CN109593761B - Small RNA related to Brucella virulence and application thereof in preparation of attenuated Brucella - Google Patents

Abstract

The invention discloses small RNA related to Brucella virulence and application thereof in preparation of attenuated Brucella. The invention uses Northern blot to prove that sRNA Clu7 exists in Brucella virulent strain M28, constructs the sRNA deletion strain M28 delta Clu7 by using a homologous recombination method, and evaluates the influence of the sRNA on M28 virulence by taking mouse macrophage RAW264.7 and Balb/c mice as models. The results show that the sRNA deletion can significantly reduce the ability of the virulent strain M28 to replicate and survive in the mouse macrophage RAW264.7 and the mouse spleen. At week 5 of inoculation, M28 Δ Clu7 was completely cleared from the mice and significantly reduced virulence compared to M28. The mouse challenge protection experiment shows that: the protection effect of the immune M28 delta Clu7 on the mice against virulent M28 infection achieves the protection effect of the vaccine strain M5-90. The above results indicate that sRNA Clu7 has a large determining effect on the virulence of Brucella. The invention provides a great promotion effect on revealing a Brucella virulence mechanism. Provides a new technical means for the research and development of new candidate vaccine strains of the Brucella.

Description

Small RNA related to Brucella virulence and application thereof in preparation of attenuated Brucella

Technical Field

The invention relates to small RNA related to Brucella virulence, and also relates to application of the small RNA in preparation of attenuated Brucella. The invention belongs to the field of biotechnology.

Background

Brucellosis (brucellosis), abbreviated as brucellosis, is a chronic bacterial infectious disease of zoonosis caused by Brucella, is widely distributed all over the world, is also a serious epidemic area of China, and is the first of the world of new annual cases of animals and human beings. The disease distribution causes great damage to the health of people and agricultural cultivation in China. After infection of brucella in human, the symptoms of wavy heat, endocarditis, arthritis and the like are shown, and after infection of animals, abortion and the like can be caused. In contrast to enteropathogenic bacteria, brucella virulence is not dependent on the expression of specific virulence factors, but rather on its ability to replicate and survive within the host cell. Animal disease distribution is prevalent except in Hainan province, and is severely prevalent in the three north, and at present, immunization is performed on animals in class I areas. New cases of people in nearly 5 years in China all reach more than 6 thousands of people. Brucella has a potential biological safety hazard and is defined as a class B bioterrorism agent by the united states centers for disease prevention and control.

Brucella belongs to alpha proteobacteria, gram negative bacteria, is intracellular parasitic bacteria, grows slowly, can avoid the immune system of a host and grows in macrophages latently. The discovery direction of researchers has been long for revealing the virulence and pathogenic mechanism of brucella. The main characteristic of virulent and attenuated strains is that the virulent strains can be infected latently all the time, and the attenuated strains can be cleared in vivo after a period of time.

Bacteria have a variety of regulatory mechanisms, and among them, RNA having a regulatory function is considered to be an important component of its intrinsic regulatory mechanism, such as small RNA (sRNA) and the like. The bacterial sRNA is a non-coding small RNA with a regulation function, most of the bacterial sRNA is positioned in an encoding intergenic region, the length of the bacterial sRNA is 50-500 nt, and the bacterial sRNA plays a wide regulation role in bacterial life activities, such as regulation of iron metabolism, sugar metabolism, bacterial virulence, signal transmission, quorum sensing and the like. Most of the srnas found to date are located on bacterial chromosomes, and some are located on extrachromosomal genetic material such as transposons, plasmids, and the like. Brucella can infect humans or a variety of animals (cattle, sheep, pigs, dogs, etc.), and when cultured in vitro, it can infect a variety of cells including macrophages, reticuloendothelial cells, and this multi-homing property may be related to sRNA regulation. It is speculated that brucella theoretically should have 100-200 srnas, and only two srnas, AbsR1 and AbsR2, have been identified and relatively few studies have been performed.

