CN105018498A - Application method of lnc RNA (long-chain non-coding ribonucleic acid) AFAP1-AS1 - Google Patents
Application method of lnc RNA (long-chain non-coding ribonucleic acid) AFAP1-AS1 Download PDFInfo
- Publication number
- CN105018498A CN105018498A CN201510512545.5A CN201510512545A CN105018498A CN 105018498 A CN105018498 A CN 105018498A CN 201510512545 A CN201510512545 A CN 201510512545A CN 105018498 A CN105018498 A CN 105018498A
- Authority
- CN
- China
- Prior art keywords
- afap1
- shrna
- rna
- application method
- silicon particles
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an application method of an lnc RNA (long-chain non-coding ribonucleic acid) AFAP1-AS1 gene, and particularly provides an application method of the lnc RNA gene for preparation of interference and inhibition agents. According to the gene sequence, a short-hairpin RNA eukaryotic expression vector for RNA interference and closing of lnc RNA expression is designed and synthesized, the vector is loaded to polylysine modified silica nanoparticles to prepare nanospheres, by the aid of the vector, AFAP1-AS1 expression is successfully inhibited in a nasopharynx cancer cell line, and nasopharynx cancer cell invasion and metastasis are inhibited. The polylysine modified silica nanoparticles can protect the AFAP1-AS1 interference vector from being degraded by nuclease, the acting time is prolonged, higher transfection efficiency is realized, and further development and application are facilitated.
Description
Technical field
The invention belongs to oncomolecularbiology field, be specifically related to long-chain non-coding RNA AFAP1-AS1 and preparing the application method on interference carrier, tumor suppression reagent.
Background technology
The Human Genome Project and follow-up DNA element encyclopedia plan (The Encyclopedia of DNA Elements Project thereof, ENCODE) achievement in research shows, protein coding gene sequence only accounts for the 1-3% of human genomic sequence, and the transcribed sequence of the overwhelming majority is long-chain non-coding RNA (Long non-coding RNA, lncRNA) in human genome.LncRNA is present in various biology widely, and along with the rising of biological complex degree, in genome, the ratio of lncRNA sequence also correspondingly increases, and lncRNA is significant in organic evolution process in prompting.Along with lncRNA is constantly found, their function is annotated gradually, scientists finds that lncRNA extensively and actively participates in the function controlling of vital movement different aspects, as a brand-new field, has become new forward position, international life science field and focus.
LncRNA can be used as the various ways such as signal (signal), induction (guide), bait (decoy) or support (scaffold) molecule of functional protein, in the expression of chromatin reconstruct, genetic transcription, translation and the multiple levels regulatory gene such as protein modified, and play irreplaceable role comprising in the basic physiological processes such as growth, immunity, reproduction, the more important thing is, expression and the functional disorder of lncRNA be closely connected with the mankind's various diseases comprising malignant tumour together with.Therefore, the function of further investigation lncRNA, disclose the genetic information transfer mode and expression regulation network that are mediated by lncRNA, not only can again annotate from the angle beyond protein coding gene and illustrate genomic structure and fuction, deeply find essence and the rule of vital movement, also be expected to the pathogeny comprising multiple mankind's common disease of tumour from a new visual angle understanding, and provide new molecular marker and therapy target for the Clinics and Practices of these diseases.
Nasopharyngeal carcinoma is common head-neck malignant tumor occurred frequently, and easily metastasic cervical lymph nodes occurs, prognosis is poor.Research shows, the generation development of this tumour is polygene participation, multi-step, multistage complex process, and LncRNA may also play an important role in the generation evolution of nasopharyngeal carcinoma.We utilize lncRNA chip recently, construct the express spectra of lncRNA in Biopsies from Patients with Nasopharyngeal Carcinoma and normal reference sample, therefrom screen the lncRNAs of some differential expressions in nasopharyngeal carcinoma, verify through enlarged sample real-time fluorescence quantitative PCR, confirm that lncRNA AFAP1-AS1 (NCBI accession number:NR_026892) significantly raises at nasopharyngeal carcinoma, and the nodus lymphoideus transferring rate of the expression level of AFAP1-AS1 and nasopharyngeal carcinoma and clinical stages closely related, the detection preparation for this lncRNA also may be used for the auxiliary diagnosis of nasopharyngeal carcinoma.Subsequently, we increase sample further, have in the nasopharyngeal carcinoma paraffin file sample of Clinical Follow-up data in 112 examples, the expression level of AFAP1-AS1 is have detected by the method for in situ hybridization (in situ hybridization), find that AFAP1-AS1 expresses high patient and more easily shifts, its survival time is shorter than this lncRNA and expresses low patient, therefore also may be used for the Index for diagnosis of nasopharyngeal carcinoma for the detection preparation of this lncRNA.
We are by designing and synthesizing short hairpin RNA (the short-hairpin RNA of target AFAP1-AS1, shRNAs) sequence, construct the rna interference vector of target AFAP1-AS1, be transfected in human nasopharyngeal epithelioma 1, all confirm that the expression of target interference AFAP1-AS1 obviously can suppress the invasion inhibition ability of nasopharyngeal carcinoma cell in culture systems and nude mice metastatic tumor In vivo model in vitro.The nano silicon particles rna interference vector of AFAP1-AS1 being loaded to polylysine modification makes Nanoparticulate Carriers for Gene Delivery; the nano silicon particles of polylysine modification can protect the rna interference vector of AFAP1-AS1 from nuclease degradation; extend action time, and have higher transfection efficiency.
Summary of the invention
The object of this invention is to provide long-chain non-coding RNA AFAP1-AS1 and prepare the application on interference carrier, tumor suppression reagent.Preparation for suppressing AFAP1-AS1 to express in tumour cell of the present invention is made up of the rna interference vector of target AFAP1-AS1 and nano silicon particles two parts of poly-lysine bag quilt.The interference carrier utilizing AFAP1-AS1 sequence to obtain can suppress the expression of AFAP1-AS1, and can prepare the preparation suppressing nasopharyngeal carcinoma cell Invasion and Metastasis.
The application method of long-chain non-coding RNA AFAP1-AS1, has prepared for disturbing it to express according to this long-chain non-coding RNA, and has suppressed the preparation of nasopharyngeal carcinoma cell Invasion and Metastasis; The sequence of this long-chain non-coding RNA AFAP1-AS1 is as shown in SEQ NO:1.
Preparation described in above-mentioned application is the short hairpin RNA expression vector for RNA interference for the design of this long-chain non-coding RNA.The nano silicon particles that described expression vector can also be loaded to polylysine modification makes nanometer ball.
