CN109593761A - A kind of small RNA relevant to brucella virulence and its preparing the application in weak malicious brucella - Google Patents
A kind of small RNA relevant to brucella virulence and its preparing the application in weak malicious brucella Download PDFInfo
- Publication number
- CN109593761A CN109593761A CN201811572734.1A CN201811572734A CN109593761A CN 109593761 A CN109593761 A CN 109593761A CN 201811572734 A CN201811572734 A CN 201811572734A CN 109593761 A CN109593761 A CN 109593761A
- Authority
- CN
- China
- Prior art keywords
- clu7
- brucella
- virulence
- srna
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/098—Brucella
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/522—Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Animal Behavior & Ethology (AREA)
- Biotechnology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a kind of small RNA relevant to brucella virulence and its preparing the application in weak malicious brucella.Present invention application Northern blot proves that there are sRNA Clu7 in brucella velogen strain M28, utilize the method for homologous recombination, the sRNA gene-deleted strain M28 Δ Clu7 is constructed, the influence for being the model evaluation sRNA to M28 virulence using mouse macrophage RAW264.7 and Balb/c mouse.The ability that velogen strain M28 replicates existence in mouse macrophage RAW264.7 and mouse spleen can be significantly lowered after sRNA missing as the result is shown.When being inoculated with the 5th week, M28 Δ Clu7 is fully erased out of Mice Body, and virulence is remarkably decreased compared with M28.Mouse attacks malicious Protection and shows: the protecting effect that immune M28 Δ Clu7 resists virulent M28 infection to mouse has reached the protection of vaccine strain M5-90.Result above implies that sRNA Clu7 has huge decisive action to the virulence of brucella.It is proposed of the invention gives a pushing effect on to brucella virulence mechanism is disclosed.New technological means is provided for the research and development of the new candidate vaccine strain of brucella.
Description
Technical field
The present invention relates to a kind of small RNA relevant to brucella virulence, further relate to the small RNA prepare it is weak
Application in malicious brucella.The invention belongs to field of biotechnology.
Background technique
Brucellosis (brucellosis), abbreviation cloth disease, is a kind of people beast as caused by brucella (Brucella)
Suffer from chronic bacterial infectious disease altogether, be distributed widely in all over the world, China is also cloth disease severe epidemic area, and animal and people's is annual
The new cases world tops the list.Cloth disease causes huge damage to the health of our people and agricultural breeding.People infects brucella
After show as the symptoms such as undulant fever, endocarditis and arthritis, can cause after zoogenetic infection miscarriage etc..Not with pathogenic entero becteria
Together, brucella virulence, which is not rely on, expresses special virulence factor, and is to rely on it and replicates existence in host cell
Ability.Animal cloth disease has a prevalence in addition to Hainan Province, and three northern areas of China are in severe epidemic, and current I class area has started pair in fact
Animal carries out immunity inoculation.The nearly 5 years people's new cases in China are up to more than 60,000 people.Brucella has potential bio-safety
Hidden danger, disease prevention and control center, the U.S. are defined as " B class bioterrorism medicament ".
Brucella belongs to α Proteobacteria, Gram-negative bacteria, and brucella is bacterial parasite intracellular, slow growth, and can
Hide the immune system of host and hides and be grown on macrophage.Disclose brucella virulence and its pathogenic mechanism be for a long time with
Carry out the probing direction of scientific research personnel.The main feature of highly-wetting liquid be velogen strain can latent infection always, and low virulent strain passes through
It can remove in vivo after a period of time.
Bacterium has a variety of adjustment mechanisms, wherein the RNA with adjusting function is considered as the weight of its intrinsic adjustment mechanism
Want component part, such as small RNA (sRNA).Bacterium sRNA is a kind of non-coding tiny RNA with adjusting function, most of
The area between encoding gene, length play extensive regulating and controlling effect, such as between 50~500nt in bacterium vital movement
Regulate and control iron metabolism, glycometabolism, bacterial virulence, signal transmitting, quorum sensing etc..So far the most of sRNA found is located at bacterium dye
On colour solid, partially it is located at extrachromosomal genetic element such as transposons, plasmid etc..Brucella can infect people or many animals
(ox, sheep, pig, dog etc.), when in vitro culture, can infect including various kinds of cell such as macrophage, reticuloendothelial cells, this more
Host characteristics may be related to sRNA regulation.By inference, brucella should theoretically have 100~200 sRNA, at present only
Identified two sRNA of AbsR1 and AbsR2 out, are studied relatively fewer.
Inventor identifies the small RNA (sRNA) that can determine brucella virulence, has filled up Bu Lu
The deficiency of Salmonella sRNA research aspect, gives a pushing effect on to brucella virulence mechanism is disclosed, while to cloth Shandong
The research and development of the new candidate vaccine strain of Salmonella provide new technological means, have broad application prospects.