The inventor identifies a small RNA (sRNA) capable of determining the virulence of the Brucella, fills the defects in the research aspect of the sRNA of the Brucella, plays a great promoting role in disclosing the virulence mechanism of the Brucella, provides a new technical means for researching and developing new candidate vaccine strains of the Brucella, and has wide application prospect.

Disclosure of Invention

One of the purposes of the invention is to provide a novel small RNA related to the virulence of Brucella and application thereof in preparing attenuated Brucella.

The second purpose of the invention is to provide attenuated Brucella and a construction method thereof.

The invention also aims to provide the application of the attenuated Brucella in the preparation of attenuated Brucella vaccines.

In order to achieve the purpose, the invention adopts the following technical means:

the present inventors identified a small RNA (sRNA) that determines the virulence of Brucella, designated sRNA Clu 7. The invention uses northern blot to prove that sRNA Clu7 exists in Brucella virulent strain M28, constructs the sRNA deletion strain M28 delta Clu7 by using a homologous recombination method, and evaluates the influence of the sRNA on M28 virulence by taking mouse macrophage RAW264.7 and Balb/c mice as models. The results show that the sRNA deletion can significantly reduce the ability of the virulent strain M28 to replicate and survive in the mouse macrophage RAW264.7 and the mouse spleen. At week 5 of inoculation, M28 Δ Clu7 was completely cleared from the mice and significantly reduced virulence compared to M28. The mouse challenge protection experiment shows that: the protection effect of the immune M28 delta Clu7 on the mice against virulent M28 infection achieves the protection effect of the vaccine strain M5-90. The above results indicate that sRNALU 7 has a large determinant effect on the virulence of Brucella and potential as a vaccine.

Therefore, on the basis of the research, the invention provides small RNA related to brucella virulence, which is named sRNA Clu7 and has a coding nucleotide sequence shown as SEQ ID NO. 1.

Furthermore, the invention also provides application of the small RNA related to the Brucella virulence in Brucella virulence evaluation. And

the small RNA related to the Brucella virulence is applied to the preparation of attenuated Brucella.

The attenuated Brucella is characterized in that the genome of the Brucella does not contain a sequence for coding small RNA related to the Brucella virulence.

Preferably, the attenuated Brucella is prepared by the following method:

(1) synthesizing primers for constructing the attenuated Brucella:

Clu7_L-F：5’GGTGACACTATAGAACTCGAGAGAGCGAGGGCAAACGCC3’

Clu7_L-R：5’AGATATGAAGACCCATTACCGACAG3’

Clu7_K-F：5’GGTAATGGGTCTTCATATCTTTCAAATATGTATCCGCTCATGAGA3’

Clu7_K-R：5’CCATCGGTCATCATCAGAAGAACTCGTCAAGAAGGC3’

Clu7_R-F：5’CTTCTGATGATGACCGATGGCACCG3’

Clu7_R-R：5’TATAGGGAGACCGGCAGATCTGCTTCTCAGCGTGCTTGAAGA3’

Clu7YL_F：5’TTCGCTGGCATAGGCATTGGCTCTC3’

Clu7YL_R：5’CCAGCCGGCCACAGTCGATGAATCC3’

Clu7YR_F：5’CCGACCTGTCCGGTGCCCTGAATGA3’

Clu7YR_R：5’ATGAAGTGCGCTATGAGGGCCGTGG3’

(2) construction of suicide plasmids

Respectively carrying out PCR amplification on N-terminal and C-terminal homologous arms of a Clu7 gene by using brucella M28 genome DNA as a template and primers Clu7_ L-F, Clu7_ L-R and Clu7_ R-F, Clu7_ R-R; using pBlue-Kan as template, primer Clu7_ K-F and Clu7_ K-R were used to amplify Kan^rAn expression cassette; the pSP72 vector is subjected to double enzyme digestion by XhoI and BglII, the three target fragments are recovered by gel cutting, the ligation product is transformed into a competent cell, and Kan is coated^rScreening positive clones by using a resistant plate, and naming the obtained positive clones as pSP 72-delta Clu 7-k;