3 interfered target sequences needed for the described short hairpin RNA expression vector for the preparation of RNA interference are as follows:
shRNA-1：GCAATTCACTGAGTGGTTACG
shRNA-2：GCTTACTCTCTTGGTGATTCT
shRNA-3：GCAAGACATCCGATGGTATAC。
For 3 interfered target sequences, and carrier, design can form oligonucleotide strand and the reverse complementary sequence thereof of hairpin structure, can form the DNA double chain of two ends respectively with restriction enzyme site sticky end after their annealing; Concrete sequence is as follows:
shRNA-1：
5’-GATCCCC
GCAATTCACTGAGTGGTTACGTTCAAGAGA CGTAACCACTCAGTGAATTGC TTTTTA-3’
3’-GGG CGTTAAGTGACTCACCAATGC AAGTTCTCT GCATTGGTGAGTCACTTAACG AAAAATTCGA-5’
shRNA-2：
5’-GATCCCC
GCTTACTCTCTTGGTGATTCTTTCAAGAGA AGAATCACCAAGAGAGTAAGC TTTTTA-3’
3’-GGG CGAATGAGAGAACCACTAAGA AAGTTCTCT TCTTAGTGGTTCTCTCATTCG AAAAATTCGA-5’
shRNA-3：
5’-GATCCCC
GCAAGACATCCGATGGTATACTTCAAGAGA GTATACCATCGGATGTCTTGC TTTTTA-3’
3’-GGG CGTTCTGTAGGCTACCATATG AAGTTCTCT CATATGGTAGCCTACAGAACG AAAAATTCGA-5’。
The preparation method of the described short hairpin RNA expression vector for RNA interference is specific as follows:
1) design of shRNA
First according to long-chain non-coding RNA AFAP1-AS1, find shRNA target spot, 3 target sequences are as follows:
shRNA-1：GCAATTCACTGAGTGGTTACG
shRNA-2：GCTTACTCTCTTGGTGATTCT
shRNA-3：GCAAGACATCCGATGGTATAC
Using widely used in human genome without any the Scramble sequence of target spot as negative control, its sequence is as follows:
Scramble：GACACGCGACTTGTACCAC
2) for these 3 target sequences, and Scramble sequence, and OligoEngine company pSUPER carrier, design can form oligonucleotide strand and the reverse complementary sequence thereof of hairpin structure, can form the DNA double chain of two ends respectively with restriction enzyme site BglII and HindIII sticky end after their annealing; The DNA double chain that rear formation is return in concrete each bar oligonucleotide sequence that need synthesize and their pairings is as follows:
shRNA-1：
5’-GATCCCC
GCAATTCACTGAGTGGTTACGTTCAAGAGA CGTAACCACTCAGTGAATTGC TTTTTA-3’
3’-GGG CGTTAAGTGACTCACCAATGC AAGTTCTCT GCATTGGTGAGTCACTTAACG AAAAATTCGA-5’
shRNA-2：
5’-GATCCCC
GCTTACTCTCTTGGTGATTCTTTCAAGAGA AGAATCACCAAGAGAGTAAGC TTTTTA-3’
3’-GGG CGAATGAGAGAACCACTAAGA AAGTTCTCT TCTTAGTGGTTCTCTCATTCG AAAAATTCGA-5’
shRNA-3：
5’-GATCCCC
GCAAGACATCCGATGGTATACTTCAAGAGA GTATACCATCGGATGTCTTGC TTTTTA-3’
3’-GGG CGTTCTGTAGGCTACCATATG AAGTTCTCT CATATGGTAGCCTACAGAACG AAAAATTCGA-5’
Scramble
5’-GATCCCC
GACACGCGACTTGTACCACTTCAAGAGA GTGGTACAAGTCGCGTGTC TTTTTA-3’
3’-GGG CTGTGCGCTGAACATGGTG AAGTTCTCT CACCATGTTCAGCGCACAG AAAAATTCGA-5’
3) shRNA vector construction
8 strand oligo sequences of above-mentioned 3 shRNA of chemosynthesis and contrast, synthetic oligo oligo annealing buffer is dissolved into 20 μMs, and complementary strand is respectively got 10 μ l and is mixed; Then by the 95 DEG C of heating 5 minutes in PCR instrument of oligo mixture, then naturally cool to room temperature, form double-strand oligo fragment;
With Bgl II and Hind III double digestion pSUPER plasmid, reclaim the carrier segments of 3.1kb, mixed according to the ratio of the amount of substance of 3:1 by the carrier that the DNA of the sticky end after annealing and enzyme cut back to close, use T4 ligase enzyme, 16 DEG C of connections are spent the night; Transformed E .coil competence, select transformant, bacterium colony PCR and order-checking qualification, the pSUPER plasmid built is cut again with Cla I and EcoR I enzyme, the agarose DNA gel electrophoresis of 2%, with blank pSUPER for blank, judges the positive colony inserting object fragment, by the pcSUPER Plastid transformation competence intestinal bacteria comprising AFAP1-AS1 interference sequence obtained, with the plasmid that increases.
The nano silicon particles of above-mentioned polylysine modification uses the microemulsion self-assembling technique of OP-10, hexanaphthene, ammoniacal liquor to carry out the synthesis of nano silicon particles, and utilize the surface energy of nano silicon particles and ion electrostatic interaction to carry out poly-lysine finishing, prepare.
Prepare the detailed process of the nano silicon particles of polylysine modification:
1) OP-10, hexanaphthene and ammoniacal liquor are mixed, the different ester of positive silicic acid is added after stirring at room temperature is even, continue to be stirred to polymerization to complete, add equal-volume acetone, ultrasonic disperse, centrifugal, distilled water washs three times, centrifugal collecting precipitation is in 80 DEG C of dryings, and porphyrize obtains the nano silicon particles of particle size range 10-50nm; Wherein H
2o and OP-10 and H
2the mol ratio of O and the different ester of positive silicic acid is 2 ~ 10, ammonia concn is 1.6 ~ 28%, the positive volumetric molar concentration of the different ester of silicic acid in hexanaphthene is 0.1 ~ 3mol/L;
2) nano silicon particles is resuspended in 0.6M NaCO by 0.1 ~ 10mg/ml
3in solution, ultrasonic disperse, centrifugal, abandon supernatant, then be resuspended in by 0.1 ~ 10mg/ml in the PBS of pH 7.4 by throw out, ultrasonic disperse, adds poly-lysine, and final concentration is 4 ~ 15nmol/mL, fully mixes, and room temperature is mixed shakes; Centrifugal, abandon supernatant, precipitate and be resuspended in distilled water by 0.1 ~ 10mg/ml, obtain the nano silicon particles of polylysine modification.
By the nano silicon particles ultrasonic disperse of polylysine modification, every milliliter of nano particle suspension adds the interference carrier of 10 ~ 50ug long-chain non-coding RNA AFAP1-AS1, mixing, room temperature leaves standstill and makes it combine, and just obtains the preparation suppressing nasopharyngeal carcinoma cell Invasion and Metastasis.
The present invention constructs the rna interference vector suppressing AFAP1-AS1 to express, be transfected in human nasopharyngeal epithelioma 1, culture systems and nude mice move to grow in knurl In vivo model and all confirm to suppress the expression of AFAP1-AS1 obviously can suppress the Invasion and Metastasis ability of nasopharyngeal carcinoma cell in vitro.Nano silicon particles AFAP1-AS1 interference carrier being loaded to polylysine modification makes Nanoparticulate Carriers for Gene Delivery; the nano silicon particles of polylysine modification can protect AFAP1-AS1 interference carrier from nuclease degradation; extend action time, and have higher transfection efficiency.
Accompanying drawing explanation
Fig. 1 is the expression of Real-Time Fluorescent Quantitative PCR Technique checking lncRNA AFAP1-AS1 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium;
Significantly improve in the expression ratio normal nasopharyngeal epithelium (Normal) of AFAP1-AS1 in nasopharyngeal carcinoma (NPC), and with nodus lymphoideus transferring rate (left side) and clinical stages (right side) closely related, the expression of AFAP1-AS1 is having in the tissues of nasopharyngeal carcinoma of nodus lymphoideus transferring rate (NPC_N1/2) than higher (the left figure) that do not have nodus lymphoideus transferring rate (NPC_N0), the expression of AFAP1-AS1 is also increased (right figure, I, II, III represent clinical I, II, III phase respectively) gradually with Nasopharyngeal Carcinoma Patients clinical stages.
Fig. 2 is that in situ hybridization detects the expression of AFAP1-AS1 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium;
In normal nasopharyngeal epithelium (NPE), expression level is lower (has only detected low expression in 2 routine normal nasopharyngeal epithelium, expression is can't detect) in all the other 8 examples, and in the nasopharyngeal carcinoma (78 examples in 112 routine tissues of nasopharyngeal carcinomas) of 69.64%, the expression of AFAP1-AS1 detected, wherein 55 examples are low expression (NPC_Low), 23 examples are high expression level (NPC_High), the expression (NPC_negative) of AFAP1-AS1 do not detected in remaining 34 routine tissues of nasopharyngeal carcinoma; P<0.001.
Fig. 3 is the expression of AFAP1-AS1 in nasopharyngeal carcinoma and the relation of Nasopharyngeal Carcinoma Patients prognosis
In nasopharyngeal carcinoma, the high expression level of AFAP1-AS1 is relevant with the poor prognosis of Nasopharyngeal Carcinoma Patients, namely survival time (the Over-all survival that the patient of AFAP1-AS1 high expression level is total, left) and the patient that will be starkly lower than the low expression of AFAP1-AS1 without recurrence survival time (Relapse-free sruvival, right) or not express.
Fig. 4 is the interference carrier importing AFAP1-AS1 in nasopharyngeal carcinoma cell, significantly can suppress the expression of AFAP1-AS1 in nasopharyngeal carcinoma cell
Interference carrier (the sh-1 of target AFAP1-AS1 is imported in Nasopharyngeal Carcinoma Cell Line 5-8F, HK1 and HNE2, sh-2, sh-3) after, real time fluorescence quantifying PCR method have detected the expression of AFAP1-AS1 in nasopharyngeal carcinoma cell, and the expression of AFAP1-AS1 is all subject to obvious suppression.Negative control (NC) is scramble interference carrier, and Mock is the nasopharyngeal carcinoma cell without any process.