Summary of the invention
One of the objects of the present invention is to provide a kind of novel small RNA relevant to brucella virulence and its
Prepare the application in weak malicious brucella.
The second object of the present invention is to provide the weak malicious brucella of one kind and its construction method.
The third object of the present invention is to provide the weak malicious brucella in preparation brucella attenuated vaccine
Purposes.
In order to achieve the above object, present invention employs following technological means:
Inventor identifies the small RNA (sRNA) that can determine brucella virulence, is named as sRNA
Clu7.Present invention application Northernblot proves in brucella velogen strain M28 there are sRNA Clu7, using homologous heavy
The method of group, is constructed the sRNA gene-deleted strain M28 Δ Clu7, is commented using mouse macrophage RAW264.7 and Balb/c mouse as model
Influence of the sRNA to M28 virulence is estimated.Velogen strain M28 can be significantly lowered in mouse macrophage after sRNA missing as the result is shown
The ability survived is replicated in RAW264.7 and mouse spleen.When being inoculated with the 5th week, M28 Δ Clu7 is fully erased out of Mice Body,
Virulence is remarkably decreased compared with M28.Mouse attacks malicious Protection and shows: immune M28 Δ Clu7 resists virulent M28 to mouse and infects
Protecting effect reached the protection of vaccine strain M5-90.Result above implies that sRNAClu7 has the virulence of brucella
Huge decisive action and as Vaccine Potential.
Therefore, on the basis of the studies above, the invention proposes a kind of smalls relevant to brucella virulence
RNA is named as sRNA Clu7, and coding nucleotide sequence is as shown in SEQID NO.1.
Further, the invention also provides the small RNAs relevant to brucella virulence in brucella
Application in virulence evaluation.And
The small RNA relevant to brucella virulence is preparing the application in weak malicious brucella.
A kind of weak malicious brucella, which is characterized in that above-mentioned without containing encoding in the genome of the brucella
The sequence of small RNA relevant to brucella virulence.
Wherein, it is preferred that the weak malicious brucella is to be prepared by the following method to obtain:
(1) primer for constructing the weak malicious brucella is synthesized:
Clu7_L-F:5 ' GGTGACACTATAGAACTCGAGAGAGCGAGGGCAAACGCC3 '
Clu7_L-R:5 ' AGATATGAAGACCCATTACCGACAG3 '
Clu7_K-F:5 ' GGTAATGGGTCTTCATATCTTTCAAATATGTATCCGCTCATGAGA3 '
Clu7_K-R:5 ' CCATCGGTCATCATCAGAAGAACTCGTCAAGAAGGC3 '
Clu7_R-F:5 ' CTTCTGATGATGACCGATGGCACCG3 '
Clu7_R-R:5 ' TATAGGGAGACCGGCAGATCTGCTTCTCAGCGTGCTTGAAGA3 '
Clu7YL_F:5 ' TTCGCTGGCATAGGCATTGGCTCTC3 '
Clu7YL_R:5 ' CCAGCCGGCCACAGTCGATGAATCC3 '
Clu7YR_F:5 ' CCGACCTGTCCGGTGCCCTGAATGA3 '
Clu7YR_R:5 ' ATGAAGTGCGCTATGAGGGCCGTGG3 '
(2) building of suicide plasmid
Using brucella M28 genomic DNA as template, using primer Clu7_L-F, Clu7_L-R and Clu7_R-F,
N-terminal, the C-terminal homology arm of Clu7_R-R difference PCR amplification Clu7 gene；Using pBlue-Kan as template, primer Clu7_K-F is used
Kan is expanded with Clu7_K-RrExpression cassette；With II double digestion pSP72 carrier of XhoI and Bgl, more than gel extraction three sections of purpose pieces
Section, connection product are converted into competent cell, are coated with KanrResistant panel, screening positive clone, obtained positive colony life
Entitled pSP72- Δ Clu7-k；
(3) electroporated and Clu7 gene-deleted strain the evaluation and screening of suicide plasmid
PSP72- Δ Clu7-k electrotransformation is entered in brucella M28 competent cell, screen only to block that anti-
Property positive colony, to screen candidate gene-deleted strain scribing line passage detect its stability, using primer Clu7YL_F,
Clu7YL_R and Clu7YR_F, Clu7YR_R are expanded from two side of genome to kan resistant gene respectively, are completed PCR identification, are gone forward side by side
The identification of one pacing sequence chooses preservation after positive strain expands culture and obtains weak malicious brucella, is named as M28 Δ Clu7.
Further, the invention also provides the weak malicious brucella in preparation brucella attenuated vaccine
Using.