(3) electric shock transformation of suicide plasmid and identification and screening of Clu7 gene deletion strain

Electrically transforming pSP 72-delta Clu7-k into Brucella M28 competent cells, screening obtained positive clones with kanamycin resistance, carrying out streak passage on screened candidate deletion strains to detect the stability of the candidate deletion strains, respectively amplifying kan resistance genes from two sides of a genome by using primers Clu7YL _ F, Clu7YL _ R and Clu7YR _ F, Clu7YR _ R, completing PCR identification, further sequencing identification, selecting positive strains, carrying out amplification culture, and storing to obtain the attenuated Brucella, wherein the attenuated Brucella is named as M28 delta Clu 7.

Furthermore, the invention also provides application of the attenuated Brucella in preparation of the attenuated Brucella vaccine.

Compared with the prior art, the invention has the beneficial effects that:

according to the invention, researches show that the sRNA Clu7 gene has a huge virulence determining function, and the M28 delta Clu7 strain lacking the gene is completely eliminated from a mouse body 5 weeks after immunization, which is essentially different from the parent strain M28. Compared with viruses, brucella has huge genome (about 350 ten thousand bp), the environment adapting ability of the brucella is far stronger than that of the viruses, the function loss caused by the deletion of single gene can be supplemented by other compensation mechanisms or redundancy mechanisms, and therefore, the modification of bacteria by using the deletion of single gene to obtain attenuated strain is a difficult task. Clu7, it can be seen from the results of the present invention that M28 has a bacterial content of about 4.7Log10 in the spleen of mice at week 5, whereas M28 Δ Clu7 is 0 at this time, and this great change is of great significance in revealing the intracellular survival mechanism of Brucella.

The invention proves that the virulence of the Brucella can be obviously reduced after the sRNA clu7 is deleted, the pathogenic mechanism of the Brucella can be understood, and a new technical means is provided for the research and development of a new candidate vaccine strain of the Brucella.

Drawings

FIG. 1 is Northern blot analysis of Brucella M28sRNA Clu 7;

FIG. 2 shows the construction and identification of suicide plasmids;

a: constructing pSP 72-delta Clu7-k plasmid; m: DNA Marker DL5000, L: clu7 left homology arm, K: kan gene, R: a right homology arm;

b: PCR identification of pSP72- Δ Clu7-k plasmid; m: DNA Marker DL5000, 1: full-length amplification of the inserted sequence;

FIG. 3 shows the PCR identification of M28. delta. Clu7 deletion strain;

m: DNA Marker DL5000, YL: left homology arm, YR: m28;

FIG. 4 shows that Clu7 affects brucella intracellular survival ability (. about.P < 0.01);

FIG. 5 is a graph showing that Clu7 affects the virulence of Brucella in mice (P < 0.01);

FIG. 6 is an assessment of the immunoprotective effect of M28 Δ Clu 7.

Detailed Description

The present invention is further described below in conjunction with specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. These examples are merely illustrative and do not limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

Example 1

1 materials and methods

1.1 strains, plasmids and vectors

Brucella M28 was stored in the biological safety third-level laboratory of Harbin veterinary institute of Chinese academy of agricultural sciences, and plasmids pSP72 and pBlue-Kan (described in "construction of Saccharomyces cerevisiae ERG6 gene deletion mutant, journal of northwest agriculture proceedings" 03 st 2012, Lei Ji et al "documents, stored and provided by Harbin veterinary institute of Chinese academy of agricultural sciences) were stored in this laboratory. DH5 α competent cells were purchased from Nanjing Novophilia. SPF-grade BALB/c mice 6-7 weeks old were purchased from Experimental animals technology, Inc. of Wei Tong Hua, Beijing.

All experiments involving Brucella strains and their pathogenicity were performed in biosafety third-level laboratories.

1.2 reagents

Brucella Selective Supplement is available from OXOID, TSB, TSA from BD.