Fig. 5 be import in nasopharyngeal carcinoma cell AFAP1-AS1 interference carrier suppress AFAP1-AS1 express after, cell invasion ability reduce
Cell-penetrating (transwell) experiment confirms, the interference carrier of target AFAP1-AS1 is proceeded in Nasopharyngeal Carcinoma Cell Line 5-8F, HK1 and HNE2, after suppressing the expression of AFAP1-AS1, significantly can reduce through the nasopharyngeal carcinoma cell number of matrix glued membrane, show that cell invasion ability reduces.
Fig. 6 be import in nasopharyngeal carcinoma cell AFAP1-AS1 interference carrier suppress AFAP1-AS1 express after, cell migration ability reduce
Cell scratch experiment confirms, the interference carrier of target AFAP1-AS1 is proceeded in Nasopharyngeal Carcinoma Cell Line 5-8F, HK1 and HNE2, after suppressing the expression of AFAP1-AS1, from cut both sides toward cut, central authorities' travelling speed obviously slows down nasopharyngeal carcinoma cell, the time lengthening of cut healing, shows that cell movement transfer ability reduces.
Fig. 7. experimentation on animals confirms to disturb the expression of AFAP1-AS1 can suppress the transfer ability of nasopharyngeal carcinoma cell further
Proceed to shRNA interference carrier suppression AFAP1-AS1 expression in nasopharyngeal carcinoma cell 5-8F after, through tail vein, nasopharyngeal carcinoma cell is expelled in nude mouse, observe Lung metastases situation, find compared with control group (NC), shRNA strikes the number of 5-8F cell Pulmonary metastasis focuses that low AFAP1-AS1 expresses and to tail off (Fig. 7 A-C, P<0.05), the smaller volume (Fig. 7 D) of metastasis, shows that the transfer ability of nasopharyngeal carcinoma cell is subject to obvious suppression.
Embodiment
The present invention is further illustrated below in conjunction with embodiment, and unrestricted the present invention.
Embodiment 1, quantitative real-time PCR detects and confirms that AFAP1-AS1 raises at nasopharyngeal carcinoma
1. materials and methods:
Collect 10 routine normal nasopharyngeal epithelium and 31 routine tissues of nasopharyngeal carcinomas, extracted total RNA, 2 μ g RNA become after cDNA through reverse transcription, carry out real-time fluorescence quantitative PCR.AFAP-AS1 forward primer is for 5 '-AATGGTGGTAGGAGGGAGGA-3 ' is as shown in SEQ NO:8, and reverse primer 5 '-CACACAGGGGAATGAAGAGG-3 ' is as shown in SEQ NO:9.
For the GAPDH forward primer that contrasts for 5 '-ACCACAGTCCATGCCATCAC-3 ' is as shown in SEQ NO:10, and reverse primer 5 '-TCCACCACCCTGTTGCTGTA-3 ', as shown in SEQ NO:11.
Real-time fluorescence quantitative PCR reaction system
Real-time fluorescence quantitative PCR reactions steps
1 94℃ 5min
2 95℃ 10sec
3 58℃ 30sec
4 72℃ 20sec
5 Plate read
6 82℃ 30sec
7 Plate read
8 Go to step 2for more 39times
9 Perform melting curve from 55.0℃to 95.0℃，read every 0.2℃，hold for 1sec
Reaction terminates amplification curve and the melting curve of rear confirmation real-time fluorescence quantitative PCR, the expression intensity of each gene, according to after CT value (threshold cycle values), reference gene (GAPDH) markization, adopts group t-test inspection to calculate P value.
2. result
AFAP1-AS1 does not express or expresses very low in normal control tissue, and in tissues of nasopharyngeal carcinoma high expression level P<0.001 (Fig. 1)
Embodiment 2, in situ hybridization detects and finds that the expression of AFAP1-AS1 in nasopharyngeal carcinoma is relevant to patient's prognosis
1. MATERIALS METHODS
1.1 design and synthesize hybridization probe
In order to the expression adopting in-situ hybridization method to detect AFAP1-AS1, we devise oligonucleotide probe and each 3 of positive control two groups of in situ hybridization oligonucleotide probes of detecting AFAP1-AS1 expression in situ hybridization.
The oligonucleotide probe of AFAP1-AS1 expression is detected in situ hybridization:
AFAP1-AS1 probe 1:5 '-ATTCCTTTATTTTATGGGATGTTCTGTAGGGAGTT-3 ' as shown in SEQ NO:2,
AFAP1-AS1 probe 2:5 '-TAGAAATGAGAAAAGAATCACCAAGAGAGTAAGCA-3 ' as shown in SEQ NO:3,
AFAP1-AS1 probe 3:5 '-TCCCTACAGCTAGTTTCCTCTTCATTTATTCATTT-3 ' is as shown in SEQ NO:4.
Positive control probe (detecting house-keeping gene GAPDH):
GAPDH probe 1:5'-CCACTTTACCAGAGTTAAAAGCAGCCCTGG-3', as shown in SEQ NO:5,
GAPDH probe 2:5'-CAGTAGAGGCAGGGATGATGTTCTGGAGAG-3', as shown in SEQ NO:6,
GAPDH probe 3:5'-GTCAGAGGAGACCACCTGGTGCTCAGTGTA-3', as shown in SEQ NO:7.
Chemical synthesis process is adopted to synthesize each gene specific oligonucleotides probe sequence of above-mentioned design.
1.2 oligonucleotide probe labelling kits and in situ hybridization detection reagent
Digoxin oligonucleotide tailing reagent (Dig Oligonucleitide Tailing Kit 2
ndgeneration, Roche company), anti-digoxin-horseradish peroxidase complex detection kit (Anti-Digoxigenin-POD, Fab fragments, Roche company), strengthen the TSA signal amplifying system (TSA of expressed in situ detection signal
tMbiotin System, NEL700 test kit, PerkinElmer company), DAB staining kit (Beijing Zhong Shan company), 20x sodium citrate buffer (saline sodium citrate, SSC), T 500 (Dextran sulphate), deionized formamide (Deionized Formamide), polyadenylic acid (polyadenylic acid, Poly A), poly deoxyadenylic acid (polydeoxyadenylic acid, Poly dA), frog essence DNA (the denatured and sheared salmon sperm DNA that sex change is sheared, ssDNA), yeast transfer RNA (yeast t-RNA, tRNA), dithiothreitol (DTT) (DTT), Deng 50x Han Shi damping fluid (Denhardts ' s solution), phosphoric acid buffer (PBS buffer), stomach en-K, bovine serum albumin (BSA), trolamine (TEA), TNB Buffer (0.1M Tris-HCl, pH7.5, 0.15M NaCL, 0.5%Blocking Reagent), TNT Buffer (0.1M Tris-HCl, pH7.5, 0.15M NaCL, 0.05%Tween 20), acetic anhydride, block reagent (Blocking reagent agent, Roche company).
1.3 other main agents and materials
Dehydrated alcohol, 90% alcohol, 70% alcohol, 50% alcohol, turps, distilled water, PBS damping fluid (pH7.2 ~ 7.4, NaCl 137mmol/L, KCl 2.7mmol/L, Na
2hPO
44.3mmol/L, KH
2pO
41.4mmol/L); 3% methyl alcohol-hydrogen peroxide solution (80% methyl alcohol and the configuration of 30% hydrogen peroxide); 0.01mol/L citrate buffer (citrate buffer, CB, pH6.0 ± 0.1,9ml 0.1M citric acid solution and 41ml 0.1M sodium citrate solution to add in 450ml distilled water after provisional configuration correction work liquid pH value again); 0.1% trypsinase; Hematorylin; 1% hydrochloride alcohol (configuration of 1ml concentrated hydrochloric acid+99ml 70% alcohol); Mounting glue (PTS Cure Mount II); Special cap slide (480 × 240mm
2) customize in Zhengzhou Glassware Factory.Leica low melting point (58 DEG C) paraffin, domestic beeswax, raw spirit, dimethylbenzene, 10% neutral paraformaldehyde (0.01mol/L, pH7.4, DEPC distilled water and PBS buffer), Hematorylin, Yihong, neutral mounting natural gum, cover glass, slide glass.
1.4 label probe
Utilize 3-tailing DIG Olignucleutide Kit to carry out oligonucleotide probe mark, reaction system is as follows.