Compared to the prior art, the beneficial effects of the present invention are:
The present invention has huge virulence decisive action by research discovery sRNA Clu7 gene, lacks the M28 of the gene
Δ Clu7 strain is removed out of Mice Body, this has difference substantially with parent plant M28 completely 5 weeks after immune.With virus
It compares, brucella has huge genome (about 3,500,000 bp), and the ability for adapting to environment is much better than virus, individually
Function caused by the missing of gene is lost, and might have other compensatory mechanisms or redundancy scheme to supplement, therefore, using lacking
List of lost property gene is transformed bacterium, and to obtain low virulent strain be one and its difficult work.The discovery of clu7 realizes this target, from
It is about 4.7Log10 that result of study of the invention, which can be seen that M28 in the 5th week bacterial content in mouse spleen, and M28 Δ
Clu7 is 0 at this time, and this huge variation has great importance for disclosing brucella Intracellular survival mechanism.
The invention demonstrates that can significantly lower the virulence of brucella after sRNA clu7 missing, it will help understand cloth Shandong
The pathogenesis of Salmonella, and new technological means is provided for the research and development of the new candidate vaccine strain of brucella.
Detailed description of the invention
Fig. 1 is that Northern blot verifies brucella M28sRNA Clu7；
Fig. 2 is the building and identification of suicide plasmid；
The building of A:pSP72- Δ Clu7-k plasmid；The left homology arm of M:DNA Marker DL5000, L:Clu7, K:kan base
Cause, R: right homology arm；
The PCR of B:pSP72- Δ Clu7-k plasmid is identified；M:DNA Marker DL5000,1: the overall length of insetion sequence expands
Increase；
Fig. 3 is that the PCR of M28 Δ Clu7 gene-deleted strain is identified；
M:DNA Marker DL5000, YL: left homology arm, YR:M28；
Fig. 4 is that Clu7 influences brucella Intracellular survival ability (* *: P < 0.01)；
Fig. 5 is that Clu7 influences brucella to the pathogenicity (P < 0.01) of mouse；
The immune protective effect that Fig. 6 is M28 Δ Clu7 is assessed.
Specific embodiment
Further describe the present invention below with reference to specific example, the advantages and features of the present invention will be with description and more
It is clear.But these examples be only it is exemplary, it is not intended to limit the scope of the present invention in any way.Those skilled in the art answer
It should be appreciated that without departing from the spirit and scope of the invention can details to technical solution of the present invention and form repair
Change or replace, but these modifications and replacement are fallen within the protection scope of the present invention.
Embodiment 1
1 materials and methods
1.1 bacterial strains, plasmid and carrier
Brucella M28 is saved by Harbin Veterinary Medicine Inst., China Academy of Agriculture's P3 laboratory, matter
Grain pSP72 and pBlue-Kan (is documented in " building of saccharomyces cerevisiae ERG6 gene deletion mutants, " northwest agricultural journal " 2012
In the 03rd phase of year, Lei Jie etc. " document, is saved, provided by Harbin Veterinary Medicine Inst., China Academy of Agriculture.) it is this experiment
Room saves.DH5 α competent cell is only praised purchased from Nanjing promise.SPF grades of BALB/c mouses of 6-7 week old are real purchased from Beijing dimension tonneau China
Test zoo technical Co., Ltd.
Related to brucella bacterial strain and its pathogenic experiment are carried out in P3 laboratory.
1.2 reagent
Brucella Selective Supplement is purchased from OXOID, and TSB, TSA are purchased from BD company.
Super-Fidelity DNA Polymerase、MultiS One Step Cloning Kit andII One Step Cloning Kit is only praised purchased from Nanjing promise, the small extraction reagent kit of plasmid and glue reclaim reagent
Box is purchased from NEB company purchased from OMEGA, XhoI and Bgl II, and extraction reagent kit is purchased from Qiagen in plasmid, and bacterial genomes DNA is mentioned
Take kit purchased from Tiangeng biochemical technology Co., Ltd.
1.3 method
1.31 design of primers and synthesis
The primer for constructing sRNA Clu7 gene-deleted strain, primer have been synthesized according to M28 gene information design in GenBank
By Harbin, Bo Shi Bioisystech Co., Ltd synthesizes (table 1).
Table 1 constructs sRNA Clu7 gene-deleted strain and identification primer
1.3.2 the extraction of brucella total serum IgE
The strain of activation is taken to be inoculated into 5mL TSB culture medium, 37 DEG C of 200rpm shake cultures to late log phase take 1 body
The RNA protect Bacteria Reagent of 2 volumes is added in long-pending bacterium solution, and be vortexed rapidly concussion 5s, 15-25 DEG C of effect
5min.5,000g centrifugation 10min, discard supernatant, bacterial sediment is of short duration to be stored in -80 DEG C completely.
