 are that difference is statistically significant.

2 results

Expression of 2.1 PVT1 in nasopharyngeal carcinoma raising more notable than expression in normal control tissue, and and radiation sensitivity It is related

PVT1 (60/94) in 63.8% tissues of nasopharyngeal carcinoma has high expression, and only in 18.2% (33 normal structures 6 in sample) normal nasopharyngeal epithelial tissue in have high expression (Fig. 2), between the two with apparent significant difference (P< 0.001).In 94 Nasopharyngeal Carcinoma Patients, 92 have a Clinical Follow-up data, 44 resist for radiotherapy (Radioresistant, i.e., It is not sensitive enough to radiotherapy), 48 are sensitive (Radiosensitive) for radiotherapy, in the patient (29) of radiotherapy sensitivity group 60.4% PVT1 low expressions in tissues of nasopharyngeal carcinoma, and the high expression of PVT1 is detected in radiotherapy resistance group only 11.4% (5)；P< 0.001.(Fig. 3)

The Nasopharyngeal Carcinoma Patients prognosis of 2.2 PVT1 high expression is poor

We have carried out Effect of follow-up visit by telephone to 92 Nasopharyngeal Carcinoma Patients, inquired in detail they start time, treatment, Recurrence is whether there is, whether there is and suffers from other diseases, recurrence and death time etc. again, and register life span and state, and to nasopharyngeal carcinoma The survival analysis that the expression of PVT1 and the life span of patient and state carry out in tissue finds that PVT1 high expression patients are averagely raw Depositing the time is significantly shorter than PVT1 low expressions or the patient not expressed (Fig. 4).It is one relevant with nasopharyngeal carcinoma prognosis to illustrate PVT1 Molecular labeling, lncRNA expression is high, patient's poor prognosis.

Embodiment 3, the expression of structure shRNA carrier interference PVT1

1. MATERIALS METHODS

1.1 reagents and kit

Restriction enzyme Hind III, Bgl II, EcoR I and Cla I, T4DNA ligase etc. are public purchased from TakaRa Department；

TRIZOL^TMReagent(Invitrogen)；

Plasmid extraction kit (#D6943-01, OMEGA)；

Plastic recovery kit (#M5212, OMEGA)；

Reverse Transcriptase kit (#A3500, Promega)；

Antibiotic G418 (Ameresc).

The design of 1.2shRNA

First by the Block-It RNAi designer softwares of PVT1 sequence inputting Invitrogen companies, finding should It is as follows to select the corresponding target sequence of best 3 for the shRNA best targets of lncRNA：

shRNA-1：GGACTTGAGAACTGTCCTTA such as SEQ NO:Shown in 12,

shRNA-2：GCTTCTCCTGTTGCTGCTAGT such as SEQ NO:Shown in 13,

shRNA-3：GCTCCACCCAGAAGCAATTCA such as SEQ NO:Shown in 14,

Scramble：5 '-GACACGCGACTTGTACCAC-3 ' such as SEQ NO:Shown in 15.

For this 3 lncRNA target sequences and Scramble sequences, according to OligoEngine companies pSUPER carriers Specification, design can be formed hairpin structure oligonucleotides is single-stranded and its reverse complementary sequence, they can form two after annealing Hold the DNA double chain respectively with restriction enzyme site BglII and HindIII cohesive end.Each few nucleosides that need to specifically synthesize The DNA double chain formed after acid sequence and their pairing annealing is as follows：

shRNA-1：

Such as SEQ NO:16th, shown in 17,

shRNA-2：

Such as SEQ NO:18th, shown in 19,

shRNA-3：

Such as SEQ NO:20th, shown in 21,

Scramble

Such as SEQ NO:22nd, shown in 23.

After the DNA annealing of two complementary pairings, the left side is the cohesive end of restriction enzyme Bgl II, and the right is Hind The cohesive end of III.

