CN109022600B - Application of non-coding small RNA molecule ncRNA1351 of Brucella - Google Patents

Abstract

The invention discloses an application of a non-coding small RNA molecule ncRNA1351 of Brucella, wherein a ncRNA1351 revertant is named as 16M-ncRNA1351, and a ncRNA1351 deletion mutant 16M delta ncRNA1351 is transformed into a sequence list with SEQ ID NO: 3 ncRNA1351 reverting vector ncRNA 1351-MCS. The ncRNA1351 revertant can be used for Brucella resistant drug screening with the ncRNA1351 as a target.

Description

Application of non-coding small RNA molecule ncRNA1351 of Brucella

The application is a divisional application with the title of 'non-coding small RNA molecule ncRNA1351 of Brucella and application thereof' on 2016, 26.2.25.

Technical Field

The invention relates to a small non-coding RNA (sRNA) of a bacterium, in particular to a non-coding small RNA molecule ncRNA1351 derived from Brucella, and functions and application thereof.

Background

Bacterial non-coding small RNAs (srnas) are RNA regulators found in prokaryotes such as bacteria in recent years, do not encode proteins, are usually located in intergenic regions, have a length of 50-400 nucleotides, and are widely involved in regulation of various vital activities in vivo. At present, non-coding small RNA has become the leading edge and hot spot of life science research. Bacterial sRNA is an important regulator of bacterial metabolism, virulence and adaptation to environmental stress, and plays an important role in gene expression regulation in response to environmental changes. sRNA exerts a bioregulatory effect primarily by base pairing to bind to target mRNA. Most studies of the bacterial sRNA have been focused on model organisms such as escherichia coli so far, but with the progress of the studies, more and more studies have been directed to pathogenic bacteria such as: vibrio cholerae, listeria monocytogenes, pseudomonas aeruginosa, mycobacterium tuberculosis, salmonella, streptococcus pneumoniae, staphylococcus aureus, etc. Among these pathogens, sRNA has been shown to regulate gene expression at the post-transcriptional level and to play an important role in stress response and virulence regulation.

Brucellosis is a zoonosis caused by the invasion of brucella into organisms, is widely prevalent in China, not only causes huge economic loss to livestock production in China, but also seriously threatens the healthy life of people, and is an important public health problem. Brucella is an intracellular parasitic bacterium, mainly parasitizes in monocytes (mainly macrophages) of organisms, intracellular survival and replication are key to pathogenesis of Brucella, and adaptation to an intracellular environment is also key to intracellular survival of Brucella. Therefore, understanding how brucella adapts to and survives the harsh intracellular environment is crucial to understanding the pathogenesis of brucella. Since sRNA is an important regulator of bacterial adaptation to environmental pressure, the inventors speculate that sRNA plays a certain role in the regulation of intracellular survival and virulence of Brucella. Therefore, identifying sRNA of brucella and studying its function will help to understand the pathogenesis of brucella. Researchers have predicted non-coding small Brucella RNA, including BSR-2, BSR-16, etc., and patent document CN103710345A also discloses a non-coding small Brucella RNA related to intracellular survival and virulence of Brucella.

Disclosure of Invention

The invention aims to provide a primer and a probe for detecting the expression quantity of a small non-coding RNA molecule from Brucella and a revertant of the RNA molecule.

The small non-coding RNA (sRNA) derived from Brucella is named ncRNA1351, and the nucleotide sequence of the small non-coding RNA is shown as SEQ ID NO: 1 or a sequence shown as SEQ ID NO: l is a nucleotide sequence which has homology of more than 90 percent and is related to the virulence and the intracellular survival capability of the Brucella, or is a nucleotide sequence shown in SEQ ID NO: l is obtained by modifying the nucleotide sequence shown by the general formula I through sulfo modification or/and methoxyl modification.

The ncRNA1351 reverting vector belongs to the invention. The reverting vector is named ncRNA1351-MCS and consists of SEQ ID NO: 3, respectively.

The invention relates to a Brucella non-coding small RNA molecule ncRNA1351 revertant, which is named as 16M-ncRNA1351 and is prepared from SEQ ID NO: 3 ncRNA1351-MCS, a reversion vector shown in the figure.

Specifically, the restoring vector ncRNA1351-MCS plasmid DNA is electrically transformed into an electrocompetent cell of the ncRNA1351 deletion mutant 16M delta ncRNA1351, and a double-resistant clone is screened, namely the ncRNA1351 restoring strain 16M-ncRNA 1351.

The ncRNA1351 deletion mutant 16M delta ncRNA1351 is obtained by transforming ncRNA1351 deletion mutant vector ncRNA1351-NC-T (the nucleotide sequence of which is shown as SEQ ID NO: 2 in a sequence table) by taking Brucella (Brucella melitensis)16M as an initial strain.

The invention also discloses application of the non-coding small RNA molecule ncRNA1351 revertant 16M-ncRNA1351 in brucella resistance drug screening.

The invention also provides a primer for detecting the expression of the ncRNA1351DNA of the non-coding small RNA molecule of Brucella, which comprises the following components:

ncRNA1351-RT-F: GGTCGAGAAATTGCGACTGA, and

ncRNA1351-RT-R：GGCGGCGTTTTCGTTTC。

the invention also provides a probe for detecting the expression of the non-coding small RNA molecule ncRNA1351RNA of Brucella, wherein the probe is a digoxin labeled probe and has the sequence as follows:

ACGGTCGAGAAATTGCGACTGATGCCATCTTAGCTACATACCCCCGGCTGACATGGTAAGGATAGCCCCGGAAAGCCATCGGTTCCCTATAGTGAGTCGTATTA。

the invention predicts and analyzes a new Brucella non-coding small RNAncRNA1351 by a bioinformatics method. Northern blot experiments confirmed the presence of ncRNA1351 in brucella. The function of ncRNA1351 is analyzed by constructing brucella deletion mutant strains and revertants of ncRNA1351, and the experimental result shows that: after ncRNA1351 is deleted, the viability of the Brucella under the pressure condition simulating the environment in macrophages is obviously weakened, and the viability of the Brucella in mice is also reduced, which indicates that the ncRNA1351 is related to the virulence of the Brucella. Therefore, the ncRNA1351 can be used as a target spot to prepare the brucella resistance medicament, the length of the brucella resistance medicament is 105nt, and the brucella resistance medicament is shorter than that of the RNA BSR0601 which is researched in the prior art, and has higher application value. The invention plays an important role in preventing and treating brucellosis, and the ncRNA1351 revertant can be used for screening brucellosis-resistant medicaments taking the ncRNA1351 as a target.