Thallus total serum IgE is extracted using TRIzol method, operating procedure is slightly made an amendment, is summarized as follows: collecting through RNA protect
100 μ L lysozymes are added in Bacteria Reagent treated bacterial sediment and 4 μ L RNase inhibitor RNasin make
Use 15min.The ice-cold TRIzol Reagent of 800 μ L is added, acutely concussion mixes, and is placed at room temperature for 10min.200 μ L chlorine are added
It is imitative, violent concussion mixing 15s after mixing twice is overturned, makes mixed liquor at milky, is stored at room temperature 10min.12,000g at 4 DEG C
It is centrifuged 15min.Upper strata aqueous phase is transferred in a new Ep pipe, isometric isopropanol is added and mixes 5 μ g RNase-free
Glycogen, precipitates overnight after mixing.12,000g is centrifuged 15min at 4 DEG C, carefully and is eliminated as much as whole supernatants.With 1mL 75%
Ethanol washing precipitates twice, collects RNA precipitate, is dissolved after dry with the RNase-free water of proper volume.
1.3.3 Northern blot verifies sRNA Clu7
According toThe operation instruction of Kit kit is operated, and is now summarized as follows process: firstly,
Use RNaseReagent sprays the consumptive material that gel maker, comb etc. may be contacted directly or indirectly comprehensively, uses high pressure sterilization
Water rinses 2~3 times, dries, spare.Secondly, claim 1g agar, be added 90mL without RNase water, be put into 50~60 DEG C of water-baths until
10 × Denaturing of 10mL Gel Buffer is added after balance, completes to prepare denaturing formaldehyde Ago-Gel.By RNA sample
It is mixed with the Formaldehyde Load Dye of three times volume (3V).65 DEG C of effect 15min, are placed on ice immediately later.?
The good laggard row agarose gel electrophoresis of preparation of samples.Electrophoretic voltage~5V/cm, time are no more than 3h.After electrophoresis, according to saying
Bright progress siphonage transferring film, 1.5~2h of time.Electric transferring film is removed after to transferring film rapidly with tweezers, in 1 × Gel
Desalination and gel are removed in washing in Running Buffer.It goes in UV crosslinking instrument, 120mJ is crosslinked 30s~1min, DEPC washing
Film is three times.Finally, DNA probe is added in hybridization solution ULTRAhyb, hybridized overnight is carried out to film.Next day washes film, 15~25
Under the conditions of DEG C, with X-ray exposure tests.
1.3.4 the building of M28 Δ Clu7 gene-deleted strain
1.3.4.1 the building of suicide plasmid
By following experimental procedure construct suicide plasmid: using M28 genomic DNA as template, using primer Clu7_L-F,
Clu7_L-R and Clu7_R-F, Clu7_R-R distinguish PCR amplification N-terminal, C-terminal homology arm；Using pBlue-Kan as template, using drawing
Object Clu7_K-F and Clu7_K-R expand KanrExpression cassette；With II double digestion pSP72 carrier of XhoI and Bgl.It is more than gel extraction
Three sections of target fragments, concrete operations are referring to OMEGA Gel Extraction Kit.It usesMultiS One
Step Cloning Kit configures following reaction system on ice:
It is blown and beaten and is mixed using pipettor, 37 DEG C of reactions 30min, ice bath 5min are stored in -20 DEG C for use.20 μ L are taken to react
Liquid is added in 200 μ L competent cells, is converted in a conventional manner, and Kan is coated withrResistant panel, PCR identify the Dan Ke of picking
Grand, screening positive clone sample presentation wins bodyguard biological order-checking.
1.3.4.2 prepared by brucella M28 electrocompetent
The strain for taking -80 DEG C of preservations, is inoculated into 5mL TSB culture medium, 37 DEG C of shake cultures to late log phase, after activation
It is forwarded in the TSB culture medium of 200mL, shake culture to OD600=1.0.4 DEG C of 6000rpm are centrifuged 5min after ice bath 30min, receive
Collect bacterial sediment, is washed repeatedly 3 times using 10% glycerine water solution, finally collect bacterial sediment, proper volume is added
10% glycerine water solution is dispensed according to every 100 μ L, is stored in -80 DEG C for use.
1.3.4.3 electroporated and Clu7 gene-deleted strain the evaluation and screening of suicide plasmid
PSP72- Δ Clu7-k and 100 μ L competent cells are mixed well, 15min is pre-chilled, uses the conversion of 0.1cm
Cup, electroporated instrument are chosen Bacterial mode, are transferred them to rapidly in the SOC culture medium of 900 μ L after electric shock, 37 DEG C of vibrations
Culture activation 4h is swung, is all applied on the TSA culture medium of that resistance of card, bacterium colony situation is observed after 3~5 days.