Super-Fidelity DNA Polymerase、

Multi S One Step Cloning Kit and

II One Step Cloning Kit was purchased from Nanjing Novophilia, plasmid mini-extraction Kit and gel recovery Kit were purchased from OMEGA, XhoI and Bgl II were purchased from NEB, plasmid extraction Kit was purchased from Qiagen, and bacterial genomic DNA extraction Kit was purchased from Tiangen Biotechnology Ltd.

1.3 methods

1.31 primer design and Synthesis

Primers for constructing sRNA Clu 7-deleted strain, each synthesized by harbin bosch biotechnology limited, were designed and synthesized based on the M28 gene information in GenBank (table 1).

Table 1 construction of sRNA Clu 7-deleted Strain and identification primers

1.3.2 extraction of Brucella Total RNA

Inoculating the activated strain into 5mL of TSB culture medium, performing shake culture at 37 ℃ and 200rpm until the late logarithmic phase, adding 1 volume of bacterial liquid into 2 volumes of RNA protect Bacteria Reagent, rapidly performing vortex shake for 5s, and performing action at 15-25 ℃ for 5 min. Centrifuging at 5,000g for 10min, completely discarding supernatant, and storing the thallus precipitate at-80 deg.C for a short time.

The total RNA of the thalli is extracted by using a TRIzol method, and the operation steps are slightly modified and briefly described as follows: the bacterial pellet treated by RNA protect Bacteria Reagent is collected and added with 100 mu L lysozyme and 4 mu L RNase inhibitor RNase for action for 15 min. Add 800. mu.L of ice-cold TRIzol Reagent, mix well with vigorous shaking, and let stand at room temperature for 10 min. Adding 200 μ L chloroform, mixing by inversion twice, shaking vigorously, mixing for 15s to make the mixture milky white, and standing at room temperature for 10 min. Centrifuge at 12,000g for 15min at 4 ℃. The upper aqueous phase was transferred to a fresh Ep tube and 5. mu.g RNase-free glycogen was mixed with an equal volume of isopropanol and precipitated overnight after mixing. Centrifugation at 12,000g for 15min at 4 ℃ was carried out, taking care and removing as much of the supernatant as possible. The precipitate was washed twice with 1mL of 75% ethanol, and the RNA precipitate was collected, dried and dissolved in an appropriate volume of RNase-free water.

1.3.3 Northern blot validation sRNA Clu7

According to

Instructions for Kit use the procedure is now briefly described as follows: first, RNase was used

The comprehensive spraying of reagent system glue ware, comb etc. probably direct or indirect contact's consumptive material uses autoclaving water washing 2 ~ 3 times, dries for subsequent use. Secondly, weighing 1g of agar, adding 90mL of RNase-free water, putting the agar into a water bath at 50-60 ℃ until the agar is balanced, and adding 10mL of 10 XDesurring Gel Buffer to finish preparing the formaldehyde modified agarose Gel. The RNA samples were mixed with a triple volume (3V) of Formaladehydeload Dye. The reaction was carried out at 65 ℃ for 15min and immediately afterwards placed on ice. Agarose gel electrophoresis was performed after the samples were prepared. The electrophoresis voltage is 5V/cm, and the time is not more than 3 h. After electrophoresis is finished, performing siphon film transfer according to the description for 1.5-2 h. After the transfer of the membrane was completed, the electric transfer membrane was rapidly removed with tweezers, and the salt and Gel were removed by washing in a 1 × Gel Running Buffer. Transferring the membrane to an ultraviolet crosslinking instrument, crosslinking for 30 s-1 min at 120mJ, and washing the membrane with DEPC water for three times. Finally, the DNA probe was added to the hybridization solution ULTRAhyb and the membrane was hybridized overnight. And (5) washing the membrane the next day, and exposing and detecting by using an X-ray film at the temperature of 15-25 ℃.

1.3.4 construction of 28. delta. Clu7 Gene-deleted Strain

1.3.4.1 construction of suicide plasmids

Suicide plasmids were constructed as follows: respectively carrying out PCR amplification on N-terminal and C-terminal homologous arms by using M28 genome DNA as a template and primers Clu7_ L-F, Clu7_ L-R and Clu7_ R-F, Clu7_ R-R; using pBlue-Kan as template, primer Clu7_ K-F and Clu7_ K-R were used to amplify Kan^rAn expression cassette; the pSP72 vector was double digested with XhoI and BglII. Cutting Gel and recovering the three target fragments, and referring to an OMEGA Gel Extraction Kit. Use of

The MultiS One Step Cloning Kit was set up on ice as follows:

and (3) uniformly mixing by using a pipette, reacting at 37 ℃ for 30min, carrying out ice bath for 5min, and storing at-20 ℃ for later use. Adding 20 μ L of the reaction solution into 200 μ L of competent cells, transforming in a conventional manner, and coating with Kan^rResistant plates, PCR identification of picked monoclonals, screening positive clones and sequencing by Boshi biosequence.

1.3.4.2 Brucella M28 shock-competent preparation

Inoculating the strain stored at-80 deg.C to 5mL TSB culture medium, shake culturing at 37 deg.C to late logarithmic phase, activating, transferring to 200mL TSB culture medium, and shake culturing to OD₆₀₀1.0. Performing ice bath for 30min, centrifuging at 4 deg.C and 6000rpm for 5min, collecting thallus precipitate, repeatedly washing with 10% glycerol water solution for 3 times, collecting thallus precipitate, adding 10% glycerol water solution with appropriate volume, packaging according to 100 μ L per bag, and storing at-80 deg.C for use.

1.3.4.3 electric shock transformation of suicide plasmid and identification and screening of Clu7 gene deletion strain

Fully and uniformly mixing pSP 72-delta Clu7-k and 100 mu L of competent cells, precooling for 15min, using a transformation cup with the length of 0.1cm, selecting a Bacterial mode by an electric shock transformation instrument, quickly transferring the mixture into 900 mu L of SOC culture medium after electric shock, carrying out shake culture and activation for 4h at the temperature of 37 ℃, completely coating the mixture on a Carna resistant TSA culture medium, and observing the colony condition after 3-5 days.

Carna-resistant colonies were streaked into TSA media containing Carna-resistant and ampicillin-resistant colonies, respectively, and further screened to determine positive clones. The screened positive clone only has kanamycin resistance, and the stability of the screened candidate deletion strain is tested by streak passage. The candidate deletion strain was freshly cultured and genomic DNA extraction was performed using a bacterial genomic DNA extraction kit (Tiangen). Primers Clu7YL _ F, Clu7YL _ R and Clu7YR _ F, Clu7YR _ R are used for amplifying the kan resistance genes from two sides of the genome respectively, PCR identification is completed, and sequencing identification is further carried out. And selecting a positive strain, performing amplification culture, and preserving the positive strain, wherein the positive strain is named as M28 delta Clu 7.

1.3.4.4 effect of sRNA Clu7 on the ability of Brucella M28 to replicate within macrophages

When RAW264.7 mouse macrophages were cultured in a 24-well plate and formed about 70% monolayer cells, brucella M28 and M28 Δ Clu7 infected the cells at a MOI of 100. Centrifuging at 1000rpm for 5min, and containing 5% CO at 37 deg.C₂Incubate in cell incubator for 3 h. And then washing with PBS three times, washing off extracellular bacteria of uninfected cells, adding a 5% DMEM medium containing 5 mu g/mL gentamicin to maintain infection until the old medium is discarded after 24 hours, and adding a new medium after washing with PBS three times to maintain infection for 48 hours. Samples were taken at different time points (8h, 24h and 48h) post infection. PBS washing three times, adding cold TritonX-100 containing 0.1% to lyse cells, ten-fold diluting, plating and counting the viable bacteria amount.