100pmol oligonucleotide+ddH
2O＝9μl(control:control oligonucleutide 5μl+ddH
2O 4μl)
Mixing, slightly centrifugal.37 DEG C of water-bath 30min, add 2 μ l EDTA (0.2M, PH 8.0) stopped reactions.
Purifying after 1.5 oligonucleotide probe marks
In order to increase the purity of label probe, need carry out purifying to the probe marked, concrete operations are as follows:
1) probe reaction mixture (22 μ l)+2.5 μ l 4M LiCL+75 μ cold ethanol of l 100% (-20 DEG C).
2)-70 DEG C of precipitations 60min, or-20 DEG C of 2h.
3) 13.000 × g, 4 DEG C of centrifugal 15min.
4) supernatant is abandoned, by 70% (V/V) washing with alcohol that 50 μ l are ice-cold.
5) 13.000xg 4 DEG C, centrifugal 5min.
6) supernatant is abandoned, vacuum 4 DEG C of dryings.
7) with the heavy molten probe of aseptic double-distilled water.
1.6 in situ hybridizations detect the expression of AFAP1-AS1 in file paraffin section
Paraffin section hybridization pre-treatment
1) 4 DEG C of paraffin sections preserved are placed in 58 DEG C of roasting sheet 30min, melted surface paraffin.
2) dimethylbenzene dewaxes 3 × 5min successively.
3) step ethanol wash, 100% alcohol 2 × 2min → 95% alcohol 1 × 5min → 70% alcohol 1 × 5min → 50% alcohol 1 × 5min → DEPC water washing 2 × 3min → DEPC-PBS washs 2 × 5min.
4) 300 μ l stomach en-K (10 μ g/ml) are dripped in section, 37 DEG C of digestion 20min.
5) cut into slices and wash 1min, stopped reaction into PBS (0.1M PBS+2mg/ml L-glutamic acid).
6) cut into slices into 0.2N HCL, in 37 DEG C of reaction 20-30min, increase the permeability of tissue.
7) section fixes 10min, room temperature afterwards with 4% paraformaldehyde (0.1M PBS dissolves).
8) organize positive intensity for hybridization to increase, acetyl process is carried out to section.Cut into slices into 0.25% diacetyl oxide Buffer I (0.1M trolamine), room temperature 10min.
9) 1M PBS washs 2 × 5min.
Prehybridization and hybridization
Prehybridization :-20 DEG C of prehybridization solutions preserved, be first placed in 37 DEG C and hatch 60min, the consumption of prehybridization solution is 50 μ l, and Parafilm carries out lid section, prehybridization 2 hours in 37 DEG C of wet boxes.(prehybridization solution composition comprises: 2XSSC, 10%Dextran sulphate, 1X Denhardt ' s solution, 50mM Phosphate Buffer (PH 7.0), 50mM DTT, 250 μ l, 100 μ g/ml poly A, 5 μ g/ml poly dA, 250 μ g/ml yeast t-RNA, 500 μ g/ml ssDNA, 47%Deionized formamide).
1) remove Parafilm, get rid of prehybridization solution, section is placed in 2 × SSC 5min.
2) hybridization: 37 DEG C of hybridized overnight (18-20h).Each section adds 250 μ l hybridization solutions and carries out lid with Parafilm.Add corresponding probe in prehybridization solution and just become hybridization solution.Hybridization solution is prepared when prehybridization, and place 37 DEG C and hatch, probe is fully dissolved in hybridization solution, this experiment many oligonucleotide probes mix, and is mixed with probe hybridization liquid by each probe 500ng/ml concentration.Digoxin tailing labelling kit label probe concentration basis: the concentration of each probe is compared by developing the color during detection reaction when itself and the positive quantitative probe and the naked probe mark reaction theory probe output of 100pmol 30 bases is that 900ng two kinds of standards carry out the concentration that COMPREHENSIVE CALCULATING goes out label probe.
3) post-hybridization washing, section immersion 2 × SSC, 10min, throws off Parafilm.Shake washing on shaking table successively, 2 × SSC (0.5%SDS), 2 × 15min → 0.25 × SSC (0.5%SDS), 2 × 15min.
Color developing detection reaction after hybridization
1) Anti-Digoxigenin-POD is adopted to detect digoxigenin-probe with mRNA in conjunction with mixture; TSA amplification system strengthens the positive signal of in situ hybridization reaction solution reaction, and DAB develops the color.
2) section goes in TNT damping fluid, 3 × 5min.
3) drip TNB and block damping fluid, 300 μ l/TMAs, room temperature, 30min.
4) unnecessary blocker is sucked, the Anti-Digoxigenin-POD (TBS+0.1%Triton X-100+1% blocker) of 1:100 dilution, room temperature 4 hours.
5) TNT Buffer (0.1M Tris-CL, pH7.5,0.15M NaCL, 0.05%Tween 20) washing, 3x5min.
6) section drips signal and amplify reagent Biotinyl Tyamid, 300 μ l/TMAs, (Biotinyl Tyramid stock solution: Biotinyl Tyramid is dissolved in 0.2ml DMSO, Biotinyl Tyramid working fluid: 1 × diluent, 1:50 dilutes Biotinyl Tyramid stock solution), room temperature 10 minutes.
7) TNT washes, 3 × 5min.
8) section drips SA-HRP (strepto-avidin-horseradish peroxidase), 300 μ l/TMAs, room temperature 30min.
9) TNT washes, 3 × 5min.
10) aquae destillata washing, 1 × 1min.
11) DAB colour developing, controls color reaction under microscope.
12) Hematorylin is redyed,
13) alcohol step dehydration, chip drying.
14) mounting glue is dripped, the cover glass cover plate of dimension, crosslinked section 1min under ultraviolet lamp.
1.7 results judge and standard
Applied optics microscope is observed respectively under low power and high power lens, and first the positive expression signal of object observing RNA is in the intracellular location of object observing: be positioned at nucleus, cytoplasm or cytolemma.
Carry out comprehensive grading with cell count two kinds of standards of the intensity of this detection rna expression position positive signal and positive expression respectively again, judging criterion is: (1) judges according to positive cell dyeing intensity: a. cell dye-free, remembers 0 point; B. cell dyes light brown is the weak positive, remembers 1 point; C. cell is dyed brown and without background coloration, or cell is dyed dark-brown and has light brown background to be moderate positive, remembers 2 points; D. cell is dyed dark-brown and is strong positive without background coloration, remembers 3 points.(2) express number score according to positive cell: the no positive cell expressing of a., remember 0 point; B. positive expression cell count≤25%, remembers 1 point; C.25% < positive cell number < 50%, remembers 2 points; D. positive expression cell count >=50%, remembers 3 points.
In order to reduce the subjective factor of appraisal result as far as possible, carried out separately judging and marking by one of above-mentioned standard respectively by two pathology experts, then both scorings be multiplied, result is: 1. 0 point of person finally counts 0 point, thinks negative and expresses; 2. 1 point and 2 points of persons finally count 1 point, think weak positive expression; 3. 3 points and 4 points of persons finally count 2 points, think that moderate positive is expressed; 4. 6 assign to 9 points of persons and finally count 3 points, think that strong positive is expressed.
1.8 analyze and statistical software
Application SPSS13.0 statistical software carries out statistical analysis to experimental result, compares between two and uses χ
2test or Fisher exact test, correlation analysis adopts Spearmen correlation method; P < 0.05 i.e. difference has statistical significance.Survival curve analysis adopts Kaplan-Meier method and log-rank test; Multivariate analysis adopts Cox ' s proportional hazards model; P < 0.05 i.e. difference has statistical significance.
2 results
Expression in the expression ratio normal control tissue of 2.1AFAP1-AS1 in nasopharyngeal carcinoma significantly raises
AFAP1-AS1 (78/112 example) in the tissues of nasopharyngeal carcinoma of 69.64% has expression, and only in the normal nasopharyngeal epithelium of 20% (2 examples in 10 routine healthy tissues samples), have expression (Fig. 2), there is obvious significant difference (P<0.001) between the two.
The Nasopharyngeal Carcinoma Patients prognosis of 2.2AFAP1-AS1 high expression level is poor
We have carried out Effect of follow-up visit by telephone to 112 routine Nasopharyngeal Carcinoma Patients, detailed inquired them start time, treatment situation, with or without recurrence, with or without suffering from other diseases, recurrence and death time etc. again, and register survival time and state, and to the survival analysis that the expression of AFAP1-AS1 in tissues of nasopharyngeal carcinoma and the survival time of patient and state are carried out, find the patient (Fig. 3) that AFAP1-AS1 high expression level patient is significantly shorter than AFAP1-AS1 low expression the mean survival time or does not express.Illustrate that AFAP1-AS1 is a molecule marker relevant to nasopharyngeal carcinoma prognosis, this lncRNA expresses high, patient's poor prognosis.