The present invention will be described in further detail with reference to specific examples.

Drawings

FIG. 1 shows the Northern blot detection result of the expression condition of ncRNA1351 in different growth stages of Brucella (Brucella melitensis) 16M;

FIG. 2 is a graph of transcription of ncRNA1351 under various stress conditions mimicking the environment within macrophages, such as acid, heat, nutrient deficiency, oxidative stress, and the like;

FIG. 3A is a physical map of ncRNA1351 deletion mutant vector ncRNA 1351-NC-T;

FIG. 3B is a physical map of ncRNA1351 revertant vector ncRNA 1351-MCS;

FIG. 4 shows the results of RT-PCR identification of ncRNA1351 deletion mutant 16M. DELTA. ncRNA1351 and ncRNA1351 revertant 16M-ncRNA 1351;

FIG. 5 shows the results of the viability assay of ncRNA1351 deleted mutant 16 M.DELTA.ncRNA 1351 and ncRNA1351 revertant 16M-ncRNA1351 under stress conditions mimicking the environment in macrophages;

FIG. 6 shows the results of mouse virulence experiments with deletion mutant of ncRNA1351, 16M. DELTA. ncRNA1351 and a revertant of ncRNA1351, 16M-ncRNA 1351.

Detailed Description

The methods used in the following examples are conventional unless otherwise specified, and specific procedures can be found in: molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).

The percentage concentration is a mass/mass (W/W, unit g/100mL) percentage concentration, a mass/volume (W/V, unit g/100mL) percentage concentration, or a volume/volume (V/V, unit mL/100mL) percentage concentration, unless otherwise specified.

The various biological materials described in the examples are obtained by way of experimental acquisition for the purposes of this disclosure and should not be construed as limiting the source of the biological material of the invention. In fact, the sources of the biological materials used are wide and any biological material that can be obtained without violating the law and ethics can be used instead as suggested in the examples.

Brucella melitensis (Brucella melitensis or b.melitensis)16M (wild strain) was supplied by the national CDC.

The primers and probes used were synthesized by Dalibao Biotech, and the plasmids were synthesized by Shanghai Bioengineering, Inc.

The embodiments are provided in order to provide detailed embodiments and specific procedures, which will help understanding of the present invention, but the scope of the present invention is not limited to the following embodiments.

Example 1 obtaining of sequence of non-coding Small RNA molecule ncRNA1351 of Brucella

Chromosomal sequences (two chromosomes, NC-003317.1 and NC-003318.1, designated I and II) of Brucella (Brucella or B.meilitensis) 16M (wild strain) were downloaded from NCBI (ftp:// ftp. NCBI. nih. gov/genes/Bacteria /), and intergenic regions (referring to the sequence between the two open reading frames) fragments were extracted from the downloaded sequences. The intergenic region was searched for promoters (cut-off value was 255) with pftools 2.3(http:// www.isrec.isb-sib. ch/ftp-server/pftools /), for terminators with RNAmid, wherein the motif descriptor was derived from (http:// www.tufts.edu/sackler/waldolab/NAPRredict /), then the intergenic region with the complete transcription unit was predicted on the basis of redundancy removal (referring to the repeated sequence), the sequences containing tRNA and rRNA were removed, and finally, conserved intergenic region was found as a candidate (small non-coding RNA, sRNA) sequence by BLAST alignment.

Among candidate sRNA sequences, ncRNA1351 is a small non-coding RNA predicted on the antisense strand of chromosome 16M I of Brucella melitensis (Brucella melitensis), and its nucleotide sequence is shown in SEQ id no: 1, 1405195 at the 5 'end (referring to sequence number in Genbank), 1405091 at the 3' end (referring to sequence number in Genbank), and 105nt long, and the coding gene thereof is located in the intergenic region between (Brucella melitensis)16M BMEI1351 (referring to site number in Genbank) and BMEI1350 (referring to site number in Genbank). BLAST alignment results show that the homology of the ncRNA1351 among brucella species reaches 100%, which indicates that the ncRNA1351 has high conservation, and the result also conforms to the characteristics of sRNA.

Example 2 Northern blot validation of the expression of ncRNA1351 in different growth stages of Brucella 16M

Northern blots are gold standards for the identification of small non-coding RNAs. Since expression of small non-coding RNAs is often growth-time dependent, Northern blot can be used to detect the expression of ncRNA1351 in different growth stages of brucella 16M. The method comprises the following steps:

1) designing a primer according to the coding sequence of the ncRNA1351, and adding a T7 promoter sequence outside a reverse primer, wherein the primer sequence is ncRNA 1351-p-F: ACGGTCGAGAAATTGCGA and ncRNA 1351-p-R:TAATACGACTCACTATAGGGAACCGATGGCTTTCCGGG (underlined sequence is the T7 promoter sequence).

2) Firstly, taking genome DNA of Brucella melitensis (Brucella melitensis)16M (wild strain) as a template, preparing a DNA template of a probe by PCR amplification of primers ncRNA1351-p-F and ncRNA1351-p-R, and carrying out 25-mul PCR reaction system: 10 XBuffer 2.5. mu.l, dNTPs (2.5mmol/L) 2. mu.l, primer ncRNA1351-p-F (10. mu. mol/L) 0.5. mu.l, primer ncRNA1351-p-R (10. mu. mol/L) 0.5. mu.l, EX Taq (5U/mL) 0.2. mu.l, template DNA 3. mu.l, ddH₂O17. mu.l. The PCR reaction conditions are as follows: 7min at 95 ℃; 30 cycles of 95 ℃ for 30s, 56 ℃ for 30s, and 72 ℃ for 30 s; 10min at 72 ℃.