1.3shRNA vector construction

The corresponding 8 single-stranded oligo sequences of above-mentioned 4 shRNA of chemical synthesis, by synthetic oligo oligo Annealingbuffer is dissolved into 20 μM, and complementary single strand respectively takes 10 μ l to mix.Then by oligo mixtures 95 DEG C in PCR instrument Heating 5 minutes, then cooled to room temperature, forms double-strand oligo segments.

With Bgl II and Hind III double digestion pSUPER plasmids, the carrier segments of 3.1kb are recycled, by the viscosity after annealing The DNA of end and the carrier of digestion recycling are according to 3:The ratio mixing of 1 amount of substance, with T4 ligases, 16 DEG C of connections are overnight.Turn Change E.coil competence, select transformant, bacterium colony PCR and sequencing identification, then built with Cla I and I digestions of EcoR PSUPER plasmids, 2% agarose DNA gel electrophoresis, using blank pSUPER as blank control, judgement inserts target fragment Positive colony, for the expression of PVT1 in interference cell after positive colony sequencing verification.

1.4 cell culture and transfection

Nasopharyngeal Carcinoma Cell Line CNE2 and 5-8F are purchased from Central South University's cell centre, and RPMI 1640 used in cell culture trains base And fetal calf serum and trypsase used in vitellophag are U.S.'s Gibco Products.

The good Nasopharyngeal Carcinoma Cell Line CNE2 and 5-8F of growth conditions is pressed 2 × 10⁵A cells/well is inoculated in 6 orifice plates, 6 orifice plates are placed in 37 DEG C, 5%CO₂In incubator, cell growth to be cultivated to 50-70% density can start shRNA expression and carry The transfection of body；Transfection process is as follows：

The lipofectamine 2000 of the 3 μ l mixing in 100 μ l serum free mediums is added in sterile EP pipes to stand 5min；

The shRNA expression vectors of structure are added in 100 μ l serum free mediums；Then it is included with above-mentioned The 100 mild mixings of μ l serum free mediums of lipofectamine, are stored at room temperature 30 minutes, DNA are made to be formed with liposome compound Body；

Cell is washed with D-Hank's liquid 3 times；

800 μ l serum free mediums (antibiotic-free) will be added in said mixture, are added in 6 orifice plates after mild mixing 1 hole；

6 orifice plates are placed in CO₂In incubator, 37 DEG C are cultivated 6 hours, then abandon supernatant, are added in complete medium and are continued to train It supports 48 hours.

The effect of 1.5 real-time quantitative PCRs detection shRNA interference lncRNA expression：

Nasopharyngeal carcinoma cell extracted total RNA after various shRNA carriers are transfected, 2 μ g RNA through reverse transcription into after cDNA, into Row real-time fluorescence quantitative PCR.PVT1 primers are 5 '-TGG CTG AGA GGG TTG AGA TC-3 ' and 5 '-GCTGTA TGT GCC AAG GTC AC-3’。

For control GAPDH primers for 5 '-ACCACAGTCCATGCCATCAC-3 ' and 5 '- TCCACCACCCTGTTGCTGTA-3’,

Real-time fluorescence quantitative PCR reaction system

Real-time fluorescence quantitative PCR reaction step

2. result

After these three shRNA carriers transfection nasopharyngeal carcinoma cell CNE2 and 5-8F, can significantly it lower in nasopharyngeal carcinoma cell The expression (Fig. 5) of PVT1.