Embodiment 3, builds the expression of shRNA carrier interference AFAP1-AS1
1. MATERIALS METHODS
1.1 reagent and test kit
Restriction enzyme Hind III, Bgl II, EcoR I and Cla I, T4DNA ligase enzyme etc. are purchased from TakaRa company;
TRIZOL
TMReagent(Invitrogen)；
Plasmid extraction test kit (#D6943-01, OMEGA);
Glue reclaims test kit (#M5212, OMEGA);
Reverse Transcriptase kit (#A3500, Promega);
Microbiotic G418 (Ameresc).
The design of 1.2shRNA
First by the Block-It RNAi designer software of AFAP1-AS1 sequence inputting Invitrogen company, find the shRNA best target of this lncRNA, select 3 best corresponding target sequences as follows:
ShRNA-1:GCAATTCACTGAGTGGTTACG as shown in SEQ NO:12,
ShRNA-2:GCTTACTCTCTTGGTGATTCT as shown in SEQ NO:13,
ShRNA-3:GCAAGACATCCGATGGTATAC as shown in SEQ NO:14,
Using widely used in human genome without any the Scramble sequence of target spot as negative control, its sequence is as follows:
Scramble:5 '-GACACGCGACTTGTACCAC-3 ' is as shown in SEQ NO:15.
For these 3 lncRNA target sequences, and Scramble sequence, according to OligoEngine company pSUPER carrier specification sheets, design can form oligonucleotide strand and the reverse complementary sequence thereof of hairpin structure, can form the DNA double chain of two ends respectively with restriction enzyme site BglII and HindIII sticky end after their annealing.The DNA double chain formed after concrete each bar oligonucleotide sequence that need synthesize and their pairing annealing is as follows:
shRNA-1：
5’-GATCCCC GCAATTCACTGAGTGGTTACG TTCAAGAGA CGTAACCACTCAGTGAATTGC TTTTTA-3’
3’-GGG CGTTAAGTGACTCACCAATGC AAGTTCTCT GCATTGGTGAGTCACTTAACG AAAAATTCGA-5’
As shown in SEQ NO:16,17,
shRNA-2：
5’-GATCCCC GCTTACTCTCTTGGTGATTCT TTCAAGAGA AGAATCACCAAGAGAGTAAGC TTTTTA-3’
3’-GGG CGAATGAGAGAACCACTAAGA AAGTTCTCT TCTTAGTGGTTCTCTCATTCG AAAAATTCGA-5’
As shown in SEQ NO:18,19,
shRNA-3：
5’-GATCCCC GCAAGACATCCGATGGTATAC TTCAAGAGA GTATACCATCGGATGTCTTGC TTTTTA-3’
3’-GGG CGTTCTGTAGGCTACCATATG AAGTTCTCT CATATGGTAGCCTACAGAACG AAAAATTCGA-5’
As shown in SEQ NO:20,21,
Scramble
5’-GATCCCC GACACGCGACTTGTACCAC TTCAAGAGA GTGGTACAAGTCGCGTGTC TTTTTA-3’
3’-GGG CTGTGCGCTGAACATGGTG AAGTTCTCT CACCATGTTCAGCGCACAG AAAAATTCGA-5’
As shown in SEQ NO:22,23.
Article two, after the DNA of complementary pairing anneals, the left side is the sticky end of restriction enzyme Bgl II, and the right is the sticky end of Hind III.
1.3shRNA vector construction
8 strand oligo sequences that above-mentioned 4 shRNA of chemosynthesis are corresponding, synthetic oligo oligo annealing buffer is dissolved into 20 μMs, and complementary strand is respectively got 10 μ l and is mixed.Then by the 95 DEG C of heating 5 minutes in PCR instrument of oligo mixture, then naturally cool to room temperature, form double-strand oligo fragment.
With Bgl II and Hind III double digestion pSUPER plasmid, reclaim the carrier segments of 3.1kb, mixed according to the ratio of the amount of 3:1 by the carrier that the DNA of the sticky end after annealing and enzyme cut back to close, use T4 ligase enzyme, 16 DEG C of connections are spent the night.Transformed E .coil competence, select transformant, bacterium colony PCR and order-checking qualification, the pSUPER plasmid built is cut again with Cla I and EcoR I enzyme, the agarose DNA gel electrophoresis of 2%, with blank pSUPER for blank, judge the positive colony inserting object fragment, for the expression of AFAP1-AS1 in interference cell after positive colony sequence verification.
1.4 cell cultures and transfection
Nasopharyngeal Carcinoma Cell Line 5-8F, HK1 and HNE2 are purchased from Central South University's cell centre, and cell cultures RPMI 1640 used trains base and foetal calf serum, and peptic cell trypsinase used is U.S. Gibco Products.
By good for growth conditions Nasopharyngeal Carcinoma Cell Line 5-8F, HK1 and HNE2 by 2 × 10
5individual cells/well is inoculated in 6 orifice plates, 6 orifice plates is placed in 37 DEG C, 5%CO
2in incubator, treat that culturing cell grows to the transfection that 50-70% density can start shRNA expression vector; Transfection process is as follows:
The lipofectamine 2000 adding 3 μ l in aseptic EP pipe mixes and leaves standstill 5min in 100 μ l serum free mediums;
The shRNA expression vector of structure is added in 100 μ l serum free mediums; Then mix with the above-mentioned 100 μ l serum free medium gentlenesses comprising lipofectamine, room temperature leaves standstill 30 minutes, makes DNA and liposome form complex body;
With D-Hank's liquid washed cell 3 times;
800 μ l serum free mediums (antibiotic-free) will be added in said mixture, after gentle mixing, add 1 hole in 6 orifice plates;
6 orifice plates are placed in CO
2in incubator, cultivate 6 hours, then abandon supernatant for 37 DEG C, add perfect medium and continue cultivation 48 hours.
1.5 real-time quantitative PCRs detect the effect that shRNA disturbs lncRNA to express:
By the nasopharyngeal carcinoma cell extracted total RNA after the transfection of various shRNA carrier, 2 μ g RNA become after cDNA through reverse transcription, carry out real-time fluorescence quantitative PCR.AFAP1-AS1 primer is 5 '-AATGGTGGTAGGAGGGAGGA-3 ', and 5 '-CACACAGGGGAATGAAGAGG-3 '.
GAPDH primer for contrasting is 5 '-ACCACAGTCCATGCCATCAC-3 ' and 5 '-TCCACCACCCTGTTGCTGTA-3 ',
Real-time fluorescence quantitative PCR reaction system
Real-time fluorescence quantitative PCR reactions steps
1 94℃ 5min
2 95℃ 10sec
3 58℃ 30sec
4 72℃ 20sec
5 Plate read
6 82℃ 30sec
7 Plate read
8 Go to step 2for more 39times
9 Perform melting curve from 55.0℃to 95.0℃，read every 0.2℃，hold for 1sec
Reaction terminates amplification curve and the melting curve of rear confirmation real-time fluorescence quantitative PCR, the expression intensity of each gene, according to after CT value (threshold cycle values), reference gene (GAPDH) markization, adopts group t-test inspection to calculate P value.
2. result
After these three shRNA carrier transfection nasopharyngeal carcinoma cells 5-8F, HK1 and HNE2, all significantly can lower the expression level (Fig. 4) of AFAP1-AS1 in nasopharyngeal carcinoma cell.
Embodiment 4, the nano particle preparing load shRNA interference carrier suppresses the expression of AFAP1-AS1 in nasopharyngeal carcinoma cell
1. MATERIALS METHODS
1.1 nano silicon particles preparing poly-lysine bag quilt
The nano silicon particles of poly-lysine bag quilt uses OP10/ hexanaphthene/ammonia microemulsion self-assembling technique to carry out nano silicon particles (silica nanoparticle, SiNP) synthesis, and utilize nano silicon particles surface energy and by ion electrostatic interaction, prepare the nano silicon particles of polylysine modification; Described nano particle can be prepared by following methods:
1) OP-10, hexanaphthene and ammoniacal liquor are mixed, the different ester of positive silicic acid (TEOS) is added after stirring at room temperature is even, continue to be stirred to polymerization to complete, add equal-volume acetone, ultrasonic disperse, centrifugal, distilled water washs three times, centrifugal collecting precipitation is in 80 DEG C of dryings, and porphyrize obtains nano silicon particles (SiNP).Wherein H
2o and OP-10 and H
2the mol ratio of O and TEOS is 2 ~ 10, ammonia concn is 1.6 ~ 28%, the volumetric molar concentration of TEOS in hexanaphthene is 0.1 ~ 3mol/L.