3) Taking the DNA obtained in the step 2) as a template, and preparing a digoxin labeled probe of the ncRNA1351 by in vitro transcription with T7 polymerase, wherein the sequence of the probe is as follows:

ACGGTCGAGAAATTGCGACTGATGCCATCTTAGCTACATACCCCCGGCTGACATGGTAAGGATAGCCCCGGAAAGCCATCGGTTCCCTATAGTGAGTCGTATTA

the transcription system is: template DNA 1. mu.g, DIG-11-UTP Mix 2. mu.l, 5 × Transcription buffer 4. mu.l, RiboLock^TMRNase Inhibitor (40U/. mu.l) 1. mu.l, T7RNA Polymerase (20U/. mu.l) 1.5. mu.l, DEPC water to 20. mu.l, mix well. The transcription conditions were: carrying out in-vitro transcription reaction for 2h at 37 ℃ in a PCR instrument; adding 1. mu.l DNase I (2U/. mu.l) to treat and digest DNA at 37 ℃ for 30 min; then 2. mu.l EDTA (0.2M, pH 8.0) was added to stop the reaction; adding 30 μ l DEPC treated water to make the total volume to 50 μ l; adding 1/10 volumes of 5M ammonium acetate (5. mu.l) and 3 volumes of pre-cooled absolute ethanol (150. mu.l), vortex mixing, standing overnight at 20 ℃; centrifuging at 12,000rpm and 4 deg.C for 15min, rinsing with 75% ethanol for 2 times, discarding the supernatant, and air drying. The RNA probe was dissolved in 50. mu.l DEPC water. And add theretoAdding 20U RNase Inhibitor, subpackaging with 5 μ l, and preserving at-80 deg.C.

4) Brucella melitensis (Brucella melitensis)16M (wild strain) was cultured to early logarithmic growth (EP, OD)₆₀₀0.5) and plateau (ST, OD)₆₀₀And 2.0), extracting the total RNA of the Brucella melitensis (Brucella melitensis)16M by adopting a Trizol method, taking the total RNA of the Brucella melitensis (Brucella melitensis)16M as a template, and carrying out Northern blot verification by using the probe prepared in the step 3).

Northern blot verification results are shown in FIG. 1, and the ncRNA1351 is transcribed in the middle logarithmic growth phase and the plateau phase of Brucella melitensis (Brucella melitensis)16M, which proves that the ncRNA1351 is actually present in Brucella 16M.

Example 3 expression analysis of ncRNA1351 under different stress conditions mimicking the macrophage internal Environment

Since bacterial sRNA expression is associated with stress conditions, transcription of ncRNA1351 under various stress conditions simulating the macrophage internal environment, such as acid, nutrient deficiency, oxidative stress, etc., was examined by RT-PCR. The method comprises the following steps:

1) culturing to mid-logarithmic growth phase (OD)₆₀₀1.2) of Brucella melitensis (Brucella melitensis)16M (wild strain) was centrifuged, and the cells were collected in (i) TSB (TSB is soybean tryptone broth, purchased from Bio Meiriea) 7.0(pH 7.0, standard), and (ii) GEM7.0 (nutrient-deficient medium, MgSO 2 in each liter of medium)₄.7H₂O 0.2g，Citric acid.H₂O 2.0g，K₂HPO₄ 10.0g，NaNH₄HPO₄.4H₂O3.5g, 20g glucose, pH 7.0), 7.0, 42 deg.C TSB (thermal stimulation), 4.0 acid TSB (acid), 7.0 TSB (1.5 mM H)₂O₂Culturing for 30min under (high oxygen) condition.

2) The RNA of Brucella melitensis (Brucella melitensis)16M cultured under different conditions is extracted by a Trizol method, the RNA is digested by DNAse I and used as a template, and primers ncRNA1351-RT-F: GGTCGAGAAATTGCGACTGA and ncRNA1351-RT-R are used: GGCGGCGTTTTCGTTTC expression levels of ncRNA1351 were measured using primers 16 sRNA-RT-F: CACTGGACCATTACTGACGC and 16 sRNA-RT-R: ACTAAGGGCGAGGGTTGC detecting the expression level of 16S rRNA, wherein the 16S rRNA is a positive internal control gene, and 25 μ l of PCR reaction system is as follows: 2 Xonestrep SYBR RT-PCR Buffer 12.5. mu.l, Takara ExTaq (5U/. mu.l) 0.5. mu.l, RT Enzyme Mix II 0.5. mu.l, Forward primer (10. mu.M) 1. mu.l, Reverse primer (10. mu.M) 1. mu.l, RNase free H₂O8.5. mu.l, Total RNA 100 ng; the PCR reaction conditions are as follows: 5min at 42 ℃; 10s at 95 ℃; 95 ℃ for 5s, 56 ℃ for 30s, 72 ℃ for 30s, 45 cycles.

3) Calculation of relative quantification adopts 2^-ΔΔCtMethod analysis, i.e. Δ Ct target gene ═ Ct (target gene) -Ct (same sample 16S rRNA); Δ Δ Ct target gene (experimental group) — Δ Ct target gene (control group), and relative fold (experimental group/control group) — 2^-ΔΔCt. The experiment was performed 3 times, with TSB7.0 as a control group (relative transcription level set to 1), and the remaining conditions as an experimental group. The experiment was repeated 3 times and the mean was calculated.

The results are shown in FIG. 2, and it can be seen that ncRNA1351 is in acid (TSB4.0), nutrient deficiency (GEM7.0), oxidative stress condition (H)₂O₂) And the expression level under the stress condition of simulating the macrophage internal environment such as heat (42 ℃) is obviously increased, and the ncRNA1351 is possibly related to adaptation of brucella to the macrophage internal environment.

Example 4 functional analysis of ncRNA1351

To further analyze the role ncRNA1351 plays in brucella intracellular survival and virulence, mutants and revertants of ncRNA1351 were constructed and relevant phenotypic experiments were performed.

1. Construction and verification of ncRNA1351 mutant strain and revertant strain

The N-terminal homologous arm of ncRNA1351 is amplified by using genomic DNA of Brucella melitensis (Brucella melitensis)16M (wild strain) as a template and primers ncRNA1351-N-F and ncRNA1351-N-R, and the C-terminal homologous arm of ncRNA1351 is amplified by using primers ncRNA1351-C-F and ncRNA 1351-C-R. Using pUC19K (purchased from Dalibao Biopsis) as a template, kanamycin resistance gene (Kan gene) was amplified using primers Kana-F and Kana-R. After the PCR amplification product was recovered with a DNA gel purification recovery kit (purchased from Promega), the N-terminal homology arm, the C-terminal homology arm, and the Kan gene were mixed at an equal molar ratio as a template to perform fusion PCR amplification. PCR amplification was performed in two rounds and designated PCR-1 and PCR-2, respectively.