Embodiment 4, the nano particle for preparing load shRNA interference carriers inhibit the expression of PVT1 in nasopharyngeal carcinoma cell

1. MATERIALS METHODS

1.1 prepare the coated nano silicon particles of poly-D-lysine

The coated nano silicon particles of poly-D-lysine are carried out with OP10/ hexamethylenes/ammonia microemulsion self-assembling technique The synthesis of nano silicon particles (silica nanoparticle, SiNP), and can and pass through ion using the surface of nano silicon particles Electrostatic interaction prepares the nano silicon particles of polylysine modification；The nano particle can be prepared by following methods：

1) OP-10, hexamethylene and ammonium hydroxide are mixed, adds in the positive different ester of silicic acid (TEOS) after being stirred at room temperature uniformly, continue to stir Mix to polymerization and complete, add in equal-volume acetone, ultrasonic disperse, centrifugation, distilled water washs three times, be collected by centrifugation be deposited in 80 DEG C it is dry It is dry, it is finely ground to obtain nano silicon particles (SiNP).Wherein H₂O and OP-10 and H₂The molar ratio of O and TEOS is 2~10, ammonia concn is 1.6~28%, molar concentrations of the TEOS in hexamethylene is 0.1~3mol/L.

2) SiNP is resuspended in 0.6M NaCO by 0.1~10mg/ml₃In solution, supernatant is abandoned in ultrasonic disperse, centrifugation, then Sediment is resuspended in by 0.1~10mg/ml in PBS (pH 7.4), ultrasonic disperse, add polylysine (final concentration of 4~ 15nmol/mL), abundant mixing, room temperature, which is mixed, shakes；Centrifugation, abandons supernatant, and precipitation is resuspended in distilled water, obtains poly-D-lysine and repair The nano silicon particles of decorations.Final concentration of 4~15nmol/mL of poly-D-lysine.

1) by modified nano silicon particles ultrasonic disperse, in mass ratio 5~30:1 with the targeting PVT1's described in embodiment 3 Rna interference vector mixes, and is stored at room temperature and makes it combine.

1.2 cell culture and transfection

Growth conditions good nasopharyngeal carcinoma cell 5-8F, HK2 and HNE2 are pressed 2 × 10⁵A cells/well is inoculated in 6 orifice plates In, 6 orifice plates are placed in 37 DEG C, 5%CO₂In incubator, cell growth to be cultivated to 50-70% density can start PVT1 eukaryons The transfection of expression vector；Transfection process is as follows：

The silicon of the polylysine modification of carrying PVT1 eukaryon expression plasmids that 100 μ l are prepared is added in sterile EP pipes Nano particle suspension, with the 100 mild mixings of μ l serum free mediums；Cell is washed with D-Hank's liquid 3 times；By said mixture It is middle to add in 800 μ l serum free mediums (antibiotic-free), add in 1 hole in 6 orifice plates after mild mixing；6 orifice plates are placed in CO₂ In incubator, 37 DEG C are cultivated 6 hours, then abandon supernatant, are added in complete medium and are continued overnight incubation.With carrying Scramble sequences The nano silicon particles of the polylysine modification of row are as experiment contrast.

1.3 radiation sensitivities experiment 1 --- Clone formation

Influence of the PVT1 expression to nasopharyngeal carcinoma cell radiation sensitivity is inhibited to be confirmed with the experiment of clone's colony.It transfects PVT1shRNA interference carriers or the nasopharyngeal carcinoma cell of control vector (scramble) are inoculated in 6 orifice plates, give 0,2,4,6 respectively, Cell, is then placed in incubator and continues culture 12 days by the radioactive ray irradiation of 8 Gy, removes culture medium, and living cells is with 0.5% Violet staining, take pictures under the microscope, observe and count Clone formation situation.

1.4 radiation sensitivities experiment 2 --- detection Apoptosis

Radioactive ray radiation-induced apoptosis of tumor cells is the main reason for radiotherapy plays killing tumor cell.It transfects PVT1shRNA interference carriers or the nasopharyngeal carcinoma cell of control vector (scramble) are inoculated in 6 orifice plates, after cell is adherent, point 0 (being equivalent to blank control) is not given or the irradiation of 6Gy radioactive ray, vitellophag after 48 hours use apoptosis test regent Fluorescent dye in box (be purchased from BD companies) is incubated altogether with cell, then with flow cytomery, and is analyzed each group cell and is withered Die situation.