2) SiNP is resuspended in 0.6M NaCO by 0.1 ~ 10mg/ml
3in solution, ultrasonic disperse, centrifugal, abandon supernatant, then be resuspended in PBS (pH 7.4) by throw out by 0.1 ~ 10mg/ml, ultrasonic disperse, add poly-lysine (final concentration is 4 ~ 15nmol/mL), fully mix, room temperature is mixed shakes; Centrifugal, abandon supernatant, precipitation is resuspended in distilled water, obtains the nano silicon particles of polylysine modification.The final concentration of poly-lysine is 4 ~ 15nmol/mL.
3) by modified nano silicon particles ultrasonic disperse, 5 ~ 30:1 mixes with the rna interference vector of the target AFAP1-AS1 described in embodiment 3 in mass ratio, and room temperature leaves standstill and makes it combine.
1.2 cell cultures and transfection
By good for growth conditions nasopharyngeal carcinoma cell 5-8F, HK2 and HNE2 by 2 × 10
5individual cells/well is inoculated in 6 orifice plates, 6 orifice plates is placed in 37 DEG C, 5%CO
2in incubator, treat that culturing cell grows to the transfection that 50-70% density can start AFAP1-AS1 carrier for expression of eukaryon; Transfection process is as follows:
In aseptic EP pipe, add the nano silicon particles suspension carrying the polylysine modification of AFAP1-AS1 eukaryon expression plasmid that 100 μ l prepare, mix with 100 μ l serum free medium gentlenesses; With D-Hank's liquid washed cell 3 times; 800 μ l serum free mediums (antibiotic-free) will be added in said mixture, after gentle mixing, add 1 hole in 6 orifice plates; 6 orifice plates are placed in CO
2in incubator, cultivate 6 hours, then abandon supernatant for 37 DEG C, add perfect medium and continue overnight incubation.With carrying the nano silicon particles of polylysine modification of Scramble sequence as experiment contrast.
1.3 cell-penetrating experiments
((transwell) experiment is the experimental technique of checking tumor cell invasion ability to cell-penetrating.Transwell cell (8 μm, aperture) and matrigel (Matrigel) purchased from American BD company, 4% paraformaldehyde stationary liquid, Viola crystallina dye liquor (0.1%g/ml) available from Sigma.Matrigel is pressed 1:8 dilution, be coated on the face, upper room of Transwell cell bottom film, put 37 DEG C and make Matrigel aggregate into gel in 30 minutes.Matrigel film water is carried out by BD company specification sheets before using.
Serum free medium and 1 × 10 is added on each Transwell cell upper strata
5the individual transfection nasopharyngeal carcinoma cell of AFAP1-AS1shRNA interference carrier or control vector (scramble), adds the substratum containing 20% foetal calf serum in Transwell cell lower floor.Cell continued cultivation after 36 hours, fixes, violet staining, dab off the non-migrating cell in upper strata, wash 3 times with PBS with cotton swab with 4% paraformaldehyde stationary liquid.Examine under a microscope the nasopharyngeal carcinoma cell through matrix glued membrane.
1.4 cell scratch experiments
Cell scratch experiment is the experimental technique of checking tumor cell migration ability.The nasopharyngeal carcinoma cell of transfection AFAP1-AS1shRNA interference carrier or control vector (scramble) is inoculated in 6 orifice plates, when cell density reaches 90%, in each 6 orifice plates, (cut) is drawn a straight line with 200ul pipet, cut healing state is examined under a microscope subsequently at each time point (depending on different cell migration ability) such as 0,8,12,16,24,32,48 hour, take pictures, and calculate each group of cell migration rates.
2. result
After 2.1 interference carriers importing AFAP1-AS1 in nasopharyngeal carcinoma cell suppress AFAP1-AS1, cell invasion ability reduces
Cell-penetrating (transwell) experiment confirms, the interference carrier of target AFAP1-AS1 is proceeded in Nasopharyngeal Carcinoma Cell Line 5-8F, HK1 and HNE2, after suppressing the expression of AFAP1-AS1, significantly can reduce through the nasopharyngeal carcinoma cell number of matrix glued membrane, show that cell invasion ability reduces (Fig. 5).
After 2.2 interference carriers importing AFAP1-AS1 in nasopharyngeal carcinoma cell suppress AFAP1-AS1 to express, cell migration ability reduces
Cell scratch experiment confirms, the interference carrier of target AFAP1-AS1 is proceeded in Nasopharyngeal Carcinoma Cell Line 5-8F, HK1 and HNE2, after suppressing the expression of AFAP1-AS1, the speed of nasopharyngeal carcinoma cell central authorities' migration from cut both sides toward cut slows down, the time lengthening of cut healing, shows that cell movement transfer ability reduces (Fig. 6).
Embodiment 5, nude mice metastatic tumor model validation suppresses the expression of AFAP1-AS1 can suppress the transfer ability of nasopharyngeal carcinoma cell
1. materials and methods
16 male BALB/C nude mices, in 4 week age, weight is 19 ± 2g, buys in Shanghai Slac Experimental Animal Co., Ltd..The equal quality inspection of all nude mices is qualified, raises under no-special pathogen (SPF) condition in laboratory animal portion of Central South University.AFAP1-AS1 interference carrier builds and the preparation of nano silicon particles of polylysine modification, cell cultures and transfection equivalent integers 4.The 5-8F cell of transfection AFAP1-AS1 interference carrier or scramble carrier (NC) respectively gets 1 × 10
6individual, to inject in nude mouse (8 often group) through tail vein, put to death nude mice after 10 weeks, observe the transfer case (mainly transferring in nude mice lung) of nasopharyngeal carcinoma cell.
2. result
Experimentation on animals confirms to disturb the expression of AFAP1-AS1 can suppress the transfer ability (Fig. 7) of nasopharyngeal carcinoma cell further.Compared with control group (NC), strike number (Fig. 7 A-C of the 5-8F cell Pulmonary metastasis focuses of low AFAP1-AS1, P<0.05) tail off, the smaller volume (Fig. 7 D) of metastasis, shows that the transfer ability of nasopharyngeal carcinoma cell is subject to obvious suppression.
Claims (9)
1. the application method of long-chain non-coding RNA AFAP1-AS1, is characterized in that, has prepared for disturbing it to express, and suppress the preparation of nasopharyngeal carcinoma cell Invasion and Metastasis according to this long-chain non-coding RNA; The sequence of this long-chain non-coding RNA AFAP1-AS1 is as shown in SEQ NO:1.
2. application method according to claim 1, is characterized in that, described preparation is the short hairpin RNA expression vector for RNA interference for the design of this long-chain non-coding RNA.
3. application method according to claim 2, is characterized in that, the nano silicon particles described expression vector being loaded to polylysine modification makes nanometer ball.