The bacterium colony of card that resistance is distinguished into streak inoculation to the TSA culture medium for containing that resistance of card and ammonia benzyl resistance, into one
Step, which is screened, determines positive colony.The positive colony screened should only block that resistance, pass to the candidate gene-deleted strain scribing line screened
In generation, detects its stability.The candidate gene-deleted strain for taking fresh cultured completes base using bacterial genomes DNA extraction kit (Tiangeng)
Because group DNA is extracted.Using primer Clu7YL_F, Clu7YL_R and Clu7YR_F, Clu7YR_R respectively from two side of genome to kan
PCR identification, a pacing sequence of going forward side by side identification are completed in resistant gene amplification.It chooses after positive strain expands culture and saves, be named as
M28ΔClu7。
1.3.4.4 influence of the sRNA Clu7 to brucella M28 replication capacity in macrophage
RAW264.7 mouse macrophage is cultivated in 24 orifice plates, when it forms 70% or so cell monolayer, by cloth Shandong
Salmonella M28 and M28 Δ Clu7 is with the ratio infected cell of MOI=100.1000rpm horizontal centrifugal 5min contains 5%CO at 37 DEG C2
3h is incubated in cell incubator.The extracellular bacteria for washing away non-infected cells three times is washed with PBS later, is added and is celebrated containing 5 μ g/mL
Big mycin, 5%DMEM culture medium maintain infection, and old culture medium is discarded when for 24 hours, and new training is added in PBS washing afterwards three times
Base is supported, infection is maintained to arrive 48h.Different time points (8h, for 24 hours and 48h) sampling after infection.PBS is washed three times, and cold contain is added
There are 0.1% TritonX-100 lytic cell, ten times of doubling dilutions, coated plate counts viable bacteria amount.
1.3.4.5 influence of the Clu7 to brucella M28 replication capacity in Mice Body
By the SPF grade BALB/c mouse of 96 6-7 week old females, four groups (24/group) are equally divided into, wherein each time
Point every group 6.100 μ L brucella velogen strain M28, vaccine strain M5-90, sRNA gene-deleted strain M28 Δ Clu7 are injected intraperitoneally respectively
And PBS, dosage of inoculation are 1 × 106CFU/ is only.It is sterile when 3d, 7d, 21d and 35d after infection that spleen is taken to weigh, 1mL is added and contains
The PBS of 0.1%TritonX-100, is ground using tissue grinder, after ten times of doubling dilutions, 100 μ L is taken to be coated on TSA plate,
37 DEG C of cultures count.
1.3.4.5 using CD-1 mouse as the immune protective effect of model evaluation M28 Δ Clu7
60 CD-1 mouse are grouped according to following situations.Wherein short-term immunity group (immune 45d) every group 10, totally three
Group, including M28 Δ Clu7, M5-90 and PBS.Permanent immunity group (immune 150d) every group 10, totally three groups, including M28 Δ
Clu7, M5-90 and PBS.Every mouse difference peritoneal immunity inoculation 1 × 10 of immune group5M5-90 the or M28 Δ Clu7 of CFU.PBS
The 100 sterile PBS of μ L of every mouse inoculation of control group.After short-term 45d and long-term 150d is immune, every mouse velogen strain M28
With 1 × 104The dosage of CFU attacks poison, attacks 15d after poison, sterile that spleen is taken to weigh, and PBS of the 1mL containing 0.1%TritonX-100 is added,
It is ground using tissue grinder, after ten times of doubling dilutions, 100 μ L is taken to be coated on TSA plate, 37 DEG C of cultures count.
2 results
The Northern blot of 2.1sRNA Clu7 is verified
The total serum IgE for extracting brucella M28 and M28 Δ Clu7, the good RNA of selection integrality is used for after detecting
Northernblot detection, the DNA probe using DIG label hybridize, and as the result is shown there are sRNAClu7 in M28, missing should
Purpose band disappears after sRNA, shows that there are the sRNA (Fig. 1) in M28.
The building and identification of 2.2pSP72- Δ Clu7-k suicide plasmid
Using M28 genomic DNA as template, Clu7 gene (shown in SEQ ID NO.1) left and right homology arm and kan are expanded respectively
Resistant gene connects pSP72 vector construction plasmid pSP72- Δ Clu7-k (Fig. 2A).Choose candidate plasmid using PCR amplification and
The mode of plasmid order-checking completes suicide plasmid identification.Suicide plasmid contains Clu7 gene upstream and downstream segment and kanamycins expression
Box is about 2256bp using its total length after T-A clone.As shown in Figure 2 B, using primer Clu7_L-F and Clu7_R-R into
Amplification and expection are consistent after PCR verifying, and suicide plasmid is named as pSP72- Δ Clu7-k.
The identification of 2.3 M28 Δ Clu7 gene-deleted strains
After kanamycins and the screening of ammonia benzyl mycin, the deletion mycopremna for only having kalamycin resistance is obtained.Design, which is located at, to be lacked
Lose on the outside of gene C lu7 or so homology arm a pair of of identification primer Clu7YL_F, Clu7YL_R and Clu7YR_F on genome,
Clu7YR_R expands the gene-deleted strain that evaluation and screening arrives using M28 Δ Clu7 genome as template.It expands respectively to size and is
The YL segment and size of 1986bp is the YR segment of 1544bp, and size is consistent with predetermined, shows successfully to construct the missing of Clu7
Strain (Fig. 3).