2. result

After 2.1 interference carriers that PVT1 is imported in nasopharyngeal carcinoma cell inhibit PVT1, cell irradiates radioactive ray quicker Sense

Colony formation confirms, the interference carrier of targeting PVT1, suppression are transferred in Nasopharyngeal Carcinoma Cell Line CNE2 and 5-8F After the expression of PVT1 processed, after the irradiation of the radioactive ray of same dose, the number that can be survived and grow up to cell clone significantly reduces, Show that cell is more sensitive to radioactive ray (Fig. 6).

After 2.2 interference carriers that PVT1 is imported in nasopharyngeal carcinoma cell inhibit PVT1 expression, Apoptosis ratio increases

The interference carrier of targeting PVT1 is transferred in Nasopharyngeal Carcinoma Cell Line CNE2 and 5-8F, after the expression for inhibiting PVT1, is withered Dying cell proportion significantly increases (Fig. 7).

Sequence table

<110>Central South University

<120>Interfere application of the reagent of long-chain non-coding RNA PVT1 expression in nasopharyngeal carcinoma auxiliary treatment preparation is prepared

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1957

<212> RNA

<213>Homo sapiens (Homo sapiens)

<400> 1

cuccgggcag agcgcgugug gcggccgagc acaugggccc gcgggccggg cgggcucggg 60

gcggccggga cgaggagggg cgacgacgag cugcgagcaa agaugugccc cgggaccccc 120

ggcaccuucc aguggauuuc cuugcggaaa ggauguuggc ggucccugug accuguggag 180

acacggccag aucugcccuc cagccugauc uuuuggccag aaggagauua aaaagaugcc 240

ccucaagaug gcugugccug ucagcugcau ggagcuucgu ucaaguauuu ucugagccug 300

auggauuuac agugaucuuc aguggucugg ggaauaacgc ugguggaacc augcacugga 360

augacacacg cccggcacau uucaggauac uaaaaguggu uuuaagggag gcuguggcug 420

aaugccucau ggauucuuac agcuuggaug uccauggggg acgaaggacu gcagcuggcu 480

gagaggguug agaucucugu uuacuuagau cucugccaac uuccuuuggg ucucccuaug 540

gaauguaaga ccccgacucu uccuggugaa gcaucugaug cacguuccau ccggcgcuca 600

gcugggcuug agcugaccau acucccugga gccuucuccc gaggugcgcg ggugaccuug 660

gcacauacag ccaucaugau gguacuuuaa guggaggcug aaucaucucc ccuuugagcu 720

gcuuggcacg uggcucccuu gguguucccc uuuuacugcc aggacacuga gauuuggaga 780

gagucucacu cuguggucca ggcugaagua caguggcaug aucccagguc acugcaaccc 840

ccaccucccg gguucaagug auccuccugc cucagccucc cgaguagcug guauuacagg 900

cgugugccac aaagccuggc uaaguuuugu auuuuuagua gagacggggu uucaccaugu 960

uggccagguu ggucucgaac uccugaccuc aagugaucca cucacuuugg ccuuucaacg 1020

ugcugggauu acaggcgaga gucaccgcac ccggacgacu cugacauuuu ugaagagucc 1080

agaauccugu uacaccuggg auuuaggcac uuucaaucug aaaaaauaca uauccuuuca 1140

gcacucugga cggacuugag aacuguccuu acgugaccua aagcuggagu auuuugagau 1200

uggagaauua agagccaguc uuggugcucu guguucaccu gguucaucug aggagcugca 1260

ucuacccugc ccaugccaua gauccugccc uguuugcuuc uccuguugcu gcuaguggac 1320