4. application method according to claim 2, is characterized in that, 3 interfered target sequences needed for the described short hairpin RNA expression vector for the preparation of RNA interference are as follows:
shRNA-1：GCAATTCACTGAGTGGTTACG
shRNA-2：GCTTACTCTCTTGGTGATTCT
shRNA-3：GCAAGACATCCGATGGTATAC。
5. application method according to claim 4, is characterized in that,
For 3 interfered target sequences, and carrier, design can form oligonucleotide strand and the reverse complementary sequence thereof of hairpin structure, can form the DNA double chain of two ends respectively with restriction enzyme site sticky end after their annealing; Concrete sequence is as follows:
shRNA-1：
5’-GATCCCC
GCAATTCACTGAGTGGTTACGTTCAAGAGA CGTAACCACTCAGTGAATTGC TTTTTA-3’
3’-GGG CGTTAAGTGACTCACCAATGC AAGTTCTCT GCATTGGTGAGTCACTTAACG AAAAATTCGA-5’
shRNA-2：
5’-GATCCCC
GCTTACTCTCTTGGTGATTCTTTCAAGAGA AGAATCACCAAGAGAGTAAGC TTTTTA-3’
3’-GGG CGAATGAGAGAACCACTAAGA AAGTTCTCT TCTTAGTGGTTCTCTCATTCG AAAAATTCGA-5’
shRNA-3：
5’-GATCCCC
GCAAGACATCCGATGGTATACTTCAAGAGA GTATACCATCGGATGTCTTGC TTTTTA-3’
3’-GGG CGTTCTGTAGGCTACCATATG AAGTTCTCT CATATGGTAGCCTACAGAACG AAAAATTCGA-5’。
6. application method according to claim 2, is characterized in that, the preparation method of the described short hairpin RNA expression vector for RNA interference is specific as follows:
1) design of shRNA
First according to long-chain non-coding RNA AFAP1-AS1, find shRNA target spot, 3 target sequences are as follows:
shRNA-1：GCAATTCACTGAGTGGTTACG
shRNA-2：GCTTACTCTCTTGGTGATTCT
shRNA-3：GCAAGACATCCGATGGTATAC
Using widely used in human genome without any the Scramble sequence of target spot as negative control, its sequence is as follows:
Scramble：GACACGCGACTTGTACCAC
2) for these 3 target sequences, and Scramble sequence, and OligoEngine company pSUPER carrier, design can form oligonucleotide strand and the reverse complementary sequence thereof of hairpin structure, can form the DNA double chain of two ends respectively with restriction enzyme site BglII and HindIII sticky end after their annealing; The DNA double chain that rear formation is return in concrete each bar oligonucleotide sequence that need synthesize and their pairings is as follows:
shRNA-1：
5’-GATCCCC
GCAATTCACTGAGTGGTTACGTTCAAGAGA CGTAACCACTCAGTGAATTGC TTTTTA-3’
3’-GGG CGTTAAGTGACTCACCAATGC AAGTTCTCT GCATTGGTGAGTCACTTAACG AAAAATTCGA-5’
shRNA-2：
5’-GATCCCC
GCTTACTCTCTTGGTGATTCTTTCAAGAGA AGAATCACCAAGAGAGTAAGC TTTTTA-3’
3’-GGG CGAATGAGAGAACCACTAAGA AAGTTCTCT TCTTAGTGGTTCTCTCATTCG AAAAATTCGA-5’
shRNA-3：
5’-GATCCCC
GCAAGACATCCGATGGTATACTTCAAGAGA GTATACCATCGGATGTCTTGC TTTTTA-3’
3’-GGG CGTTCTGTAGGCTACCATATG AAGTTCTCT CATATGGTAGCCTACAGAACG AAAAATTCGA-5’
Scramble
5’-GATCCCC
GACACGCGACTTGTACCACTTCAAGAGA GTGGTACAAGTCGCGTGTC TTTTTA-3’
3’-GGG CTGTGCGCTGAACATGGTG AAGTTCTCT CACCATGTTCAGCGCACAG AAAAATTCGA-5’
3) shRNA vector construction
8 strand oligo sequences of above-mentioned 3 shRNA of chemosynthesis and contrast, are dissolved into 20 μMs by synthetic oligo oligoannealing buffer, and complementary strand is respectively got 10 μ l and mixed; Then by the 95 DEG C of heating 5 minutes in PCR instrument of oligo mixture, then naturally cool to room temperature, form double-strand oligo fragment;
With Bgl II and Hind III double digestion pSUPER plasmid, reclaim the carrier segments of 3.1kb, mixed according to the ratio of the amount of substance of 3:1 by the carrier that the DNA of the sticky end after annealing and enzyme cut back to close, use T4 ligase enzyme, 16 DEG C of connections are spent the night; Transformed E .coil competence, select transformant, bacterium colony PCR and order-checking qualification, the pSUPER plasmid built is cut again with Cla I and EcoR I enzyme, the agarose DNA gel electrophoresis of 2%, with blank pSUPER for blank, judges the positive colony inserting object fragment, by the pcSUPER Plastid transformation competence intestinal bacteria comprising AFAP1-AS1 interference sequence obtained, with the plasmid that increases.
7. application method according to claim 3, is characterized in that,
The nano silicon particles of polylysine modification uses the microemulsion self-assembling technique of OP-10, hexanaphthene, ammoniacal liquor to carry out the synthesis of nano silicon particles, and utilize the surface energy of nano silicon particles and ion electrostatic interaction to carry out poly-lysine finishing, prepare.
8. application method according to claim 7, is characterized in that, prepares the nano silicon particles of polylysine modification:
1) OP-10, hexanaphthene and ammoniacal liquor are mixed, the different ester of positive silicic acid is added after stirring at room temperature is even, continue to be stirred to polymerization to complete, add equal-volume acetone, ultrasonic disperse, centrifugal, distilled water washs three times, centrifugal collecting precipitation is in 80 DEG C of dryings, and porphyrize obtains the nano silicon particles of particle size range 10-50nm; Wherein H
2o and OP-10 and H
2the mol ratio of O and the different ester of positive silicic acid is 2 ~ 10, ammonia concn is 1.6 ~ 28%, the positive volumetric molar concentration of the different ester of silicic acid in hexanaphthene is 0.1 ~ 3mol/L;
2) nano silicon particles is resuspended in 0.6M NaCO by 0.1 ~ 10mg/ml
3in solution, ultrasonic disperse, centrifugal, abandon supernatant, then be resuspended in by 0.1 ~ 10mg/ml in the PBS of pH 7.4 by throw out, ultrasonic disperse, adds poly-lysine, and final concentration is 4 ~ 15nmol/mL, fully mixes, and room temperature is mixed shakes; Centrifugal, abandon supernatant, precipitate and be resuspended in distilled water by 0.1 ~ 10mg/ml, obtain the nano silicon particles of polylysine modification.
9. the application method according to claim 7 or 8, it is characterized in that, by the nano silicon particles ultrasonic disperse of polylysine modification, every milliliter of nano particle suspension adds the interference carrier of 10 ~ 50ug long-chain non-coding RNA AFAP1-AS1, mixing, room temperature leaves standstill and makes it combine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510512545.5A CN105018498A (en) | 2015-05-12 | 2015-08-20 | Application method of lnc RNA (long-chain non-coding ribonucleic acid) AFAP1-AS1 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510237585 | 2015-05-12 | ||
| CN201510512545.5A CN105018498A (en) | 2015-05-12 | 2015-08-20 | Application method of lnc RNA (long-chain non-coding ribonucleic acid) AFAP1-AS1 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105018498A true CN105018498A (en) | 2015-11-04 |
Family
ID=54408800
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510512545.5A Pending CN105018498A (en) | 2015-05-12 | 2015-08-20 | Application method of lnc RNA (long-chain non-coding ribonucleic acid) AFAP1-AS1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105018498A (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105602951A (en) * | 2016-01-29 | 2016-05-25 | 中南大学 | Interference preparation of long chain non-coding RNA LOC284454 and application thereof |
| CN105624160A (en) * | 2015-12-24 | 2016-06-01 | 中国人民武装警察部队总医院 | Non-coding small RNA molecule ncRNA1351 of Brucella and application of non-coding small RNA molecule ncRNA1351 |
| CN106492228A (en) * | 2016-10-31 | 2017-03-15 | 中南大学 | The application of the siRNA of long-chain non-coding RNA LINC00673 and inhibitory preparation |
| CN106511368A (en) * | 2016-10-31 | 2017-03-22 | 中南大学 | Application of siRNA of long non-coding RNA LINC00152 and inhibiting preparation |
| CN106884016A (en) * | 2017-02-13 | 2017-06-23 | 中南大学 | The expression vector of long-chain non-coding RNA LINC00472, tumor suppression reagent and its application |
| CN108186665A (en) * | 2018-01-02 | 2018-06-22 | 深圳市第二人民医院 | Interfere application of the reagent of long-chain non-coding RNA PVT1 expression in nasopharyngeal carcinoma auxiliary treatment preparation is prepared |
| CN108220436A (en) * | 2018-01-02 | 2018-06-29 | 深圳市第二人民医院 | Detect application of the reagent of long-chain non-coding RNA PVT1 expression quantity in nasopharyngeal carcinoma diagnosis reagent is prepared |