1.3.4.5 influence of Clu7 on the ability of Brucella M28 to replicate in mice

SPF-grade BALB/c mice from 96 females of 6-7 weeks of age were divided equally into four groups (24/group) with 6 mice per group at each time point. 100 mu L of Brucella virulent strain M28, vaccine strain M5-90, sRNA deletion strain M28 delta Clu7 and PBS are respectively injected into the abdominal cavity, and the inoculation dose is 1 multiplied by 10⁶CFU/only. Spleens were aseptically weighed at 3d, 7d, 21d, and 35d post-infection, 1mL of PBS containing 0.1% Triton X-100 was added, ground using a tissue grinder, diluted ten-fold, 100. mu.L spread on TSA plates, 37 deg.CAnd (5) counting the culture.

1.3.4.5 evaluation of M28. delta. Clu7 immunoprotection Effect in CD-1 mice

60 CD-1 mice were grouped as follows. The short-term immunization group (immunization 45d) comprises 10 animals each and three groups including M28 delta Clu7, M5-90 and PBS. Long-term immunization group (immunization 150d) 10 per group, three groups, including M28. delta. Clu7, M5-90 and PBS. Immunization groups Each mouse was separately immunized intraperitoneally at 1X 10⁵M5-90 for CFU or M28 Δ Clu 7. PBS control group Each mouse was inoculated with 100. mu.L of sterile PBS. After short-term 45d and long-term 150d immunization, each mouse was immunized with the virulent strain M28 at 1X 10⁴And (3) performing dose detoxification on CFU, taking and weighing the spleen aseptically 15 days after detoxification, adding 1mL of PBS containing 0.1% TritonX-100, grinding by using a tissue grinder, diluting by ten times, taking 100 mu L of the diluted product, coating the 100 mu L of the diluted product on a TSA (TSA) plate, and performing culture counting at 37 ℃.

2 results

2.1 Northern blot validation of sRNA Clu7

Total RNA of Brucella M28 and M28 delta Clu7 is extracted, RNA with good integrity is selected for northern blot detection after detection, and DNA probes marked by DIG are used for hybridization, so that the result shows that sRNALU 7 exists in M28, and a target band disappears after the sRNA is deleted, indicating that the sRNA exists in M28 (figure 1).

2.2 construction and identification of pSP72- Δ Clu7-k suicide plasmid

Using M28 genomic DNA as a template, the homology arms at the left and right of the Clu7 gene (shown in SEQ ID NO. 1) and the kan resistance gene were amplified separately, and the plasmid pSP72 vector was ligated to construct plasmid pSP 72-. DELTA.Clu 7-k (FIG. 2A). And selecting candidate plasmids and completing suicide plasmid identification in a PCR amplification and plasmid sequencing mode. The suicide plasmid contains upstream and downstream fragments of the Clu7 gene and a kanamycin expression cassette, and the total length of the suicide plasmid is about 2256bp after cloning by using a one-step method. As shown in FIG. 2B, the amplification results after PCR verification using the primers Clu7_ L-F and Clu7_ R-R were in agreement with the expectations, and the suicide plasmid was named pSP 72-. DELTA.Clu 7-k.

2.3 identification of the 28 Δ Clu7 deletion Strain

After kanamycin and ampicillin selection, a deletion strain with only kanamycin resistance was obtained. A pair of identifying primers Clu7YL _ F, Clu7YL _ R and Clu7YR _ F, Clu7YR _ R are designed on the outer side genomes of the left and right homology arms of a deleted gene Clu7, and the screened deleted strain is amplified and identified by taking the M28 delta Clu7 genome as a template. Respectively amplifying an YL fragment with the size of 1986bp and an YR fragment with the size of 1544bp, wherein the sizes are consistent with the preset sizes, and indicating that a deletion strain of Clu7 is successfully constructed (figure 3).

2.4 Effect of Clu7 on the ability of Brucella M28 to survive in macrophages

In order to detect whether the deletion of the Clu7 has an influence on the intracellular viability of the Brucella M28, the experiment takes RAW264.7 mouse macrophages as a model, and the intracellular viability counts of the wild strain M28 and the deleted strain M28 delta Clu7 at 8h, 24h and 48h after the infected cells are respectively detected. The results show that the intracellular viability of the deletion strain M28 delta Clu7 is not significantly reduced compared with the wild strain M28 within 24h of infection, but the intracellular viability of the deletion strain is significantly reduced (P <0.01) at 48h of infection (FIG. 4). The results indicate that the deletion of sRNAGlu 7 reduces the ability of Brucella M28 to replicate and survive in cells.