augagaagga cagaauaacg ggcucccaga uucacaagcc ccaccaagag gaucacccca 1380

ggaacgcuug gaggcugagg aguucacuga ggcuacugca ucuugagacu caggaugaag 1440

acccagcuug gggcugucaa agaggccuga agaggcagaa caccccagag gagccugggg 1500

ccaccaccca gcaucacugu gggaaaacgg cagcaggaaa uguccucucg ccugcgugcu 1560

ccaccucggu ccacgccuuc ccuccuucug gaagccuugc cugaccacug gccugccccu 1620

ucuaugggaa ucacuacuga ccuugcagcu uauuauagac uuauauguuu uuugcauguc 1680

ugacacccau gacuccaccu ggaccuuaug gcuccaccca gaagcaauuc agcccaacag 1740

gaggacagcu ucaacccauu acgauuucau cucugcccca accacucagc agcaagcacc 1800

uguuaccugu ccacccccac cccuuccccc aaacugccuu ugaaaaaucc cuaaccuaug 1860

agcuuugaau aagaugagua cgaacuucau cgcccacgug gcguggccgg ccucgugucu 1920

auuaaauucu uuuucuacua aaaaaaaaaa aaaaaaa 1957

<210> 2

<211> 20

<212> DNA

<213>Unknown (Unknown)

<400> 2

tggctgagag ggttgagatc 20

<210> 3

<211> 20

<212> DNA

<213>Unknown (Unknown)

<400> 3

gctgtatgtg ccaaggtcac 20

<210> 4

<211> 20

<212> DNA

<213>Unknown (Unknown)

<400> 4

accacagtcc atgccatcac 20

<210> 5

<211> 20

<212> DNA

<213>Unknown (Unknown)

<400> 5

tccaccaccc tgttgctgta 20

<210> 6

<211> 34

<212> DNA

<213>Unknown (Unknown)

<400> 6

ggtcggacta gaaaaccggt cttcctctaa tttt 34

<210> 7

<211> 30

<212> DNA

<213>Unknown (Unknown)

<400> 7

gagactgtaa aaacttctca ggtcttagga 30

<210> 8

<211> 34

<212> DNA

<213>Unknown (Unknown)

<400> 8

ctcataaaac tctaacctct taattctcgg tcag 34

<210> 9

<211> 30

<212> DNA

<213>Unknown (Unknown)

<400> 9

ccactttacc agagttaaaa gcagccctgg 30

<210> 10

<211> 30

<212> DNA

<213>Unknown (Unknown)

<400> 10

cagtagaggc agggatgatg ttctggagag 30

<210> 11

<211> 30

<212> DNA

<213>Unknown (Unknown)

<400> 11

gtcagaggag accacctggt gctcagtgta 30

<210> 12

<211> 20

<212> DNA

<213>Unknown (Unknown)

<400> 12

ggacttgaga actgtcctta 20

<210> 13

<211> 21

<212> DNA

<213>Unknown (Unknown)

<400> 13

gcttctcctg ttgctgctag t 21

<210> 14

<211> 21

<212> DNA

<213>Unknown (Unknown)

<400> 14

gctccaccca gaagcaattc a 21

<210> 15

<211> 19

<212> DNA

<213>Unknown (Unknown)

<400> 15

gacacgcgac ttgtaccac 19

<210> 16

<211> 63

<212> DNA

<213>Unknown (Unknown)

<400> 16

gatccccgga cttgagaact gtccttattc aagagagtaa ggacagttct caagtccttt 60

tta 63

<210> 17

<211> 64

<212> DNA

<213>Unknown (Unknown)

<400> 17

gggcctgaac tcttgacagg aatgaagttc tctcattcct gtcaagagtt caggaaaaat 60

tcga 64

<210> 18

<211> 64

<212> DNA

<213>Unknown (Unknown)

<400> 18

gatccccgct tctcctgttg ctgctagttt caagagaact agcagcaaca ggagaagctt 60

ttta 64

<210> 19

<211> 64

<212> DNA

<213>Unknown (Unknown)

<400> 19

gggcgaagag gacaacgacg atcaaagttc tcttgatcgt cgttgtcctc ttcgaaaaat 60

tcga 64

<210> 20

<211> 64

<212> DNA

<213>Unknown (Unknown)