| CN109762821A (en) * | 2019-02-28 | 2019-05-17 | 中山大学孙逸仙纪念医院 | Inhibit the RNA interfering of AFAP1-AS1 expression and increases the application in radiotherapy in breast cancer sensibility |
| WO2020000466A1 (en) * | 2018-06-29 | 2020-01-02 | 深圳市博奥康生物科技有限公司 | Lncrna afap1-as1 overexpression vector and preparation method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160537A (en) * | 2013-02-26 | 2013-06-19 | 中南大学 | Application method of long-chain non-coding ribonucleic acid (RNA) gene in preparation of interference inhibitor |
| CN104383559A (en) * | 2014-10-27 | 2015-03-04 | 中南大学 | Expression vector and anti-tumor reagent of long-chain non-coded RNALOC401317, and applications of expression vector and anti-tumor reagent |
-
2015
- 2015-08-20 CN CN201510512545.5A patent/CN105018498A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160537A (en) * | 2013-02-26 | 2013-06-19 | 中南大学 | Application method of long-chain non-coding ribonucleic acid (RNA) gene in preparation of interference inhibitor |
| CN104383559A (en) * | 2014-10-27 | 2015-03-04 | 中南大学 | Expression vector and anti-tumor reagent of long-chain non-coded RNALOC401317, and applications of expression vector and anti-tumor reagent |
Non-Patent Citations (3)
| Title |
|---|
| HAO BO等: "Upregulated long non-coding RNA AFAP1-AS1 expression is associated with progression and poor prognosis of nasopharyngeal carcinoma", 《ONCOTARGET》 * |
| WENJING WU等: "Hypomethylation of Noncoding DNA Regions and Overexpression of the Long Noncoding RNA, AFAP1-AS1, in Barrett’s Esophagus and Esophageal Adenocarcinoma", 《GASTROENTEROLOGY》 * |
| 杨青青等: "特异长链非编码RNA在鼻咽癌中的表达及其意义", 《肿瘤防治研究》 * |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624160A (en) * | 2015-12-24 | 2016-06-01 | 中国人民武装警察部队总医院 | Non-coding small RNA molecule ncRNA1351 of Brucella and application of non-coding small RNA molecule ncRNA1351 |
| CN109022600B (en) * | 2015-12-24 | 2021-08-03 | 中国人民武装警察部队总医院 | Application of non-coding small RNA molecule ncRNA1351 of Brucella |
| CN109022600A (en) * | 2015-12-24 | 2018-12-18 | 中国人民武装警察部队总医院 | The application of the non-coding small RNA molecular ncRNA1351 of brucella |
| CN105624160B (en) * | 2015-12-24 | 2018-09-14 | 中国人民武装警察部队总医院 | The non-coding small RNA molecular ncRNA1351 of brucella and its application |
| CN105602951A (en) * | 2016-01-29 | 2016-05-25 | 中南大学 | Interference preparation of long chain non-coding RNA LOC284454 and application thereof |
| CN105602951B (en) * | 2016-01-29 | 2018-09-11 | 中南大学 | The interference preparation of long-chain non-coding RNA LOC284454 and its application |
| CN106511368B (en) * | 2016-10-31 | 2018-10-26 | 中南大学 | The application of the siRNA of long-chain non-coding RNA LINC00152 and inhibitory preparation |
| CN106492228A (en) * | 2016-10-31 | 2017-03-15 | 中南大学 | The application of the siRNA of long-chain non-coding RNA LINC00673 and inhibitory preparation |
| CN106511368A (en) * | 2016-10-31 | 2017-03-22 | 中南大学 | Application of siRNA of long non-coding RNA LINC00152 and inhibiting preparation |
| CN106492228B (en) * | 2016-10-31 | 2018-10-26 | 中南大学 | The application of the siRNA of long-chain non-coding RNA LINC00673 and inhibitory preparation |
| CN106884016A (en) * | 2017-02-13 | 2017-06-23 | 中南大学 | The expression vector of long-chain non-coding RNA LINC00472, tumor suppression reagent and its application |
| CN108220436A (en) * | 2018-01-02 | 2018-06-29 | 深圳市第二人民医院 | Detect application of the reagent of long-chain non-coding RNA PVT1 expression quantity in nasopharyngeal carcinoma diagnosis reagent is prepared |
| CN108220436B (en) * | 2018-01-02 | 2020-07-03 | 深圳市第二人民医院 | Application of reagent for detecting long-chain non-coding RNA PVT1 expression quantity in preparation of nasopharyngeal carcinoma diagnostic reagent |
| CN108186665A (en) * | 2018-01-02 | 2018-06-22 | 深圳市第二人民医院 | Interfere application of the reagent of long-chain non-coding RNA PVT1 expression in nasopharyngeal carcinoma auxiliary treatment preparation is prepared |
| WO2020000466A1 (en) * | 2018-06-29 | 2020-01-02 | 深圳市博奥康生物科技有限公司 | Lncrna afap1-as1 overexpression vector and preparation method thereof |
| CN109762821A (en) * | 2019-02-28 | 2019-05-17 | 中山大学孙逸仙纪念医院 | Inhibit the RNA interfering of AFAP1-AS1 expression and increases the application in radiotherapy in breast cancer sensibility |
| CN109762821B (en) * | 2019-02-28 | 2021-10-01 | 中山大学孙逸仙纪念医院 | Interfering RNA for inhibiting expression of AFAP1-AS1 and application of interfering RNA in increasing sensitivity of breast cancer radiotherapy |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105018498A (en) | Application method of lnc RNA (long-chain non-coding ribonucleic acid) AFAP1-AS1 | |
| Li et al. | Advances in biological applications of self-assembled DNA tetrahedral nanostructures | |
| CN104878009A (en) | Interference preparation based on long non-coding RNA AFAP1-AS1 and application method of interference preparation | |
| CN104388543A (en) | In situ hybridization probe, reagent and application of long non-coding RNA LOC401317 | |
| CN103146693B (en) | Long chain non-coding RNA (Ribonucleic Acid) gene and application method thereof | |
| CN104383559B (en) | The expression vector of long-chain non-coding RNA LOC401317, tumor suppression reagent and application thereof | |
| CN104878100A (en) | Application of long-chain non-coding RNA AFAP1-AS1 in preparation of auxiliary diagnosis and prognosis judgment preparations for lung cancer | |
| CN103160580B (en) | Application method of long-chain non-coding ribonucleic acid (RNA) gene | |
| CN103160537A (en) | Application method of long-chain non-coding ribonucleic acid (RNA) gene in preparation of interference inhibitor | |
| CN105233304B (en) | Applications of the long-chain non-coding RNA LOC553103 on nasopharyngeal carcinoma cell inhibitor is prepared | |
| CN104894128A (en) | In-situ hybridization probe, in-situ hybridization detection reagent and application of long non-coding RNA AFAP1-AS1 | |
| CN105200152A (en) | Application of long-chain non-coding RNA (ribonucleic acid) gene LOC553103 in preparation of nasopharynx cancer prognosis preparation | |
| CN105602951B (en) | The interference preparation of long-chain non-coding RNA LOC284454 and its application | |
| CN105506154A (en) | Application of long non-coding RNA LOC284454 reagent in in-situ hybridization detection of nasopharyngeal carcinoma tissues | |
| CN109045304A (en) | A kind of kernel targeted nano carrier and its preparation method and application carrying Polymerase I inhibitor | |
| CN106032534A (en) | Ribonucleic acid aptamer capable of specifically being combined with human non-small cell lung cancer cells and screening method thereof | |
| Kou et al. | Ultrasensitive detection of circulating tumor cells in clinical blood samples by a three-dimensional network nanovehicle-based aptasensor platform | |
| CN105200156B (en) | Long-chain non-coding RNA LOC553103 application | |
| CN105154446B (en) | The application process of the microRNA BART10 antisense oligonucleotides of Epstein-Barr virus coding | |
| CN104894244A (en) | Primer, detection reagent and application of long-chain non-coded RNA AFAP1-AS1 | |
| CN105483273A (en) | Application of reagent for detecting long-chain non-coding RNA LOC284454 expression quantity in serum of patients with nasopharynx cancer | |
| CN105267987B (en) | Applications of the long-chain non-coding RNA LOC553103 on stomach cancer cell inhibitor is prepared | |
| CN105200155A (en) | Application of EBV (Epstein Barr Virus) encoded microRNA (micro ribonucleic acid) BART6-3p | |
| CN105238882A (en) | Application of EB virus encoded microRNA BART6-3p to preparation of nasopharyngeal cancer prognostic preparation | |
| CN105483271A (en) | Application of reagent for detecting long-chain non-coding RNA LOC284454 expression quantity in nasopharynx cancer tissue |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20151104 |
|
| WD01 | Invention patent application deemed withdrawn after publication |