(1) Primer sequences

ncRNA1351-N-F：GTACAAAAAAGCAGGCTTAGGTACCCCAGCATCAACATCAGCACG

ncRNA1351-N-R：GCTGACATTCATCCCAGGTGGCGCCGTAACGCAGTCAAGGAC；

ncRNA1351-C-F：ACTCTGGGGTTCGAAATGACCGTCTCGAAGGGCCGCATGTTT

ncRNA1351-C-R：TGTACAAGAAAGCTGGGTCCTGCAGCCTCCTTTATGTCAGGCGTTGC；

Kan-F：ATCAGGACATAGCGTTGGC

Kan-R：GGCAAGAAAGCCATCCAGT；

pBBR-F：GCGAAAGGGGGATGTGCTGC

pBBR-R：AGCGCGCAATTAACCCTCAC。

(2) Fusion PCR amplification

PCR-1 reaction System:

PCR-1 reaction conditions: 5min at 94 ℃; 30s at 94 ℃, 30s at 66 ℃, 60s at 72 ℃ and 10 cycles.

The obtained PCR-1 solution was diluted 10 times and used as a template for the second PCR (PCR-2) for the second round of PCR amplification.

PCR-2 reaction System:

PCR-2 reaction conditions: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 56 ℃ for 30s, 72 ℃ for 60 s; 10min at 72 ℃. And (3) carrying out gel cutting recovery on the PCR-2 reaction product by using a DNA gel purification recovery kit to obtain a recovered fragment, namely the ncRNA1351 deletion mutation box, which is named as ncRNA 1351-NC.

(3) Construction of ncRNA1351 deletion mutant vector

Deletion mutation cassettes ncRNA1351-NC and pMD18-T Simple Vector (purchased from Dalibao Bio) were ligated, the ligation product was transformed into E.coli DH 5. alpha. competent cells, the transformation product was spread on ampicillin (100. mu.g/mL) resistant LB plates, and colony PCR identification was performed on resistant clones on the plates using primers ncRNA1351-N-F and ncRNA 1351-C-R. Amplifying a 1997bp DNA fragment (the DNA fragment is a fusion fragment of an N-terminal homologous arm, a Kan gene and a C-terminal homologous arm) which is a positive clone, extracting a plasmid from the clone identified as positive, carrying out enzyme digestion identification on the plasmid by using Kpn I enzyme, and obtaining a positive plasmid of a 4689bp DNA fragment by enzyme digestion, which shows that the ncRNA1351 deletion mutant vector ncRNA1351-NC-T is successfully constructed, and the nucleotide sequence of the positive plasmid is shown as SEQ ID NO: 2, and the physical map is shown in fig. 3A.

(4) Screening and identification of ncRNA1351 deletion mutant strain

The deletion mutation vector ncRNA1351-NC-T plasmid DNA and 80 mu l of Brucella melitensis 16M competent cells are fully mixed, precooled for 15min, then shocked under the conditions of 18kV/cm and 400 omega, 1mL of TSB culture medium is immediately added for resuspension of bacteria after shocking, the bacteria are transferred into a 1.5mL centrifuge tube for resuscitation at 37 ℃ for 24h, the recovered transformation product is coated with a TSA plate containing 50 mu g/mL of kanamycin after serial dilution, the TSA plate is cultured at 37 ℃ for more than 72h, kanamycin resistant clones are screened, namely the deletion mutation strain of the ncRNA1351, and the ncRNA1351 is named as 16M delta ncRNA 1351.

(5) Construction of ncRNA1351 Recover vector

PCR amplification is carried out by taking genomic DNA of Brucella melitensis (Brucella melitensis)16M as a template and taking ncRNA1351-N-F and ncRNA1351-C-R as primers. The PCR amplification product was recovered by gel cutting using a DNA gel purification recovery kit, then double-digested with Kpn I and Pst I, and ligated with the plasmid pRR1MCS-4 double-digested with the same enzymes (see Kovach M, Elzer P, Steven Hill D, et al. four new derivatives of the broad-host-range cloning vector pBBR1MCS, cloning differential anti-reactive cassettes. Gene,1995,166: 175-. The ligation product was transformed into E.coli DH 5. alpha. competent cells, and the transformed product was spread on an ampicillin (100. mu.g/mL) resistant LB plate, and resistant clones on the plate were identified by PCR using primers pBBR1-F and pBBR 1-R. Amplifying to obtain a 1204bp DNA fragment which is a positive clone, extracting a plasmid from the clone identified as positive, wherein the extracted plasmid is a recovery vector and is named as ncRNA1351-MCS, and the nucleotide sequence of the recovery vector is shown as SEQ ID NO: 3, and the physical map is shown in FIG. 3B.

(6) Screening of ncRNA1351 revertants

The revertant vector ncRNA1351-MCS plasmid DNA is electrically transformed into 16M delta ncRNA1351 electrocompetent cells, a TSA double-resistant plate containing 50 mu g/mL kanamycin and 100 mu g/mL ampicillin is coated, the TSA double-resistant plate is cultured at 37 ℃ for more than 72h, and double-resistant clones are screened, wherein the double-resistant clones are ncRNA1351 revertant strains and are named as 16M-ncRNA 1351.

(7) RT-PCR validation of 16M. DELTA. ncRNA1351 and 16M-ncRNA1351

To verify the deletion mutant of ncRNA1351 and the revertant of ncRNA1351, the transcription of ncRNA1351 in three strains, i.e., Brucella melitensis (Brucella melitensis)16M (wild strain), 16M. DELTA. ncRNA1351 and 16M-ncRNA1351, can be analyzed by RT-PCR, and the deletion mutant of ncRNA1351 and the revertant of ncRNA1351 can be verified from the transcription level. The three strains are cultured in TSB medium to the middle logarithmic growth phase (OD)₆₀₀1.2), and then extracting total RNA by Trizol RNA extraction method. After total RNA is digested by DNAseI, random primers are used as reverse transcription primers, M-MLV reverse transcriptase is used for reverse transcription to form cDNA, and the reaction system and the reaction conditions are as follows: adding 1 mug random primer into 2 mug total RNA, placing the PCR tube in a PCR instrument for 10min at 70 ℃, and releasing the secondary structure in the template; the PCR tube was quickly placed on ice for 5min to prevent secondary structure reformation; centrifuging for a short time, and collecting the solution at the bottom of the tube; the following ingredients were added to the mixture of primers and template in the following order: M-MLV 5 × reaction buffer 5. mu.l, dNTP (2.5mM each) 5. mu.l,