2.5 Effect of Clu7 on the replication ability of Brucella M28 in mice

M28, M28. delta. Clu7 and M5-90 were mixed at 1X 10⁶CFU/dose, i.p. infected 6-7 week old female SPF grade BALB/c mice were sacrificed at 3d, 7d, 21d and 35d post infection, spleens were aseptically harvested, weighed and ground counted, and spleen weight and splenic burden were determined to measure the survival of the different strains in mice. Spleen weight results show that the weight average of the spleen of mice infected with 7d M28, M28 delta Clu7 and M5-90 after infection is increased, the weight average of the spleen of mice infected with the deletion strain M28 delta Clu7 and the vaccine strain M5-90 at 21d and 35d after infection is similar to that of the spleen of mice infected with the deletion strain M28 delta Clu7, and the weight average of the spleen of the mice infected with the vaccine strain M5-90 is obviously reduced compared with that of the wild strain M28 (P28)<0.01) (fig. 5B). Splenic load results showed that both the deletion strain M28 Δ Clu7 and the vaccine strain M5-90 were significantly reduced at 3d, 7d, 21d and 35d after infection of mice compared to the virulent strain M28, and spleen cells of M28 Δ Clu7 infected mice were cleared by the body at day 35d (FIG. 5A). The above results indicate that M28 has a significantly reduced ability to replicate and survive in mouse spleen after deletion of sRNAclu7, and is lower than that of vaccine strain M5-90.

2.6 evaluation of immunoprotective Effect of M28 Δ Clu7

To evaluate the immunoprotection effect of M28 Δ Clu7, we selected vaccine strain M5-90 as the immune control group and PBS as the non-immune control group. The vaccine was infected with virulent strain M28 at 45 and 150 days after immunization, and spleen was taken 15 days later for isolation and counting of Brucella. The results showed that the number of splenic isolates in the immunized group (M28 Δ Clu7 and M5-90) was significantly lower than that in the non-immunized group (PBS), and that the number of splenic isolates in the M28 Δ Clu7 immunized group mice was similar to, or even slightly lower than, that in the M5-90 immunized group (FIG. 6). The results show that the M28 delta Clu7 has good immune protection effect after immunization.

Sequence listing

<110> Harbin veterinary institute of Chinese academy of agricultural sciences (Harbin center of Chinese center of animal health and epidemiology)

<120> small RNA related to Brucella virulence and application thereof in preparation of attenuated Brucella