<400> 20

gatccccgct ccacccagaa gcaattcatt caagagatga attgcttctg ggtggagctt 60

ttta 64

<210> 21

<211> 64

<212> DNA

<213>Unknown (Unknown)

<400> 21

gggcgaggtg ggtcttcgtt aagtaagttc tctacttaac gaagacccac ctcgaaaaat 60

tcga 64

<210> 22

<211> 60

<212> DNA

<213>Unknown (Unknown)

<400> 22

gatccccgac acgcgacttg taccacttca agagagtggt acaagtcgcg tgtcttttta 60

<210> 23

<211> 60

<212> DNA

<213>Unknown (Unknown)

<400> 23

gggctgtgcg ctgaacatgg tgaagttctc tcaccatgtt cagcgcacag aaaaattcga 60

Claims

1. interfere application of the reagent of long-chain non-coding RNA PVT1 expression in nasopharyngeal carcinoma auxiliary treatment preparation is prepared；The long-chain The sequence of non-coding RNA such as SEQ NO:Shown in 1.

2. application process according to claim 1, which is characterized in that the interference long-chain non-coding RNA PVT1 expression Reagent needed for 3 interfered target sequences it is as follows：

shRNA-1：GGACTTGAGAACTGTCCTTA

shRNA-2：GCTTCTCCTGTTGCTGCTAGT

shRNA-3：GCTCCACCCAGAAGCAATTCA.

3. application process according to claim 2, which is characterized in that the interference long-chain non-coding RNA PVT1 expression Reagent be using interfered target sequence prepare RNA interference short hairpin RNA expression vector.

4. application process according to claim 3, which is characterized in that for 3 interfered target sequences and carrier, if Meter can be formed hairpin structure oligonucleotides is single-stranded and its reverse complementary sequence, they can form both ends band limit respectively after annealing The DNA double chain of property restriction enzyme site cohesive end processed；Particular sequence is as follows：

shRNA-1：

5’-GATCCCC GGACTTGAGAACTGTCCTTA TTCAAGAGA GTAAGGACAGTTCTCAAGTCC TTTTTA-3’

3’-GGG CCTGAACTCTTGACAGGAATG AAGTTCTCT CATTCCTGTCAAGAGTTCAGG AAAAATTCGA- 5’shRNA-2：

5’-GATCCCC GCTTCTCCTGTTGCTGCTAGT TTCAAGAGA ACTAGCAGCAACAGGAGAAGC TTTTTA- 3’

3’-GGG CGAAGAGGACAACGACGATCA AAGTTCTCT TGATCGTCGTTGTCCTCTTCG AAAAATTCGA- 5’shRNA-3：

5’-GATCCCC GCTCCACCCAGAAGCAATTCA TTCAAGAGA TGAATTGCTTCTGGGTGGAGC TTTTTA- 3’

3’-GGG CGAGGTGGGTCTTCGTTAAGT AAGTTCTCT ACTTAACGAAGACCCACCTCG AAAAATTCGA- 5’。

5. application process according to claim 3, which is characterized in that the short hairpin RNA expression for RNA interference The preparation method of carrier is specific as follows：

1) design of shRNA

shRNA-1：GGACTTGAGAACTGTCCTTA

shRNA-2：GCTTCTCCTGTTGCTGCTAGT

shRNA-3：GCTCCACCCAGAAGCAATTCA

There is no the Scramble sequences of any target spot in human genome as negative control using widely used, sequence is such as Under：

Scramble：GACACGCGACTTGTACCAC

It 2) can shape for this 3 target sequences and Scramble sequences and OligoEngine companies pSUPER carriers, design Oligonucleotides into hairpin structure is single-stranded and its reverse complementary sequence, they can form both ends band restriction enzyme respectively after annealing The DNA double chain of enzyme site BglII and HindIII cohesive end；Each oligonucleotide sequence that need to specifically synthesize and their pairings The DNA double chain formed after retracting is as follows：

shRNA-1：

5’-GATCCCC GGACTTGAGAACTGTCCTTA TTCAAGAGA GTAAGGACAGTTCTCAAGTCC TTTTTA-3’