Influence of 2.4 Clu7 to brucella M28 survival ability in macrophage
In order to detect Clu7 missing whether can the Intracellular survival ability to brucella M28 have an impact, this experiment with
RAW264.7 mouse macrophage is model, has detected wild strain M28 and gene-deleted strain M28 Δ Clu7 respectively after infection cell
8h, for 24 hours with 48h when viable count intracellular.The result shows that gene-deleted strain M28 Δ Clu7 is compared with wild strain M28 within infection for 24 hours
Intracellular survival ability declines without conspicuousness, but gene-deleted strain Intracellular survival ability is remarkably decreased (P < 0.01) (figure when infecting 48h
4).The result shows that the missing of sRNAClu7 can reduce the ability that brucella M28 replicates existence in the cell.
Influence of 2.5 Clu7 to brucella M28 replication capacity in Mice Body
By M28, M28 Δ Clu7 and M5-90 according to 1 × 106The female of 6-7 week old is infected in the dosage of CFU/ only, intraperitoneal injection
SPF grades of BALB/c mouses of property, put to death after 3d, 7d, 21d and 35d after infection, sterile to take spleen, weigh and grind counting, measure it
Spleen weight and spleen carry bacterium amount, to measure different strains survival ability in Mice Body.Spleen weight the results show that after infection 7d M28,
The spleen weight of M28 Δ Clu7 and M5-90 infecting mouse is in rising trend, after infection when 21d and 35d gene-deleted strain M28 Δ Clu7 and
The spleen weight variation of vaccine strain M5-90 institute infecting mouse is similar, and (P < 0.01) (Fig. 5 B) is remarkably decreased compared with wild strain M28.
Spleen carries bacterium amount as the result is shown compared with velogen strain M28, gene-deleted strain M28 Δ Clu7 and vaccine strain M5-90 after infecting mouse 3d,
Spleen carries bacterium amount and is remarkably decreased when 7d, 21d and 35d, and thallus was in the spleen of M28 Δ Clu7 institute infecting mouse at 35d days
Through being removed (Fig. 5 A) by body.The above result shows that M28 its energy for replicating existence in mouse spleen after lacking sRNAclu7
Power is remarkably decreased, and is lower than vaccine strain M5-90.
The immune protective effect of 2.6M28 Δ Clu7 is assessed
In order to assess the immune protective effect of M28 Δ Clu7, we select vaccine strain M5-90 as immunized controls group, PBS
As non-immunized controls group.It is infected with velogen strain M28 within 45 days and 150 days after immune, spleen is taken to separate brucella after 15 days
It counts.Immune group (M28 Δ Clu7 and M5-90) spleen separation bacterium number is substantially less than non-immune group (PBS), M28 Δ as the result is shown
It is close or even slightly lower with M5-90 immune group (Fig. 6) that Clu7 immune group mouse spleen separates bacterium number.The above result shows that M28 Δ
There is good immune protective effect after Clu7 immunity inoculation.
Sequence table
<110>Harbin Veterinary Medicine Inst., China Academy of Agriculture (China Animal Health and Epidemiology Center Harbin point
Center)
<120>a kind of small RNA relevant to brucella virulence and its application in weak malicious brucella is being prepared
<130> KLPI180960
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 163
<212> DNA
<213> Clu7
<400> 1
aacccttttg gaagccgttg cctgtcggta atgggtcttc atatctgcca ttgggcgaaa 60
gtgccgcagt ttcgataatc aaagctgcgc ttttctcccc agactttcag gattgagaag 120
atgaaagcca atatccatcc cgactaccac accatcaagg tcg 163
<210> 2
<211> 39
<212> DNA
<213> artificial sequence
<400> 2
ggtgacacta tagaactcga gagagcgagg gcaaacgcc 39
<210> 3
<211> 25
<212> DNA
<213> artificial sequence
<400> 3
agatatgaag acccattacc gacag 25
<210> 4
<211> 45
<212> DNA
<213> artificial sequence
<400> 4
ggtaatgggt cttcatatct ttcaaatatg tatccgctca tgaga 45
<210> 5
<211> 36
<212> DNA
<213> artificial sequence
<400> 5
ccatcggtca tcatcagaag aactcgtcaa gaaggc 36
<210> 6
<211> 25
<212> DNA
<213> artificial sequence
<400> 6
cttctgatga tgaccgatgg caccg 25
<210> 7
<211> 42
<212> DNA
<213> artificial sequence
<400> 7
tatagggaga ccggcagatc tgcttctcag cgtgcttgaa ga 42
<210> 8
<211> 25
<212> DNA
<213> artificial sequence
<400> 8
ttcgctggca taggcattgg ctctc 25
<210> 9
<211> 25
<212> DNA
<213> artificial sequence
<400> 9
ccagccggcc acagtcgatg aatcc 25
<210> 10
<211> 25
<212> DNA
<213> artificial sequence
<400> 10
ccgacctgtc cggtgccctg aatga 25
<210> 11
<211> 25
<212> DNA
<213> artificial sequence
<400> 11
atgaagtgcg ctatgagggc cgtgg 25
<210> 12
<211> 57
<212> DNA
<213> artificial sequence
<400> 12
ctcaatcctg aaagtctggg gagaaaagcg cagctttgat tatcgaaact gcggcac 57
Claims (6)
1. a kind of small RNA relevant to brucella virulence, is named as sRNA Clu7, coding nucleotide sequence such as SEQ
Shown in ID NO.1.