<130> KLPI180960

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 163

<212> DNA

<213> Clu7

<400> 1

aacccttttg gaagccgttg cctgtcggta atgggtcttc atatctgcca ttgggcgaaa 60

gtgccgcagt ttcgataatc aaagctgcgc ttttctcccc agactttcag gattgagaag 120

atgaaagcca atatccatcc cgactaccac accatcaagg tcg 163

<210> 2

<211> 39

<212> DNA

<213> artificial sequence

<400> 2

ggtgacacta tagaactcga gagagcgagg gcaaacgcc 39

<210> 3

<211> 25

<212> DNA

<213> artificial sequence

<400> 3

agatatgaag acccattacc gacag 25

<210> 4

<211> 45

<212> DNA

<213> artificial sequence

<400> 4

ggtaatgggt cttcatatct ttcaaatatg tatccgctca tgaga 45

<210> 5

<211> 36

<212> DNA

<213> artificial sequence

<400> 5

ccatcggtca tcatcagaag aactcgtcaa gaaggc 36

<210> 6

<211> 25

<212> DNA

<213> artificial sequence

<400> 6

cttctgatga tgaccgatgg caccg 25

<210> 7

<211> 42

<212> DNA

<213> artificial sequence

<400> 7

tatagggaga ccggcagatc tgcttctcag cgtgcttgaa ga 42

<210> 8

<211> 25

<212> DNA

<213> artificial sequence

<400> 8

ttcgctggca taggcattgg ctctc 25

<210> 9

<211> 25

<212> DNA

<213> artificial sequence

<400> 9

ccagccggcc acagtcgatg aatcc 25

<210> 10

<211> 25

<212> DNA

<213> artificial sequence

<400> 10

ccgacctgtc cggtgccctg aatga 25

<210> 11

<211> 25

<212> DNA

<213> artificial sequence

<400> 11

atgaagtgcg ctatgagggc cgtgg 25

<210> 12

<211> 57

<212> DNA

<213> artificial sequence

<400> 12

ctcaatcctg aaagtctggg gagaaaagcg cagctttgat tatcgaaact gcggcac 57

Claims (6)

1. A small RNA related to Brucella virulence is named sRNA Clu7, and the coding nucleotide sequence of the small RNA is shown in SEQ ID NO. 1.

2. Use of a small RNA associated with brucella virulence according to claim 1 in the assessment of brucella virulence.

3. The use of a small RNA related to brucella virulence according to claim 1 in the preparation of attenuated brucella.

4. A method for preparing attenuated Brucella is characterized by comprising the following steps:

(1) synthesizing primers for constructing the attenuated Brucella:

Clu7_L-F：5’GGTGACACTATAGAACTCGAGAGAGCGAGGGCAAACGCC3’

Clu7_L-R：5’AGATATGAAGACCCATTACCGACAG3’

Clu7_K-F：5’GGTAATGGGTCTTCATATCTTTCAAATATGTATCCGCTCATGAGA3’

Clu7_K-R：5’CCATCGGTCATCATCAGAAGAACTCGTCAAGAAGGC3’

Clu7_R-F：5’CTTCTGATGATGACCGATGGCACCG3’

Clu7_R-R：5’TATAGGGAGACCGGCAGATCTGCTTCTCAGCGTGCTTGAAGA3’

Clu7YL_F：5’TTCGCTGGCATAGGCATTGGCTCTC3’

Clu7YL_R：5’CCAGCCGGCCACAGTCGATGAATCC3’

Clu7YR_F：5’CCGACCTGTCCGGTGCCCTGAATGA3’

Clu7YR_R：5’ATGAAGTGCGCTATGAGGGCCGTGG3’

(2) construction of suicide plasmids

Respectively carrying out PCR amplification on N-terminal and C-terminal homologous arms of a Clu7 gene by using brucella M28 genome DNA as a template and primers Clu7_ L-F, Clu7_ L-R and Clu7_ R-F, Clu7_ R-R; using pBlue-Kan as template, primer Clu7_ K-F and Clu7_ K-R were used to amplify Kan^rAn expression cassette; the pSP72 vector is subjected to double enzyme digestion by XhoI and BglII, the three target fragments are recovered by gel cutting, the ligation product is transformed into a competent cell, and Kan is coated^rScreening positive clones by using a resistant plate, and naming the obtained positive clones as pSP 72-delta Clu 7-k;

(3) electric shock transformation of suicide plasmid and identification and screening of Clu7 gene deletion strain

Electrically transforming pSP 72-delta Clu7-k into Brucella M28 competent cells, screening obtained positive clones with kanamycin resistance, carrying out streak passage on screened candidate deletion strains to detect the stability of the candidate deletion strains, respectively amplifying kan resistance genes from two sides of a genome by using primers Clu7YL _ F, Clu7YL _ R and Clu7YR _ F, Clu7YR _ R, completing PCR identification, further sequencing identification, selecting positive strains, carrying out amplification culture, and storing to obtain the attenuated Brucella, wherein the attenuated Brucella is named as M28 delta Clu 7.

5. Attenuated Brucella produced according to the method of claim 4.

6. The use of the attenuated Brucella of claim 5 for the preparation of attenuated Brucella vaccine.

Images