5’-GATCCCC GCTTCTCCTGTTGCTGCTAGT TTCAAGAGA ACTAGCAGCAACAGGAGAAGC TTTTTA- 3’

5’-GATCCCC GCTCCACCCAGAAGCAATTCA TTCAAGAGA TGAATTGCTTCTGGGTGGAGC TTTTTA- 3’

3’-GGG CGAGGTGGGTCTTCGTTAAGT AAGTTCTCT ACTTAACGAAGACCCACCTCG AAAAATTCGA- 5’Scramble

5’-GATCCCC GACACGCGACTTGTACCAC TTCAAGAGA GTGGTACAAGTCGCGTGTC TTTTTA-3’

3’-GGG CTGTGCGCTGAACATGGTG AAGTTCTCT CACCATGTTCAGCGCACAG AAAAATTCGA-5’

3) shRNA vector constructions

With Bgl II and Hind III double digestion pSUPER plasmids, the carrier segments of 3.1kb are recycled, by the cohesive end after annealing DNA and digestion recycling carrier according to 3:The ratio mixing of the amount of 1 substance, with T4 ligases, 16 DEG C of connections are overnight；Conversion E.coil competence selects transformant, bacterium colony PCR and sequencing identification, then the pSUPER built with Cla I and I digestions of EcoR Plasmid, 2% agarose DNA gel electrophoresis using blank pSUPER as blank control, judge to insert positive gram of target fragment The pcSUPER plasmid transformed competence colibacillus Escherichia coli comprising PVT1 interference sequences that are grand, will obtaining, to expand plasmid.

6. application process according to claim 3, which is characterized in that the expression vector is loaded into poly-D-lysine Nanosphere is made on the nano silicon particles of modification.

7. application process according to claim 6, which is characterized in that

The nano silicon particles of polylysine modification are to carry out silicon with the microemulsion self-assembling technique of OP-10, hexamethylene, ammonium hydroxide The synthesis of nano particle, and poly-D-lysine surface modification can be carried out with ion electrostatic interaction using the surface of nano silicon particles, It is prepared.

8. application process according to claim 7, which is characterized in that prepare the nano silicon particles of polylysine modification：

1) OP-10, hexamethylene and ammonium hydroxide are mixed, the positive different ester of silicic acid is added in after being stirred at room temperature uniformly, continue stirring to having polymerize Into, equal-volume acetone is added in, ultrasonic disperse centrifuges, and distilled water washs three times, is collected by centrifugation and is deposited in 80 DEG C of dryings, finely ground The nano silicon particles of particle size range 10-50nm；Wherein H₂O and OP-10 and H₂The molar ratio of O and the different ester of positive silicic acid is 2~10, ammonia Water concentration is 1.6~28%, molar concentration of the different ester of positive silicic acid in hexamethylene is 0.1~3mol/L；

2) nano silicon particles are resuspended in 0.6M NaCO by 0.1~10mg/ml₃In solution, supernatant is abandoned in ultrasonic disperse, centrifugation, then Sediment is resuspended in by 0.1~10mg/ml in the PBS of pH 7.4, ultrasonic disperse, adds polylysine, final concentration of 4~ 15nmol/mL, abundant mixing, room temperature, which is mixed, shakes；Centrifugation, abandons supernatant, precipitates and be resuspended in distilled water by 0.1~10mg/ml, obtain The nano silicon particles of polylysine modification.

9. application process according to claim 7 or 8, which is characterized in that by the nano silicon particles of polylysine modification Ultrasonic disperse, every milliliter of nano particle suspension add in the interference carrier of 10~50ug long-chain non-coding RNAs PVT1, mixing, room temperature Standing makes it combine.