ribonuclose Inhibitor (40U/. mu.l) 25U, M-MLV reverse transcriptase (200U/. mu.l) 1. mu.l, water: (Nuclease free) to 25 μ Ι; flick the tube wall, mix the reaction solution, incubate at 37 ℃ for 60 min. And performing RT-PCR verification by using cDNA as a template and primers ncRNA1351-RT-F and ncRNA1351-RT-R aiming at the ncRNA1351, wherein the PCR reaction system is as follows: template 1. mu.l, dNTPs (2.5mM each) 2. mu.l, upstream primer (20. mu.M) 0.5. mu.l, downstream primer (20. mu.M) 0.5. mu.l, 10 XPCR Buffer 2.5. mu.l, rTaq (5U/. mu.l) 0.125. mu.l, sterile deionized water to 25. mu.l; the PCR reaction conditions are as follows: 5min at 95 ℃; 30 cycles of 95 ℃ for 30s, 60 ℃ for 30s and 72 ℃ for 30 s; 7min at 72 ℃.

As shown in FIG. 4, it was found that the expression levels of 16s rRNA were the same in 16M, 16M. DELTA. ncRNA1351 and 16M-ncRNA1351 of Brucella melitensis, indicating that the cDNA levels of these three strains were consistent. Therefore, the ncRNA1351 expression analysis of these three strains can be performed. No ncRNA1351 is expressed in 16M delta ncRNA1351, and the ncRNA1351 is expressed in 16M-ncRNA1351 and recovered, and the experimental results prove that the ncRNA1351 deletion mutant 16M delta ncRNA1351 and the ncRNA1351 recovered strain 16M-ncRNA1351 are successfully constructed.

2. Viability assay of ncRNA1351 deleted mutants and revertants under stress conditions mimicking the environment within macrophages

Brucella is an intracellular parasitic bacterium that contains multiple bactericidal (bacteriostatic) mechanisms in the internal environment of macrophages, and therefore brucella must adapt to these mechanisms to multiply intracellularly. To analyze the role of ncRNA1351 in Brucella resistance and adaptation to these conditions, a number of intracellular conditions including oxidative stress, thermal stress, acid stress, high osmotic stress, etc. were simulated in vitro and Brucella melitensis (Brucella melitensis)16M, 16M Δ ncRNA1351, 16M-ncRNA1351, respectively, were treated under these conditions and then observed for their respective survival rates under these conditions.

The specific experimental method comprises the following steps: culturing to mid-logarithmic growth phase (OD)₆₀₀1.2) of Brucella melitensis (Brucellaleinsis) 16M (wild strain), 16M. DELTA. ncRNA1351, and 16M-ncRNA1351, washed 1 time with PBS, resuspended, and cultured in a medium containing 440mM H₂O₂In TSB liquid (40 min); ② TSB liquid preheated at 50 ℃ (60 min); ③ TSB liquid with pH3.0 (10 min); fourthly1.5M aqueous NaCl solution (30 min); fifth, coating TSA plate for counting after dilution in multiple proportion in different culture mediums such as TSB liquid (40min, contrast) at 37 ℃, and observing the viability of Brucella melitensis (Brucella melitensis)16M, 16M delta ncRNA1351 and 16M-ncRNA1351 in high osmotic pressure, oxidation pressure, thermal pressure and acid pressure environments. Results are expressed as percentages, setting the survival rate of the control bacteria as 100%. The experiment was repeated 3 times and the mean was calculated.

The results are shown in fig. 5, and it can be seen that the viability of the ncRNA1351 deletion mutant 16M Δ ncRNA1351 is significantly reduced under conditions of high osmotic pressure, oxidation, heat and acid stimulation compared with Brucella melitensis (Brucella melitensis)16M, and the results suggest that the viability of Brucella in vitro stimulation is reduced after the ncRNA1351 is deleted; the viability of the ncRNA1351 revertant 16M-ncRNA1351 was further restored under conditions of high osmotic pressure, oxidation, heat and acid challenge compared to the ncRNA1351 deletion mutant 16 M.DELTA.ncRNA 1351. Experimental results indicate that correct expression of ncRNA1351 is essential for the survival of brucella under stress conditions mimicking the environment within macrophages.

3. Mouse toxicity test of ncRNA1351 deletion mutant strain and revertant strain

Brucella is an intracellular parasite that, following infection, first invades the regional lymph nodes of the host and then migrates to other organs and tissues. Spleen is an organ rich in immune cells, and brucella is mainly parasitized in phagocytes, so that spleen is one of the main sites where brucella inhabits. One of the important indicators of the pathogenicity of Brucella is the number of bacteria carried in the spleen. To further determine the role of ncRNA1351 in brucella intracellular survival and virulence, mouse virulence experiments were performed.

6-8-week-old Balb/c mice are selected and randomly divided into 4 groups, and each group comprises 30 mice, namely a Brucella melitensis (Brucella melitensis)16M (wild strain) group, a 16M delta ncRNA1351 deletion mutant strain group, a 16M-ncRNA1351 revertant strain group and a normal saline negative control group. The method comprises the following specific steps: culturing Brucella melitensis (Brucella melitensis)16M wild strain, 16M delta ncRNA1351 and 16M-ncRNA1351 to the middle stage of logarithmic growth(OD₆₀₀1.2), mice were then infected at the peritoneal cavity, 1 infection, with each group of bacteria at a concentration of 5 × 10⁵CFU/mL, 200. mu.l per mouse. At various time points (7, 14, 28, 45d) post-infection, 5 mice per group were sacrificed, spleens were removed rapidly under sterile conditions, 1mL of phosphate buffer containing 0.1% Triton X-100 was added, homogenized with a glass homogenizer, tissue homogenates were serially diluted 10-fold, and 100. mu.L of each homogenate at appropriate dilutions were selected for plating on TSA plates and CFU was calculated.