2. application of the small RNA relevant to brucella virulence described in claim 1 in the evaluation of brucella virulence.
3. small RNA relevant to brucella virulence described in claim 1 is preparing the application in weak malicious brucella.
4. a kind of weak malicious brucella, which is characterized in that without containing coding claim 1 in the genome of the brucella
The sequence of the small RNA relevant to brucella virulence.
5. weak malicious brucella as claimed in claim 4, which is characterized in that be prepared by the following method to obtain:
(1) primer for constructing the weak malicious brucella is synthesized:
Clu7_L-F:5 ' GGTGACACTATAGAACTCGAGAGAGCGAGGGCAAACGCC3 '
Clu7_L-R:5 ' AGATATGAAGACCCATTACCGACAG3 '
Clu7_K-F:5 ' GGTAATGGGTCTTCATATCTTTCAAATATGTATCCGCTCATGAGA3 '
Clu7_K-R:5 ' CCATCGGTCATCATCAGAAGAACTCGTCAAGAAGGC3 '
Clu7_R-F:5 ' CTTCTGATGATGACCGATGGCACCG3 '
Clu7_R-R:5 ' TATAGGGAGACCGGCAGATCTGCTTCTCAGCGTGCTTGAAGA3 '
Clu7YL_F:5 ' TTCGCTGGCATAGGCATTGGCTCTC3 '
Clu7YL_R:5 ' CCAGCCGGCCACAGTCGATGAATCC3 '
Clu7YR_F:5 ' CCGACCTGTCCGGTGCCCTGAATGA3 '
Clu7YR_R:5 ' ATGAAGTGCGCTATGAGGGCCGTGG3 '
(2) building of suicide plasmid
Using brucella M28 genomic DNA as template, primer Clu7_L-F, Clu7_L-R and Clu7_R-F, Clu7_R-R are used
N-terminal, the C-terminal homology arm of PCR amplification Clu7 gene respectively；Using pBlue-Kan as template, primer Clu7_K-F and Clu7_ are used
K-R expands KanrExpression cassette；With II double digestion pSP72 carrier of XhoI and Bgl, more than gel extraction three sections of target fragments, connection
Product is converted into competent cell, is coated with KanrResistant panel, screening positive clone, obtained positive colony are named as
pSP72-ΔClu7-k；
(3) electroporated and Clu7 gene-deleted strain the evaluation and screening of suicide plasmid
PSP72- Δ Clu7-k electrotransformation is entered in brucella M28 competent cell, that screens only blocks that resistance
Positive colony detects its stability to the candidate gene-deleted strain scribing line passage screened, using primer Clu7YL_F, Clu7YL_R and
Clu7YR_F, Clu7YR_R are expanded from two side of genome to kan resistant gene respectively, complete PCR identification, a pacing sequence of going forward side by side mirror
It is fixed, it chooses preservation after positive strain expands culture and obtains weak malicious brucella, be named as M28 Δ Clu7.