The results are shown in fig. 6, and it can be seen that the viability of the ncRNA1351 deletion mutant 16M Δ ncRNA1351 in mice was significantly reduced at different time points after infection compared to Brucella melitensis (Brucella melitensis)16M, and at 45 days after infection, there was almost no ncRNA1351 deletion mutant in the spleen of mice, while the viability of the ncRNA1351 revertant 16M-ncRNA1351 was similar to Brucella melitensis (Brucella melitensis)16M, indicating that the reduction in virulence in mice was indeed caused by the deletion of ncRNA 1351. The experimental result proves that the ncRNA1351 is related to the virulence of the Brucella.

Sequence listing

<110> general hospital for armed police force of China people

Application of ncRNA1351 of non-coding small RNA molecule of <120> Brucella

<130> CGCNB185075（165020）D

<160> 3

<210> 1

<211> 105

<212> RNA

<213> "Brucella melitensis" sequence, nucleotide sequence of Brucella non-coding small RNA molecule ncRNA1351

<400> 1

acggucgaga aauugcgacu gaugccaucu uagcuacaua cccccggcug acaugguaag 60

gauagccccg gaaagccauc gguuuuucgg gguuucuuuu agaga 105

<210> 2

<211> 4689

<212> DNA

<213> Artificial sequence, nucleotide sequence of ncRNA1351 deletion mutant vector ncRNA1351-NC-T

<400> 2

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240

attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300

tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360

tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa agaagcatga cggcaagtgg 420

acgatgtaca aaaaagcagg cttaggtacc ccagcatcaa catcagcacg gaaccggcga 480

cgccgagcgt aaagccttcg tccagcactt ccaccgtgaa acggcgaaag ccgcgcacgc 540

gaaaacgccg ggagaaaatc gtgatgtttt cccaccattc gcccaagcgg aaatgtaaat 600

tgtagagcgc ggaatcaatc caggcgtcga gtccgatcag gcgcgaaacc cggaagggct 660

tacgcttgtc gtttccgcga tctttttctg ccgtattacg catgaacact gacttcggca 720

tagggttgtc ggagacaagg cgagatttgc ctcagtatca taacagataa ataagctagc 780

tcacgcaaaa tagctaaatg aaatatgcgg attgatttta tgtaggaaag aaatcaataa 840

ataggaaaat agtccttgac tgcgttacgg cgccacctgg gatgaatgtc agctactggg 900

ctatctggac aagggaaaac gcaagcgcaa agagaaagca ggtagcttgc agtgggctta 960

catggcgata gctagactgg gcggttttat ggacagcaag cgaaccggaa ttgccagctg 1020

gggcgccctc tggtaaggtt gggaagccct gcaaagtaaa ctggatggct ttcttgccgc 1080

caaggatctg atggcgcagg ggatcaagat ctgatcaaga gacaggatga ggatcgtttc 1140

gcatgattga acaagatgga ttgcacgcag gttctccggc cgcttgggtg gagaggctat 1200

tcggctatga ctgggcacaa cagacaatcg gctgctctga tgccgccgtg ttccggctgt 1260

cagcgcaggg gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac 1320

tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct tgcgcagctg 1380

tgctcgacgt tgtcactgaa gcgggaaggg actggctgct attgggcgaa gtgccggggc 1440

aggatctcct gtcatctcac cttgctcctg ccgagaaagt atccatcatg gctgatgcaa 1500

tgcggcggct gcatacgctt gatccggcta cctgcccatt cgaccaccaa gcgaaacatc 1560

gcatcgagcg agcacgtact cggatggaag ccggtcttgt cgatcaggat gatctggacg 1620

aagagcatca ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg cgcatgcccg 1680

acggcgagga tctcgtcgtg acccatggcg atgcctgctt gccgaatatc atggtggaaa 1740

atggccgctt ttctggattc atcgactgtg gccggctggg tgtggcggac cgctatcagg 1800

acatagcgtt ggctacccgt gatattgctg aagagcttgg cggcgaatgg gctgaccgct 1860

tcctcgtgct ttacggtatc gccgctcccg attcgcagcg catcgccttc tatcgccttc 1920

ttgacgagtt cttctgagcg ggactctggg gttcgaaatg accgtctcga agggccgcat 1980

gtttcggcat cgacacccat tacaattcat ggatagcaca gttgaaaacc gggaaggggc 2040

tggcgcagcg gcacgaacgc atccgcctgg cgtaccagct acaggtgagg cacggcatta 2100

cggctgaaga cctcgcaaaa attctgggcc tttcggaaga aaggtatgac ctgtggttgc 2160

ggcggctgaa atgcaccggc agcgaggcaa aggcgccgca gcgcccgatt gagggcgctt 2220

tcgagcggct gcaagcggaa ttgcaacgat tgctcgatgg ggaacagctt cccgacaaga 2280

gcaaggccga agccttgatg gcgctggcaa aagcggtgaa gacggtggat gaactaaccg 2340

cagaaagcac aaccacagag acgggacggg agattgcaac gcctgacata aaggaggctg 2400

caggacccag ctttcttgta caatctccag aggatcgccg ggaaccgagg acgagttcgt 2460

aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca 2520

tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc taactcacat 2580

taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt 2640

aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct 2700

cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa 2760

aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa 2820

aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc 2880

tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga 2940

caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc 3000

cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt 3060

ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct 3120

gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg 3180

agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta 3240

gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct 3300

acactagaag aacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa 3360

gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt 3420

gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta 3480

cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat 3540

caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa 3600

gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct 3660

cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta 3720

cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct 3780

caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg 3840

gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa 3900

gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt 3960

cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta 4020

catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca 4080

gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta 4140

ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct 4200

gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg 4260

cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac 4320

tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact 4380

gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa 4440

atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt 4500

ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat 4560

gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg 4620

acgtctaaga aaccattatt atcatgacat taacctataa aaataggcgt atcacgaggc 4680

cctttcgtc 4689

<210> 3

<211> 5888

<212> DNA

<213> Artificial sequence, nucleotide sequence of ncRNA1351 revertant vector ncRNA1351-MCS

<400> 3

ctcgggccgt ctcttgggct tgatcggcct tcttgcgcat ctcacgcgct cctgcggcgg 60

cctgtagggc aggctcatac ccctgccgaa ccgcttttgt cagccggtcg gccacggctt 120

ccggcgtctc aacgcgcttt gagattccca gcttttcggc caatccctgc ggtgcatagg 180

cgcgtggctc gaccgcttgc gggctgatgg tgacgtggcc cactggtggc cgctccaggg 240

cctcgtagaa cgcctgaatg cgcgtgtgac gtgccttgct gccctcgatg ccccgttgca 300

gccctagatc ggccacagcg gccgcaaacg tggtctggtc gcgggtcatc tgcgctttgt 360

tgccgatgaa ctccttggcc gacagcctgc cgtcctgcgt cagcggcacc acgaacgcgg 420

tcatgtgcgg gctggtttcg tcacggtgga tgctggccgt cacgatgcga tccgccccgt 480

acttgtccgc cagccacttg tgcgccttct cgaagaacgc cgcctgctgt tcttggctgg 540

ccgacttcca ccattccggg ctggccgtca tgacgtactc gaccgccaac acagcgtcct 600

tgcgccgctt ctctggcagc aactcgcgca gtcggcccat cgcttcatcg gtgctgctgg 660

ccgcccagtg ctcgttctct ggcgtcctgc tggcgtcagc gttgggcgtc tcgcgctcgc 720

ggtaggcgtg cttgagactg gccgccacgt tgcccatttt cgccagcttc ttgcatcgca 780

tgatcgcgta tgccgccatg cctgcccctc ccttttggtg tccaaccggc tcgacggggg 840

cagcgcaagg cggtgcctcc ggcgggccac tcaatgcttg agtatactca ctagactttg 900

cttcgcaaag tcgtgaccgc ctacggcggc tgcggcgccc tacgggcttg ctctccgggc 960

ttcgccctgc gcggtcgctg cgctcccttg ccagcccgtg gatatgtgga cgatggccgc 1020

gagcggccac cggctggctc gcttcgctcg gcccgtggac aaccctgctg gacaagctga 1080

tggacaggct gcgcctgccc acgagcttga ccacagggat tgcccaccgg ctacccagcc 1140

ttcgaccaca tacccaccgg ctccaactgc gcggcctgcg gccttgcccc atcaattttt 1200

ttaattttct ctggggaaaa gcctccggcc tgcggcctgc gcgcttcgct tgccggttgg 1260

acaccaagtg gaaggcgggt caaggctcgc gcagcgaccg cgcagcggct tggccttgac 1320

gcgcctggaa cgacccaagc ctatgcgagt gggggcagtc gaaggcgaag cccgcccgcc 1380

tgccccccga gcctcacggc ggcgagtgcg ggggttccaa gggggcagcg ccaccttggg 1440

caaggccgaa ggccgcgcag tcgatcaaca agccccggag gggccacttt ttgccggagg 1500

gggagccgcg ccgaaggcgt gggggaaccc cgcaggggtg cccttctttg ggcaccaaag 1560

aactagatat agggcgaaat gcgaaagact taaaaatcaa caacttaaaa aaggggggta 1620

cgcaacagct cattgcggca ccccccgcaa tagctcattg cgtaggttaa agaaaatctg 1680

taattgactg ccacttttac gcaacgcata attgttgtcg cgctgccgaa aagttgcagc 1740

tgattgcgca tggtgccgca accgtgcggc accctaccgc atggagataa gcatggccac 1800

gcagtccaga gaaatcggca ttcaagccaa gaacaagccc ggtcactggg tgcaaacgga 1860

acgcaaagcg catgaggcgt gggccgggct tattgcgagg aaacccacgg cggcaatgct 1920

gctgcatcac ctcgtggcgc agatgggcca ccagaacgcc gtggtggtca gccagaagac 1980

actttccaag ctcatcggac gttctttgcg gacggtccaa tacgcagtca aggacttggt 2040

ggccgagcgc tggatctccg tcgtgaagct caacggcccc ggcaccgtgt cggcctacgt 2100

ggtcaatgac cgcgtggcgt ggggccagcc ccgcgaccag ttgcgcctgt cggtgttcag 2160

tgccgccgtg gtggttgatc acgacgacca ggacgaatcg ctgttggggc atggcgacct 2220

gcgccgcatc ccgaccctgt atccgggcga gcagcaacta ccgaccggcc ccggcgagga 2280

gccgcccagc cagcccggca ttccgggcat ggaaccagac ctgccagcct tgaccgaaac 2340

ggaggaatgg gaacggcgcg ggcagcagcg cctgccgatg cccgatgagc cgtgttttct 2400

ggacgatggc gagccgttgg agccgccgac acgggtcacg ctgccgcgcc ggtagcactt 2460

gggttgcgca gcaacccgta agtgcgctgt tccagactat cggctgtagc cgcctcgccg 2520

ccctatacct tgtctgcctc cccgcgttgc gtcgcggtgc atggagccgg gccacctcga 2580

cctgaatgga agccggcggc acctcgctaa cggattcacc gtttttatca ggctctggga 2640

ggcagaataa atgatcatat cgtcaattat tacctccacg gggagagcct gagcaaactg 2700

gcctcaggca tttgagaagc acacggtcac actgcttccg gtagtcaata aaccggtaaa 2760

ccagcaatag acataagcgg ctatttaacg accctgccct gaaccgacga ccgggtcgaa 2820

tttgctttcg aatttctgcc attcatccgc ttattatcac ttattcaggc gtagcaccag 2880

gcgtttaagg gcaccaataa ctgccttaaa aaaattacgc cccgccctgc cactcatcgc 2940

agtcggccta ttggttaaaa aatgagctga tttaacaaaa atttaacgcg aattttaaca 3000

aaatattaac gcttacaatt tccattcgcc attcaggctg cgcaactgtt gggaagggcg 3060

atcggtgcgg gcctcttcgc tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg 3120

attaagttgg gtaacgccag ggttttccca gtcacgacgt tgtaaaacga cggccagtga 3180

gcgcgcgtaa tacgactcac tatagggcga attggagctc caccgcggtg gcggccgctc 3240

tagaactagt ggatcccccg ggctgcagcc tcctttatgt caggcgttgc aatctcccgt 3300

cccgtctctg tggttgtgct ttctgcggtt agttcatcca ccgtcttcac cgcttttgcc 3360

agcgccatca aggcttcggc cttgctcttg tcgggaagct gttccccatc gagcaatcgt 3420

tgcaattccg cttgcagccg ctcgaaagcg ccctcaatcg ggcgctgcgg cgcctttgcc 3480

tcgctgccgg tgcatttcag ccgccgcaac cacaggtcat acctttcttc cgaaaggccc 3540

agaatttttg cgaggtcttc agccgtaatg ccgtgcctca cctgtagctg gtacgccagg 3600

cggatgcgtt cgtgccgctg cgccagcccc ttcccggttt tcaactgtgc tatccatgaa 3660

ttgtaatggg tgtcgatgcc gaaacatgcg gcccttcgag agccggaatt ctctaaaaga 3720

aaccccgaaa aaccgatggc tttccggggc tatccttacc atgtcagccg ggggtatgta 3780

gctaagatgg catcagtcgc aatttctcga ccgtagccaa tatctaccaa agcgccgtaa 3840

cgcagtcaag gactattttc ctatttattg atttctttcc tacataaaat caatccgcat 3900

atttcattta gctattttgc gtgagctagc ttatttatct gttatgatac tgaggcaaat 3960

ctcgccttgt ctccgacaac cctatgccga agtcagtgtt catgcgtaat acggcagaaa 4020

aagatcgcgg aaacgacaag cgtaagccct tccgggtttc gcgcctgatc ggactcgacg 4080

cctggattga ttccgcgctc tacaatttac atttccgctt gggcgaatgg tgggaaaaca 4140

tcacgatttt ctcccggcgt tttcgcgtgc gcggctttcg ccgtttcacg gtggaagtgc 4200

tggacgaagg ctttacgctc ggcgtcgccg gttccgtgct gatgttgatg ctggggtacc 4260

cagcttttgt tccctttagt gagggttaat tgcgcgcttg gcgtaatcat ggtcatagct 4320

gtttcctgtg tgaaattgtt atccgctcac aattccacac aacatacgag ccggaagcat 4380

aaagtgtaaa gcctggggtg cctaatgagt gagctaactc acattaattg cgttgcgctc 4440

actgcccgct ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg 4500

cgcggggaga ggcggtttgc gtattgggcg catgcataaa aactgttgta attcattaag 4560

cattctgccg acatggaagc catcacaaac ggcatgatga acctgaatcg ccagcggcat 4620

cagcaccttg tcgccttgcg tataatattt gcccattcaa atatgtatcc gctcatgaga 4680

caataaccct gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat 4740

ttccgtgtcg cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca 4800

gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc 4860

gaactggatc tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca 4920

atgatgagca cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg 4980

caagagcaac tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca 5040

gtcacagaaa agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata 5100

accatgagtg ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag 5160

ctaaccgctt ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg 5220

gagctgaatg aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca 5280

acaacgttgc gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta 5340

atagactgga tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct 5400

ggctggttta ttgctgataa atctggagcc ggtgagcgtg ggtctcgcgg tatcattgca 5460

gcactggggc cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag 5520

gcaactatgg atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat 5580

tggtaactgt cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt 5640

taatttaaaa ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatccaggtg 5700

gcacttttcg gggaaatgtg cgcgcccgcg ttcctgctgg cgctgggcct gtttctggcg 5760

ctggacttcc cgctgttccg tcagcagctt ttcgcccacg gccttgatga tcgcggcggc 5820

cttggcctgc atatcccgat tcaacggccc cagggcgtcc agaacgggct tcaggcgctc 5880

ccgaaggt 5888

Claims (6)

1. A primer for detecting ncRNA1351DNA expression of a non-coding small RNA molecule of brucella, comprising:

ncRNA1351-RT-F: GGTCGAGAAATTGCGACTGA, and

ncRNA1351-RT-R：GGCGGCGTTTTCGTTTC；

the ncRNA1351 is a non-coding small RNA molecule derived from Brucella, and the nucleotide sequence of the ncRNA is shown as SEQ ID NO: 1 or SEQ ID NO: l is obtained by modifying the nucleotide sequence shown by the general formula I through sulfo modification or/and methoxyl modification.

2. The probe for detecting the RNA expression of the non-coding small RNA molecule ncRNA1351 of the Brucella is a digoxin labeled probe, and has the sequence: ACGGTCGAGAAATTGCGACTGATGCCATCTTAGCTACATACCCCCGGCTGACATGGTAAGGATAGCCCCGGAAAGCCATCGGTTCCCTATAGTGAGTCGTATTA, respectively;

the ncRNA1351 is a non-coding small RNA molecule derived from Brucella, and the nucleotide sequence of the ncRNA is shown as SEQ ID NO: 1 or SEQ ID NO: l is obtained by modifying the nucleotide sequence shown by the general formula I through sulfo modification or/and methoxyl modification.

3. A non-coding small RNA molecule ncRNA1351 revertant of Brucella, named 16M-ncRNA1351, characterized in that a ncRNA1351 revertant vector is transformed in a Brucella wild strain 16M, and the ncRNA1351 revertant vector is named as a revertant vector ncRNA 1351-MCS;

the ncRNA1351 is a non-coding small RNA molecule derived from Brucella, and the nucleotide sequence of the ncRNA is shown as SEQ ID NO: 1 or SEQ ID NO: l is a nucleotide sequence obtained by modifying a nucleotide sequence shown by the formula I through sulfo or/and methoxyl;

the nucleotide sequence of the reply vector ncRNA1351-MCS is shown as SEQ ID NO: 3 or SEQ ID NO: 3 is obtained by modifying the nucleotide sequence shown in the formula I with sulfo or/and methoxyl.

4. The Brucella non-coding small RNA molecule ncRNA1351 revertant of claim 3,

the restoring vector ncRNA1351-MCS plasmid DNA is electrically transformed into ncRNA1351 deletion mutant 16M delta ncRNA1351 electrocompetent cells, and double-resistant clones are screened.

5. The Brucella non-coding small RNA molecule ncRNA1351 revertant of claim 4,

the ncRNA1351 deletion mutant 16M delta ncRNA1351 is obtained by transforming ncRNA1351 deletion mutant vector ncRNA1351-NC-T by taking Brucella 16M as an initial strain;

the nucleotide sequence of the ncRNA1351 deletion mutant vector ncRNA1351-NC-T is shown as SEQ ID NO: 2 or SEQ ID NO: 2 is obtained by modifying the nucleotide sequence shown in the formula 2 through sulfo or/and methoxyl.

6. The non-coding small RNA molecule ncRNA1351 revertant of any one of claims 3 to 5 for use in drug screening against Brucella.

Images