6. application of the weak malicious brucella described in claim 4 or 5 in preparation brucella attenuated vaccine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811572734.1A CN109593761B (en) | 2018-12-21 | 2018-12-21 | Small RNA related to Brucella virulence and application thereof in preparation of attenuated Brucella |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811572734.1A CN109593761B (en) | 2018-12-21 | 2018-12-21 | Small RNA related to Brucella virulence and application thereof in preparation of attenuated Brucella |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109593761A true CN109593761A (en) | 2019-04-09 |
| CN109593761B CN109593761B (en) | 2022-04-22 |
Family
ID=65963237
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811572734.1A Active CN109593761B (en) | 2018-12-21 | 2018-12-21 | Small RNA related to Brucella virulence and application thereof in preparation of attenuated Brucella |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109593761B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112941088A (en) * | 2021-02-04 | 2021-06-11 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Gene related to brucella virulence and application thereof in evaluation of brucella virulence and preparation of attenuated brucella |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103710345A (en) * | 2013-12-27 | 2014-04-09 | 中国人民解放军疾病预防控制所 | Small non-coding RNA (ribonucleic acid) molecule BSR0601 from Brucella melitensis and application thereof |
| CN105624160A (en) * | 2015-12-24 | 2016-06-01 | 中国人民武装警察部队总医院 | Non-coding small RNA molecule ncRNA1351 of Brucella and application of non-coding small RNA molecule ncRNA1351 |
-
2018
- 2018-12-21 CN CN201811572734.1A patent/CN109593761B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103710345A (en) * | 2013-12-27 | 2014-04-09 | 中国人民解放军疾病预防控制所 | Small non-coding RNA (ribonucleic acid) molecule BSR0601 from Brucella melitensis and application thereof |
| CN105624160A (en) * | 2015-12-24 | 2016-06-01 | 中国人民武装警察部队总医院 | Non-coding small RNA molecule ncRNA1351 of Brucella and application of non-coding small RNA molecule ncRNA1351 |
Non-Patent Citations (2)
| Title |
|---|
| XU DA等: "《A novel small RNA Bmsr1 enhances virulence in Brucella melitensis M28》", 《VETERINARY MICROBIOLOGY》 * |
| ZHONG ZHIJUN等: "《Large-scale identification of small noncoding RNA with strand-specific deep sequencing and characterization of a novel virulence-related sRNA in Brucella melitensis》", 《SCIENTIFIC REPORTS》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112941088A (en) * | 2021-02-04 | 2021-06-11 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Gene related to brucella virulence and application thereof in evaluation of brucella virulence and preparation of attenuated brucella |
| CN112941088B (en) * | 2021-02-04 | 2023-06-16 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Genes related to brucella virulence and application thereof in brucella virulence evaluation and preparation of attenuated brucella |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109593761B (en) | 2022-04-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ferris et al. | Enrichment culture and microscopy conceal diverse thermophilic Synechococcus populations in a single hot spring microbial mat habitat | |
| Cho et al. | 16S rDNA analysis 9f bacterial diversity in three fractions of cow rumen | |
| CN110656116B (en) | Application of gene FoCWM in regulation and control of pathogenicity of banana vascular wilt | |
| CN105585619B (en) | With rice grain grain length and grain weight GAP-associated protein GAP and its encoding gene GL3-3 and application | |
| Liu et al. | Variation and inheritance of the Xanthomonas raxX‐raxSTAB gene cluster required for activation of XA21‐mediated immunity | |
| Ruiz-Lozano et al. | A Burkholderia strain living inside the arbuscular mycorrhizal fungus Gigaspora margarita possesses the vacB gene, which is involved in host cell colonization by bacteria | |
| CN103436478A (en) | Salmonella enteritidis double knockout attenuated mutant and preparation as well as application thereof | |
| CN102776220B (en) | Construction of brucellosis A19 molecular marker vaccine strain and determination of virulence and immunogenicity | |
| CN102277361A (en) | Method for screening protective antigens of Singapore grouper iridovirus | |
| CN109652429A (en) | Gene relevant to brucella virulence and its application in weak malicious brucella is evaluated and prepared in brucella virulence | |
| Song et al. | Identification of seven novel virulence genes from Xanthomonas citri subsp. citri by Tn5-based random mutagenesis | |
| CN109593761A (en) | A kind of small RNA relevant to brucella virulence and its preparing the application in weak malicious brucella | |
| Cieslinska | Detection and Characterization of Phytoplasmas Associated with Diseases of Rebus spp. in Poland | |
| CN105316252B (en) | A kind of five gene-deleted strain of streptococcus suis 2-type and application | |
| CN101294144A (en) | Type II streptococcus suis sa1KR gene knockout mutant strain, preparation method and application thereof | |
| CN102586270A (en) | Rice stress resistance-related OsHMGB3 gene, and encoding protein and application thereof | |
| EP1045037A1 (en) | Plant cell identification system | |
| CN104498417A (en) | Streptococcus suis chorismate-synthase gene deletion strain, and construction method and application thereof | |
| CN110669714B (en) | Preparation and application of salmonella enteritidis attenuated vaccine candidate strain | |
| CN110691509A (en) | Method for improving plant traits | |
| CN108754019B (en) | Amplification method of porcine epidemic diarrhea virus ORF1 gene complete sequence | |
| CN102942621B (en) | Plant powdery mildew resistance related protein TaCAF1 and its coding gene and application | |
| CN106754592B (en) | Streptococcus suis 2-type Rex gene knockout mutant strain SS2-1 Δ Rex and its construction method and application | |
| CN112980757B (en) | Streptococcus suis serotype 2 biofilm-related gene Nsub knockout mutant strain, construction method and application | |
| CN112941088B (en) | Genes related to brucella virulence and application thereof in brucella virulence evaluation and preparation of attenuated brucella |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |