CN112980757B - Streptococcus suis serotype 2 biofilm-related gene Nsub knockout mutant strain, construction method and application - Google Patents

Streptococcus suis serotype 2 biofilm-related gene Nsub knockout mutant strain, construction method and application Download PDF

Info

Publication number
CN112980757B
CN112980757B CN202110079019.XA CN202110079019A CN112980757B CN 112980757 B CN112980757 B CN 112980757B CN 202110079019 A CN202110079019 A CN 202110079019A CN 112980757 B CN112980757 B CN 112980757B
Authority
CN
China
Prior art keywords
nsub
streptococcus suis
mutant strain
type
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110079019.XA
Other languages
Chinese (zh)
Other versions
CN112980757A (en
Inventor
赵瑞利
张欣
于恩远
李留安
潘晨浩
金天明
马吉飞
于晓雪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin Agricultural University
Original Assignee
Tianjin Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin Agricultural University filed Critical Tianjin Agricultural University
Priority to CN202110079019.XA priority Critical patent/CN112980757B/en
Publication of CN112980757A publication Critical patent/CN112980757A/en
Application granted granted Critical
Publication of CN112980757B publication Critical patent/CN112980757B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/09—Lactobacillales, e.g. aerococcus, enterococcus, lactobacillus, lactococcus, streptococcus
    • A61K39/092—Streptococcus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/522—Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Communicable Diseases (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a mutant strain SS 2-delta Nsub knocked out by a streptococcus suis biofilm-related gene Nsub 2, wherein the mutant strain SS 2-delta Nsub is obtained by knocking out a coding gene of the streptococcus suis biofilm-related gene Nsub 2 from 646750 th to 649725 th, and the whole coding sequence of the envelope gene Nsub is SEQ ID NO. 1. The mutant strain of the invention not only greatly reduces the toxicity of the strain, does not contain resistance screening markers, has excellent hereditary stability through experimental verification, and has no risk of virulence reversion, thereby ensuring the safety of the strain. Meanwhile, the construction method of the Nsub knockout mutant strain SS 2-delta Nsub is simple and efficient, and lays a foundation for further researching the function and pathogenic mechanism of the gene Nsub related to the streptococcus suis serotype 2 biofilm.

Description

Streptococcus suis serotype 2 biofilm-related gene Nsub knockout mutant strain, construction method and application
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a type 2 streptococcus suis biofilm-related gene Nsub knockout mutant strain, a construction method and application.
Background
Streptococcus suis (Streptococcus suis) is a worldwide epidemic pathogenic bacterium of human and livestock, and can not only cause meningitis, septicemia, arthritis, pneumonia, endocarditis and the like of pigs, but also infect people and cause various serious diseases. The streptococcus suis has a plurality of serotypes, wherein the streptococcus suis type 2 is one of 35 serotypes of streptococcus suis which is widely distributed and has the strongest pathogenic capability, and can infect pigs and human beings to cause meningitis, arthritis, septicemia, pneumonia and acute death, thereby bringing serious threat to public health safety. While biofilms formed by streptococcus suis may cause persistent infections by the host immune system and antibiotics, bacterial biofilms play an important role in persistent infections, biofilms play a key role in the pathogenesis and persistence of streptococcus suis infections, and these infections are rarely eradicated by antibacterial therapy. However, the molecular mechanism by which s.suis infects and causes disease is not clear at present. Therefore, the method further explores and researches the functions of new pathogenic related genes and the functions of the genes in interaction with a host, and has important significance for screening potential vaccine candidate molecules, revealing the molecular mechanism of occurrence and development of the vaccine candidate molecules and further improving the prevention and treatment level in China.
The research on virulence factors of streptococcus suis has been a hot spot, and in streptococcus suis type 2, the virulence factors mainly include lysozyme releasing protein (MRP), extracellular protein factor (EF), hemolysin (SLY), Fibrinogen Binding Protein (FBP), Glutamate Dehydrogenase (GDH), glyceraldehyde triphosphate dehydrogenase (GAPDH), etc., and due to the diversity and complexity of virulence factors, the virulence factors alone are not sufficient to explain the cause of streptococcus suis outbreak. In the research process of SS2 virulence factors, many scholars at home and abroad disclose the role of a gene in SS2 pathogenesis by constructing a knockout mutant strain of the gene and comparing virulence change with a wild strain, and a theoretical basis is laid for the research and development of novel vaccines. The vaccine is a safe and effective pathogenic bacteria prevention and control means, in particular to an attenuated live vaccine and a subunit vaccine. The gene knockout is also called gene targeting, which refers to a technology of modifying a certain target gene on a chromosome at a fixed point by using the property that the DNA of the chromosome of a living cell can be recombined with an exogenous DNA sequence in genetic engineering, and is also called homologous recombination technology. The basic principle of the technology is that homologous exchange is carried out between homologous fragments at the upper and lower streams of a target gene which are designed in advance and a genome, so that a target gene fragment is replaced, and the purpose of knocking out the target gene is achieved.
The Nsub protein is a cell surface protein encoded by the Nsub gene found in various gram-positive bacteria, and has been found in streptococcus suis, streptococcus pneumoniae, streptococcus agalactiae, streptococcus mutans, streptococcus tuberculosis, staphylococcus alateus, and the like in recent years. The applicant discovers a gene encoding the protein Nsub by genomic analysis of the JS14 strain of Streptococcus suis type 2 isolated and identified in the present research laboratory, and reports that the cell surface protein Nsub is related to the formation of the biofilm of Streptococcus suis. As cell surface proteins, which may be involved in several molecular functions including transporter activity, nucleotide binding, motility, protein binding and catalytic activity, we predict that these surface proteins may influence the interactions between bacterial cells. However, the molecular function and biological processes of Nsub are currently unknown.
Through detection, no patent publication related to the present patent application has been found.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides a type 2 streptococcus suis biofilm-related gene Nsub knockout mutant strain, a construction method and application thereof.
The technical scheme adopted by the invention for solving the technical problems is as follows:
a mutant strain SS 2-delta Nsub is knocked out from a streptococcus suis biofilm-associated gene Nsub type 2, the mutant strain SS 2-delta Nsub is obtained by knocking out a biofilm-associated gene Nsub type of streptococcus suis type 2 from a coding gene between 646750 th site and 649725 th site, and the whole coding sequence of the envelope gene Nsub is SEQ ID NO. 1.
And the streptococcus suis type 2 biofilm-related gene Nsub is obtained by screening by utilizing the temperature sensitivity, spectinomycin resistance and homologous recombination principle of pSET4s plasmid.
Moreover, the streptococcus suis type 2 is streptococcus suis type 2 strain JS 14.
The method for constructing the Nsub knockout mutant strain SS 2-delta Nsub of the streptococcus suis type 2 biofilm-related gene comprises the following steps:
the construction method of the recombinant plasmid pSET4s-Nsub containing homologous recombination fragments comprises the following steps:
designing specific primers L1 and L2 by taking an upstream DNA sequence of a type 2 streptococcus suis genome Nsub coding gene as a template, amplifying an upstream homology arm L of a Nsub gene, designing specific primers R1 and R2 by taking a downstream DNA sequence of the type 2 streptococcus suis genome Nsub coding gene as a template, amplifying a downstream homology arm R of the Nsub gene, and respectively purifying and recovering to obtain an upstream homology arm product L and a downstream homology arm product R;
L1：SEQ ID NO.2：
GCTATGACCATGATTACGCCAAGCTTATGAACAAAATTCTAAAAAGTG
L2：SEQ ID NO.3：GTTTGAAAAAAATTTTTTAGTGTAAATTAGCAGCTCCAACTTCT
R1：SEQ ID NO.4：AGAAGTTGGAGCTGCTAATTTACACTAAAAAATTTTTTTCAAAC
R2：SEQ ID NO.5：
GTTGTAAAACGACGGCCAGTGAATTCTCATCCATCAGACTCCTCCT
secondly, cutting and recycling the temperature-sensitive suicide particle PSET4s after enzyme digestion by EcoRI and HindIII;
thirdly, adding the upstream homology arm product L and the downstream homology arm product R which are obtained by purification and recovery and plasmid PSET4s which is obtained by purification and recovery into the cloning reagent of the DNA fragment with the same volume, uniformly mixing, and reacting for 15min at 50 ℃;
fourthly, sucking the reaction product into the melted Mach1-T1 competent cells, evenly mixing, then freezing for 10min, placing the mixture into a 42 ℃ water bath kettle after ice bath is finished, thermally shocking for 120s, and taking out and continuously carrying out ice bath for 3 min; after the ice bath is finished, LB liquid culture medium without resistance is added, and the reaction product: the volume ratio of the LB liquid medium without resistance is 1: 20, placing the mixture in a constant-temperature shaking incubator at 37 ℃ and 220rpm for culturing for 30 min;
taking out the product in a constant-temperature shaking incubator at 37 ℃, centrifuging at 3000rpm for 4min, taking out the supernatant in a super clean bench, blowing and uniformly mixing the residual liquid, uniformly coating the mixture on a flat plate, and putting the flat plate in the incubator at 37 ℃ for overnight culture;
sixthly, picking single colony in the plate for amplification culture, extracting plasmid after 12h and sending the plasmid to a sequencing part for sequencing;
seventhly, comparing a sequencing result sent back by the sequencing part with a target sequence, screening out correct clones, and storing to obtain a recombinant plasmid pSET4 s-Nsub;
electrically transforming the obtained recombinant plasmid pSET4s-Nsub into a virulent strain of Streptococcus suis type 2, and screening by using temperature, spectinomycin and a homologous recombination principle to obtain a knockout mutant strain SS 2-delta Nsub of the gene Nsub related to the biofilm of Streptococcus suis type 2.
The Cloning reagent for the DNA fragment in step c is a Seamless Cloning and recombination Mix2 × Seamless Cloning Mix (this reagent is a reagent in the BM Seamless Cloning kit and is used for Cloning the DNA fragment).
And picking single bacterial colonies in the flat plate to perform amplification culture in a test tube filled with a liquid culture medium.
The method comprises the following specific steps:
resuscitating type 2 streptococcus suis strain, transferring into fresh culture medium according to a ratio of 1:100 the next day, and culturing at 37 ℃ until OD600The value is 0.6 +/-0.3, ice bath is carried out for 15-30min, bacterial liquid is taken, centrifugation is carried out for 5min at 4000r/min, and supernatant is discarded at 4 ℃; add Pre-chilled ddH2O resuspending the thallus, bacterial liquid: pre-chilled ddH2The volume ratio of O is 1: centrifuging at 1,4000 r/min for 5min, at 4 deg.C, and removing supernatant; repeating the above steps with pre-cooled ddH2O resuspending the thallus, centrifuging for 5min at 4000r/min, and discarding the supernatant at 4 ℃; by ddH2O resuspending the thalli, adding recombinant plasmids, transferring to a precooled 2mm electric rotating cup, and adjusting the parameters of an electroporator: 2.25kv, 200 Ω, 25uF, shock; rapidly transferring the electric shock product into a fresh culture medium, recovering for 2-3h at 28 ℃, coating recovered bacterial liquid on a THB plate containing 100 mu g/mL spectinomycin, and culturing at 28 ℃ until a single colony appears;
secondly, carrying out PCR amplification identification on the single colony obtained in the step (i) by using primers L1 and R2, wherein the colony capable of obtaining a 2700bp strip in amplification is a colony which is successfully electrically transformed, inducing recombination exchange between plasmids and genomes by using temperature and resistance, carrying out PCR amplification identification by using primers L1 and R2, and detecting to obtain a colony with only one 2700bp strip which is a knock-out mutant strain, namely the Nsub knock-out mutant strain SS 2-delta Nsub of the gene related to the streptococcus suis biofilm of the type 2 is obtained.
The application of the Nsub knockout mutant strain SS 2-delta Nsub of the streptococcus suis serotype 2 biofilm-related gene in analyzing the molecular mechanism of the influence of the Nsub on the pathogenicity of SS 2.
Moreover, the applications are:
the mutant strain SS 2-delta Nsub is applied to research on the aspect that Nsub mediates the formation of streptococcus suis serotype 2 biofilm by serving as a cell surface protein;
alternatively, the mutant strain SS2- Δ Nsub is used as a virulence factor to influence the pathogenicity of S.suis type 2.
The application of the Nsub knockout mutant strain SS 2-delta Nsub of the streptococcus suis type 2 biofilm-related gene in the aspect of preparing streptococcus suis type 2 attenuated vaccines and multivalent genetic engineering vaccines.
The application of the Nsub knockout mutant strain SS 2-delta Nsub of the streptococcus suis type 2 biofilm-related gene in the aspect of preparing medicines for treating or preventing streptococcus suis type 2 infection.
The invention has the following advantages and positive effects:
1. the invention is based on the modification of the streptococcus suis serotype 2 strain at the gene level, and applies the principle of homologous recombination to construct a streptococcus suis serotype 2 biofilm-related gene Nsub knockout mutant strain, so that the toxicity of the strain is greatly reduced, a resistance screening marker is not contained, the experimental verification also has very good genetic stability, and the risk of virulence return is avoided, thereby ensuring the safety of the strain. Meanwhile, the construction method of the Nsub knockout mutant strain SS 2-delta Nsub is simple and efficient, and lays a foundation for further researching the function and pathogenic mechanism of the gene Nsub related to the streptococcus suis serotype 2 biofilm.
2. The invention analyzes the relevant biological characteristics and pathogenicity of the Nsub gene knockout mutant strain, and defines the relationship between the Nsub envelope gene and the pathogenicity of the streptococcus suis serotype 2. The mutant strain provides a theoretical basis for screening protective antigens of the multivalent subunit vaccine, and can be applied to developing or preparing Streptococcus suis attenuated live vaccines and multivalent genetic engineering vaccines.
3. The invention provides a 2-type streptococcus suis biofilm-related gene Nsub knockout mutant strain and a construction method and application thereof aiming at the defects of the existing streptococcus suis vaccine.
4. The constructed envelope gene Nsub knockout mutant strain delta Nsub can be used for researching the molecular mechanism of the influence of Nsub as a virulence factor on the pathogenicity of the streptococcus suis type 2, lays a foundation for further researching the pathogenesis of the streptococcus suis type 2, and can also be used for researching a streptococcus suis attenuated live vaccine or a genetic engineering multivalent vaccine.
Drawings
FIG. 1 is a schematic diagram showing the construction of a Nsub capsule-envelope-gene-knockout mutant strain of the present invention;
FIG. 2 is a map of recombinant plasmid pSET4s-Nsub according to the present invention;
FIG. 3 is a diagram showing the restriction enzyme digestion identification of the recombinant plasmid pSET4s-Nsub in the present invention; wherein, M: DL5000 Marker, 1: pSET4s-Nsub/EcoRI + HindIII;
FIG. 4 is a diagram showing the sequencing and identification of the recombinant plasmid pSET4s-Nsub in the present invention;
FIG. 5 is a diagram showing the result of PCR identification of the knockout mutant strain SS2- Δ Nsub of the present invention; wherein 1 is a negative control H2O, 2 is a PCR product which takes Nsub-L1/Nsub-R2 as a primer pair, namely a Nsub envelope gene deletion strain, and M is DL5000 Marker;
FIG. 6 is a graph showing the growth of the envelope gene knockout mutant strain SS2- Δ Nsub and wild type S.suis strain type 2 according to the present invention;
FIG. 7 is a gram stain of wild type S.suis type 2 strain of the present invention;
FIG. 8 is a gram stain of the envelope knock-out mutant strain SS2- Δ Nsub according to the present invention;
FIG. 9 is a graph showing the hemolytic characteristic of a wild type S.suis strain type 2 according to the present invention;
FIG. 10 is a diagram showing hemolytic properties of the envelope gene knock-out mutant strain SS2- Δ Nsub according to the present invention;
FIG. 11 is a graph showing adhesion test of the knockout capsule mutant strain SS 2-. DELTA.Nsub according to the present invention.
Detailed Description
The present invention is further illustrated by the following examples, which are intended to be illustrative, not limiting and are not intended to limit the scope of the invention.
The raw materials used in the invention are all conventional commercial products if no special description is provided, the method used in the invention is all conventional methods in the field if no special description is provided, and the mass of all the materials used in the invention is the conventional use mass.
The experimental method of the present invention, in which specific conditions are not specified, is generally carried out under conventional conditions such as molecular cloning: the conditions described in the Laboratory Manual (New York Cold Spring Harbor Laboratory Press, 1989). Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
A mutant strain SS 2-delta Nsub is knocked out from a streptococcus suis biofilm-associated gene Nsub type 2, the mutant strain SS 2-delta Nsub is obtained by knocking out a biofilm-associated gene Nsub type of streptococcus suis type 2 from a coding gene between 646750 th site and 649725 th site, and the whole coding sequence of the envelope gene Nsub is SEQ ID NO. 1.
Preferably, the streptococcus suis type 2 biofilm-related gene Nsub is obtained by screening by utilizing the temperature sensitivity, spectinomycin resistance and homologous recombination principle of pSET4s plasmid.
Preferably, the streptococcus suis type 2 is streptococcus suis type 2 strain JS 14.
The method for constructing the Nsub knockout mutant strain SS 2-delta Nsub of the streptococcus suis type 2 biofilm-related gene comprises the following steps:
the construction method of the recombinant plasmid pSET4s-Nsub containing homologous recombination fragments comprises the following steps:
designing specific primers L1 and L2 by taking an upstream DNA sequence of a type 2 streptococcus suis genome Nsub coding gene as a template, amplifying an upstream homology arm L of a Nsub gene, designing specific primers R1 and R2 by taking a downstream DNA sequence of the type 2 streptococcus suis genome Nsub coding gene as a template, amplifying a downstream homology arm R of the Nsub gene, and respectively purifying and recovering to obtain an upstream homology arm product L and a downstream homology arm product R;
L1：SEQ ID NO.2：
GCTATGACCATGATTACGCCAAGCTTATGAACAAAATTCTAAAAAGTG
L2：SEQ ID NO.3：GTTTGAAAAAAATTTTTTAGTGTAAATTAGCAGCTCCAACTTCT
R1：SEQ ID NO.4：AGAAGTTGGAGCTGCTAATTTACACTAAAAAATTTTTTTCAAAC
R2：SEQ ID NO.5：
GTTGTAAAACGACGGCCAGTGAATTCTCATCCATCAGACTCCTCCT
secondly, cutting and recycling the temperature-sensitive suicide particle PSET4s after enzyme digestion by EcoRI and HindIII;
thirdly, adding the upstream homology arm product L and the downstream homology arm product R which are obtained by purification and recovery and plasmid PSET4s which is obtained by purification and recovery into the cloning reagent of the DNA fragment with the same volume, uniformly mixing, and reacting for 15min at 50 ℃;
fourthly, sucking the reaction product into the melted Mach1-T1 competent cells, evenly mixing, then freezing for 10min, placing the mixture into a 42 ℃ water bath kettle after ice bath is finished, thermally shocking for 120s, and taking out and continuously carrying out ice bath for 3 min; after the ice bath is finished, LB liquid culture medium without resistance is added, and the reaction product: the volume ratio of the LB liquid medium without resistance is 1: 20, placing the mixture in a constant-temperature shaking incubator at 37 ℃ and 220rpm for culturing for 30 min;
taking out the product in a constant-temperature shaking incubator at 37 ℃, centrifuging at 3000rpm for 4min, taking out the supernatant in a super clean bench, blowing and uniformly mixing the residual liquid, uniformly coating the mixture on a flat plate, and putting the flat plate in the incubator at 37 ℃ for overnight culture;
sixthly, picking single colony in the plate for amplification culture, extracting plasmid after 12h and sending the plasmid to a sequencing part for sequencing;
seventhly, comparing a sequencing result sent back by the sequencing part with a target sequence, screening out correct clones, and storing to obtain a recombinant plasmid pSET4 s-Nsub;
electrically transforming the obtained recombinant plasmid pSET4s-Nsub into a virulent strain of Streptococcus suis type 2, and screening by using temperature, spectinomycin and a homologous recombination principle to obtain a knockout mutant strain SS 2-delta Nsub of the gene Nsub related to the biofilm of Streptococcus suis type 2.
Preferably, the reagent for Cloning the DNA fragment in step c is a Seamless Cloning and recombination Mix2 × Seamless Cloning Mix (this reagent is a reagent in the BM Seamless Cloning kit and is used for Cloning the DNA fragment).
Preferably, in the step of sixthly, a single bacterial colony in a flat plate is picked and subjected to amplification culture in a test tube filled with a liquid culture medium.
Preferably, the method comprises the following specific steps:
resuscitating type 2 streptococcus suis strain, transferring into fresh culture medium according to a ratio of 1:100 the next day, and culturing at 37 ℃ until OD600The value is 0.6 +/-0.3, ice bath is carried out for 15-30min, bacterial liquid is taken, centrifugation is carried out for 5min at 4000r/min, and supernatant is discarded at 4 ℃; add Pre-chilled ddH2O resuspending the thallus, bacterial liquid: pre-chilled ddH2The volume ratio of O is 1: centrifuging at 1,4000 r/min for 5min, at 4 deg.C, and removing supernatant; repeating the above steps with pre-cooled ddH2O resuspending the thallus, centrifuging for 5min at 4000r/min, and discarding the supernatant at 4 ℃; by ddH2O resuspending the thalli, adding recombinant plasmids, transferring to a precooled 2mm electric rotating cup, and adjusting the parameters of an electroporator: 2.25kv, 200 Ω, 25uF, shock; rapidly transferring the electric shock product into a fresh culture medium, recovering for 2-3h at 28 ℃, coating recovered bacterial liquid on a THB plate containing 100 mu g/mL spectinomycin, and culturing at 28 ℃ until a single colony appears;
secondly, carrying out PCR amplification identification on the single colony obtained in the step (i) by using primers L1 and R2, wherein the colony capable of obtaining a 2700bp strip in amplification is a colony which is successfully electrically transformed, inducing recombination exchange between plasmids and genomes by using temperature and resistance, carrying out PCR amplification identification by using primers L1 and R2, and detecting to obtain a colony with only one 2700bp strip which is a knock-out mutant strain, namely the Nsub knock-out mutant strain SS 2-delta Nsub of the gene related to the streptococcus suis biofilm of the type 2 is obtained.
The application of the Nsub knockout mutant strain SS 2-delta Nsub of the streptococcus suis serotype 2 biofilm-related gene in analyzing the molecular mechanism of the influence of the Nsub on the pathogenicity of SS 2.
Preferably, the application is:
the mutant strain SS 2-delta Nsub is applied to research on the aspect that Nsub mediates the formation of streptococcus suis serotype 2 biofilm by serving as a cell surface protein;
alternatively, the mutant strain SS2- Δ Nsub is used as a virulence factor to influence the pathogenicity of S.suis type 2.
The application of the Nsub knockout mutant strain SS 2-delta Nsub of the streptococcus suis type 2 biofilm-related gene in the aspect of preparing streptococcus suis type 2 attenuated vaccines and multivalent genetic engineering vaccines.
The application of the Nsub knockout mutant strain SS 2-delta Nsub of the streptococcus suis type 2 biofilm-related gene in the aspect of preparing medicines for treating or preventing streptococcus suis type 2 infection.
Specifically, the preparation and detection are as follows:
firstly, the method comprises the following steps:
this example isolated and identified Streptococcus suis type 2 strain JS14 (i.e. Streptococcus suis JS14) (Nsub) in this study+) Constructing a recombinant plasmid pSET4s-Nsub containing a homologous recombination fragment as a parent strain, electrically transforming pSET4s-Nsub into a JS14 strain, inducing by temperature and spectinomycin to generate two times of homologous recombination, and screening a membrane gene Nsub knockout mutant strain delta Nsub sensitive to spectinomycin, wherein the method comprises the following specific steps:
(1) construction of recombinant plasmid pSET4 s-Nsub:
1) taking an upstream DNA sequence of a Nsub coding gene of a streptococcus suis serotype 2 genome as a template, designing specific primers L1 and L2, amplifying an upstream homology arm L of a Nsub gene, taking a downstream DNA sequence of the Nsub coding gene of the streptococcus suis serotype 2 genome as a template, designing specific primers R1 and R2, amplifying a downstream homology arm R of the Nsub gene, and respectively purifying and recovering to obtain an upstream homology arm product L and a downstream homology arm product R;
L1：GCTATGACCATGATTACGCCAAGCTTATGAACAAAATTCTAAAAAGTG
L2：GTTTGAAAAAAATTTTTTAGTGTAAATTAGCAGCTCCAACTTCT
R1：AGAAGTTGGAGCTGCTAATTTACACTAAAAAATTTTTTTCAAAC
R2：GTTGTAAAACGACGGCCAGTGAATTCTCATCCATCAGACTCCTCCT
2) cutting the temperature-sensitive suicide plasmid PSET4s by EcoRI and HindIII enzyme, and then cutting and recycling;
3) respectively taking about 80ng of the upstream homology arm product L and the downstream homology arm product R obtained by purification and recovery and the PSET4s obtained by purification and recovery, adding the equal volume of Seamless Cloning recombinant Mix2 multiplied by Seamless Cloning Mix, uniformly mixing, and reacting for about 15min at 50 ℃;
4) sucking about 5 mu L of reaction product into the melted Mach1-T1 competent cells, flicking, uniformly mixing, then freezing for 10min, placing in a 42 ℃ water bath kettle after ice bath is finished, thermally shocking for 120s, taking out, and continuously carrying out ice bath for 3 min. After the ice bath is finished, 100 mu L of the LB liquid medium without the antibody is added and placed in a constant temperature shaking incubator at 37 ℃ for culturing for 30min at 220 rpm.
5) Taking out the product in a constant-temperature shaking incubator at 37 ℃, centrifuging at 3000rpm for 4min, taking out about 80 mu L of supernatant in a super clean bench, blowing and uniformly mixing the residual liquid, uniformly coating the mixture on a flat plate, and putting the flat plate in the incubator at 37 ℃ for overnight culture.
6) Single colonies in the plates were picked and grown in tubes containing 4mL of liquid medium, and after about 12h the plasmids were extracted and sent to the sequencing section for sequencing.
7) And comparing the sequencing result returned by the sequencing part with the target sequence, screening out correct clones, and storing to obtain the recombinant plasmid pSET4 s-Nsub.
(2) The recombinant plasmid pSET4s-Nsub is electrically transformed into the streptococcus suis serotype 2 competent cells:
1) resuscitating Streptococcus suis type 2 strain JS14, inoculating to 5mL fresh culture medium according to a ratio of 1:100 the next day, culturing at 37 deg.C to OD600The value is about 0.6, ice bath is carried out for 15-30min, 1mL of bacterial liquid is taken, centrifugation is carried out for 5min at 4000r/min, and supernatant is discarded at 4 ℃;
2) add 1mL of precooled ddH2O resuspending the thallus, centrifuging for 5min at 4000r/min, and discarding the supernatant at 4 ℃; repeating the above steps with pre-cooled ddH2O resuspending the thallus, centrifuging for 5min at 4000r/min, and discarding the supernatant at 4 ℃;
3) with 100uL ddH2O resuspending the thallus, adding about 1ug of recombinant plasmid, transferring to a precooled 2mm electric rotating cup, adjusting the parameters of the electroporator: 2.25kv, 200 Ω, 25uF, shock.
4) And (3) rapidly transferring the electric shock product to 900uL of fresh culture medium, recovering for 2-3h at 28 ℃, coating recovered bacterial liquid on a THB plate containing 100ug/mL spectinomycin, and culturing at 28 ℃ until single bacterial colony appears.
(3) Inducing single exchange: inoculating the single colony which is successfully transformed into the TSB culture medium, culturing at 37 ℃, accelerating the generation of one-time single exchange between the plasmid and the bacterial genome in the process, streaking the single-exchange-generated bacterium on a spectinomycin-resistant plate, culturing at 37 ℃, and purifying the single-exchange-generated strain.
(4) Inducing double exchange: single crossover single colonies were inoculated into THB liquid medium and passaged three times in succession at 28 ℃ without added resistance, a second recombinational crossover taking place and allowing the plasmid to fall out of the bacterial genome by recombination and be lost.
(5) Screening for deletion mutants: and diluting the bacteria obtained by double exchange, and then uniformly coating the bacteria on a nonresistant THB plate, wherein single colonies which cannot grow under the condition of acquiring the resistance of the streptomycin and well grow on a nonresistant plate are subjected to PCR identification. The upstream primer of the upstream homology arm and the downstream primer (Nsub-L-1, Nsub-R-2) of the downstream homology arm are used for PCR amplification, and a gene deletion mutant strain which is identified as a prospective fragment can be amplified. Sequencing verification proves that the construction success of the type 2 streptococcus suis biofilm-related gene Nsub knockout mutant strain is further determined.
The correlation results are shown in fig. 1 to 5.
II, biological characteristic analysis of Nsub knockout mutant strains of streptococcus suis biofilm-related genes of type 2:
(1) analysis of genetic stability
Selecting a single colony of the mutant strain, inoculating the single colony to 5mL of THB culture medium containing spectinomycin (100 mu g/mL), carrying out shake culture at 37 ℃ until OD600 is 0.3, taking 100uL of bacterial liquid, transferring the bacterial liquid to 5mL of fresh THB culture medium without spectinomycin, continuing the shake culture, continuously carrying out 10 generations in the THB culture medium without spectinomycin, taking 100uL of bacterial liquid, diluting in multiple proportions, respectively coating the bacterial liquid on THB plates containing spectinomycin (100 mu g/mL) and no spectinomycin, and evaluating the stability of the mutant strain by plate counting. The colony counting method is adopted for genetic stability analysis, colonies on a plate are counted, and the result shows that bacteria passaged on THB plates containing spectinomycin and THB plates without spectinomycin can grow on the THB plates containing spectinomycin finally, 68 colonies and 77 colonies grow on the THB plates respectively, which shows that the mutant strain with the deletion of the gene Nsub related to the streptococcus suis biofilm type 2 can be stably inherited under the condition of antibiotic selection pressure.
(2) Growth Curve determination
Single colonies of the wild strain and the knockout mutant strain SS 2-delta Nsub are respectively picked, inoculated in a fresh culture medium, cultured overnight at 37 ℃, and cultured in a manner of mixing the components in a ratio of 1:100 percent of the culture medium is transferred into a fresh culture medium and is subjected to shaking culture at 37 ℃ and 180 r/min. Hourly sampling and determining OD600And recording, drawing growth curves of the wild strain and the knockout mutant strain. The results indicate that OD of the knockout mutant strain SS2- Δ Nsub600And the CFU curves both lag behind the wild strain, the knockout mutant SS2- Δ Nsub grew slower at log phase than the wild strain (results are shown in FIG. 6).
(3) Gram staining for observing bacterial morphology
Single colonies of the wild strain and the knockout mutant strain SS 2-delta Nsub are respectively picked, inoculated in a fresh culture medium, cultured overnight at 37 ℃, and cultured in a manner of mixing the components in a ratio of 1: transferring the strain to a fresh culture medium in a ratio of 100, performing shake culture at 37 ℃ and 180r/min to logarithmic phase, taking a part of bacterial liquid smear, performing gram staining and microscopic examination, and observing the form of the streptococcus suis type 2 under in vitro culture conditions. The results show that the chain arrangement of the knockout mutant strain SS2- Δ Nsub is more scattered than that of the wild strain, most of thalli are gathered into clusters, no obvious chain structure exists, and the chain forming capability of the knockout mutant strain SS2- Δ Nsub is weakened (the results are shown in FIG. 7 and FIG. 8).
(4) Comparison of hemolytic characteristics
Respectively inoculating the wild strain and the knockout mutant strain SS 2-delta Nsub to a Columbia blood agar plate by using a partition streaking method, placing the Columbia blood agar plate in a 37 ℃ incubator for culture, and observing whether the hemolytic activity of the wild strain and the knockout mutant strain has obvious difference. The results show that the knockout mutant strain SS2- Δ Nsub and the wild strain grow grayish white, round and translucent, smooth and wet microcolonies, and hemolytic rings are obvious around the colonies, which indicates that the hemolytic activities of the knockout mutant strain and the wild strain are not obviously different (the results are shown in FIGS. 9 and 10).
(5) Adhesion test
1) Vero cell culture: the cells were plated in 24-well cell culture plates in 1640 medium containing 10% heat-inactivated fetal bovine serum and placed in 5% CO2Culturing in an incubator at 37 ℃ until the cells grow to 80-90% of the monolayer for later use.
2) And (3) bacterial culture: culturing the constructed Nsub gene knockout mutant strain SS 2-delta Nsub and a 2 type streptococcus suis wild strain to a logarithmic growth phase, washing for 3 times by sterile PBS, and diluting to a proper concentration by a 1640 culture medium.
3) Cell adhesion: adding diluted bacterial liquid into a 24-hole culture plate full of monolayer cells according to the bacterial cell ratio of 10: l, placing at 37 ℃ and 5% CO2After incubation for 2h, the culture medium was removed and washed three times with sterile PBS pH 7.4 to remove non-adherent bacteria.
4) Cell elution: after washing, 200w L of a PBS solution containing 0.25 trypsin and 0.1% EDTA at pH7.2 was added to the 24-well plate to elute the cells.
5) Cell disruption: to the eluted cells, 800uL of a PBS solution of pH7.2 containing 0.025% Triton X-100 was added to disrupt the cells.
6) And (3) counting bacteria: diluting the cell disruption solution by multiple proportions, coating the cell disruption solution on a THB plate, culturing at 37 ℃, calculating the number of colonies after overnight growth, and comparing the difference of different strains in Vero cell adhesion.
Comparing the difference of the adhesion ability of the knockout mutant strain and the wild strain to the Vero cell, the result is shown in figure 11, and the result shows that compared with the wild strain, the adhesion ability of the knockout mutant strain SS 2-delta Nsub to the Vero cell is reduced, the difference is very obvious (P <0.01), which indicates that Nsub plays an important role in adjusting the adhesion ability of the 2-type streptococcus suis, and indicates that the adhesion ability of the knockout mutant strain SS 2-delta Nsub to the Vero cell is obviously reduced compared with the wild strain.
Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the embodiments disclosed.
The total coding sequence of the Nsub gene is SEQ ID NO.1
2976bp
ATGGAACATAAATATACTACAAATAATTTTTTGGTTCGTAATGCAATCATTGGAATACATGAATTGTTGGAATGTGATTATAATTCATTTTTAGAAACTATAAGAGAGAATAAGATATTCCAGGAGCAACTATTTGTAGCCAGCAGGAGTTTATATGAATCGCTTCAAAAATATTATAGTGGTGATTCAATGAAAAGGAAAAAAATCAACCAATTATCAGAATCTGTATATAAATATTATAAGCGTAGTAAGGAGCGCTCAACACCATTTGGTTTATTTAGTGAAACTTCAATAGGTTCATTTTCTTCTACAGAGAAATTAAACTTGAATGGAAAAACATTAAAAAAAGTACTCTTGGATTCAGAGTGGTTAATACGTCTAGTTTTTAAGATTGAGAAGGAATATTCTCGAGAATTAGCCTATAAAATAAATCCAGCCAACTATCAATTTGGAGATAGAGTTGTTCAATTGTTTTCTATAAATGATACTAAAATTGAAGAAGTCAACATAAAGTTCACTAAAGTTTATCAACTTATTGATGAGCTTTGTTGTGATAAATATGTATATTTTAACTGTATTATAGAAAAACTTGTTGAATCCTATGGTGAAGAGTATCGAGATATTGCAACATCATATATCATGAGTTTGATTGATAGTCATTTTCTAATTTCAAATATTAATTCAGAATTAATAATGAATTTTAAGTTTGAAGAATTCATTTCTAAAGTTAAAGAAATCGATAAGCAAAATCTTTATTATTTTAAACTAATAGCAATTAGCAACTTAATTGTTGAATATTCTGAATTGGAAATTGGGGATGGGATTGAAAAGCTTCAAGAAATCTACAAGTTAATGTCATCGTTAGTTGAAACCCCTAATTTTCTTCAAATTGATCTTTATAATGATGGTCAAATCCAATTAGGTAATGAAAATAAAACTCAGATAGTAGAATTTGCTGAGTTTCTAGTAAGTAATTCAGATCATGTAAAGCGTACTTATTTAGATGATTATAAAGAAAAATTTTTAGATAAGTACGGAGTAAATAGAGAAGTTCAGTTGATGGAGTTGTTTGATTCTAATTTAGGAATTGGTTCTCCATATGGATATCAGCACCCCAAAAATGATTTCTGGGAATCTTCGCCTTCTACTGTATATTTTAGTGAAAAAGAAGAATTAGAATATCTCAATAATTTTGAAAAAGCCTTAGAAACAGGTGGAAATATTCAACTTTATAATGAAGAAGATTTTTTTAATCAAGACAAAGATAAAATCAATCTAGGATTTGAGTTGTTCTTTTATGTTAATAAAGTAGATGGTAAAAGCGTACTAAGCTTAACTAATACAGGATGTTCTAAGAATTTAGGAGCTAGCTCAGGCAGGTTTTCTATTCTATCAGATAAATTGGAACATTATCATCAAACTATCACTCAAATTGTTGAAAACAATAATCACGTATCAGGGTATAACTCTTGTGAAATAACATTTTTACCAGAGAATCTTCGTCATGCTAATGTTATGCGCACAACAAATGTCAGAGAAAAAGTATTATCACTTTTTACGAATATGGATAAGAGAAGTCAAATTTTATCTGATATATATATTGGTATTGATTCTAAGAATAGTTTTTATGCTAGAAATTTTAAAACTAAGGAACTCTTAAAATTTTATAGTACAAATATGTATAACCAAATGATGTTTAGCAATGAATTACGGTTTTTATGTGAGATAGCTCAAGAAGATCATTTCGGAATATTCCCTTGGGAGATGGTTTATCAAAAATTTTCTCATATTCCTAGAATAGTATTTAAGGACATTATTGTTGCTCCTGAACGTTGGAGGCTTAGTGGAAGGATGTTGTCGAAGGATATTCATCAGATTATTCTTGAAAACAATCTTCCGACAAAATTGTATGTTGATAACAGTGATAATCGAATATTAATTAACCGTAATAATCCACTAGATAATCAACTTTTTGAAGATATTGTAAGAAAAAGTAGTAATAAAAATGAAGAATTATGTCTATCAGAGTGTATTTTTGATTCACACCTTGTAGAGAAGGAATCTACAACTCATATTTCTGATATAGTTGTTCCAGTATTTGCTAAGGATGAAATTAAGGAACCTAGGTACATAAAAGAAATATTACCAGAGGTTATTCCGACAAATGTTAGACAGAAAATACCATTTGATGAATGGCTCTACTTTAAATTGTATATGTCGGCAGATAGGCAAGAGGAATTTCTTTCGGATATAATGCCTCAAATTTTGAAGTTAGTAAATTTAGATGATGGGATGAGCTTCTATATCAGATATACTGATCCAAAATTTCATATCCGACTAAGGATAAGAACGCAGAATTTATATAAAAGTTTTGAAAAAATTCAAGAGATTTTTCAACTCTGCATACAAAACAAGTTAATATCAAATATAGATATTTCAACGTATGACAGAGAAATCGAAAGGTATGGGGGACTAGAAAGAATTCCTTTGGTAGAAGAAATTTTTTGTCTAGATACTGAAATAGTCATCAATTCATTAAGTTTAATTCGGCAGAAAAGATTAGATTTAACCCTAGATGATTTAGCAATAATATTTAACTACTTTTATCTCAAATCATTTTTTAAAGATAACAATAAAGAAATAATACAATTTTTAGAATTTGCTTGTCCAGAGCATTTAGACAGCCAAAATAGAGATAAAAATAGGAATACTGCATTAATTGATTTGTACTTAATAAAGGGATATTTAATAAATCTTCTTCCAGAACTATCTAAACTATGTCAAAGACTTAAGAAATTATCAGACAGTTGTATTCAATTATCAGATGACTATACATATATCATTTATGATAGTATCATTCATGTACACAATAATCGCTTATTTGGTATAAAGAGAGAAAATGAGACTAAGATTTATGCTATAATTCGCGGATTGATAATC AGTGAAGAATTTAGAAATGGGCACAATCATGGATAA。
Sequence listing
<110> Tianjin college of agriculture
Nsub knockout mutant strain of streptococcus suis serotype <120> 2 biofilm-related gene, construction method and application
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2976
<212> DNA
<213> all coding sequences of envelope gene Nsub (Unknown)
<400> 1
atggaacata aatatactac aaataatttt ttggttcgta atgcaatcat tggaatacat 60
gaattgttgg aatgtgatta taattcattt ttagaaacta taagagagaa taagatattc 120
caggagcaac tatttgtagc cagcaggagt ttatatgaat cgcttcaaaa atattatagt 180
ggtgattcaa tgaaaaggaa aaaaatcaac caattatcag aatctgtata taaatattat 240
aagcgtagta aggagcgctc aacaccattt ggtttattta gtgaaacttc aataggttca 300
ttttcttcta cagagaaatt aaacttgaat ggaaaaacat taaaaaaagt actcttggat 360
tcagagtggt taatacgtct agtttttaag attgagaagg aatattctcg agaattagcc 420
tataaaataa atccagccaa ctatcaattt ggagatagag ttgttcaatt gttttctata 480
aatgatacta aaattgaaga agtcaacata aagttcacta aagtttatca acttattgat 540
gagctttgtt gtgataaata tgtatatttt aactgtatta tagaaaaact tgttgaatcc 600
tatggtgaag agtatcgaga tattgcaaca tcatatatca tgagtttgat tgatagtcat 660
tttctaattt caaatattaa ttcagaatta ataatgaatt ttaagtttga agaattcatt 720
tctaaagtta aagaaatcga taagcaaaat ctttattatt ttaaactaat agcaattagc 780
aacttaattg ttgaatattc tgaattggaa attggggatg ggattgaaaa gcttcaagaa 840
atctacaagt taatgtcatc gttagttgaa acccctaatt ttcttcaaat tgatctttat 900
aatgatggtc aaatccaatt aggtaatgaa aataaaactc agatagtaga atttgctgag 960
tttctagtaa gtaattcaga tcatgtaaag cgtacttatt tagatgatta taaagaaaaa 1020
tttttagata agtacggagt aaatagagaa gttcagttga tggagttgtt tgattctaat 1080
ttaggaattg gttctccata tggatatcag caccccaaaa atgatttctg ggaatcttcg 1140
ccttctactg tatattttag tgaaaaagaa gaattagaat atctcaataa ttttgaaaaa 1200
gccttagaaa caggtggaaa tattcaactt tataatgaag aagatttttt taatcaagac 1260
aaagataaaa tcaatctagg atttgagttg ttcttttatg ttaataaagt agatggtaaa 1320
agcgtactaa gcttaactaa tacaggatgt tctaagaatt taggagctag ctcaggcagg 1380
ttttctattc tatcagataa attggaacat tatcatcaaa ctatcactca aattgttgaa 1440
aacaataatc acgtatcagg gtataactct tgtgaaataa catttttacc agagaatctt 1500
cgtcatgcta atgttatgcg cacaacaaat gtcagagaaa aagtattatc actttttacg 1560
aatatggata agagaagtca aattttatct gatatatata ttggtattga ttctaagaat 1620
agtttttatg ctagaaattt taaaactaag gaactcttaa aattttatag tacaaatatg 1680
tataaccaaa tgatgtttag caatgaatta cggtttttat gtgagatagc tcaagaagat 1740
catttcggaa tattcccttg ggagatggtt tatcaaaaat tttctcatat tcctagaata 1800
gtatttaagg acattattgt tgctcctgaa cgttggaggc ttagtggaag gatgttgtcg 1860
aaggatattc atcagattat tcttgaaaac aatcttccga caaaattgta tgttgataac 1920
agtgataatc gaatattaat taaccgtaat aatccactag ataatcaact ttttgaagat 1980
attgtaagaa aaagtagtaa taaaaatgaa gaattatgtc tatcagagtg tatttttgat 2040
tcacaccttg tagagaagga atctacaact catatttctg atatagttgt tccagtattt 2100
gctaaggatg aaattaagga acctaggtac ataaaagaaa tattaccaga ggttattccg 2160
acaaatgtta gacagaaaat accatttgat gaatggctct actttaaatt gtatatgtcg 2220
gcagataggc aagaggaatt tctttcggat ataatgcctc aaattttgaa gttagtaaat 2280
ttagatgatg ggatgagctt ctatatcaga tatactgatc caaaatttca tatccgacta 2340
aggataagaa cgcagaattt atataaaagt tttgaaaaaa ttcaagagat ttttcaactc 2400
tgcatacaaa acaagttaat atcaaatata gatatttcaa cgtatgacag agaaatcgaa 2460
aggtatgggg gactagaaag aattcctttg gtagaagaaa ttttttgtct agatactgaa 2520
atagtcatca attcattaag tttaattcgg cagaaaagat tagatttaac cctagatgat 2580
ttagcaataa tatttaacta cttttatctc aaatcatttt ttaaagataa caataaagaa 2640
ataatacaat ttttagaatt tgcttgtcca gagcatttag acagccaaaa tagagataaa 2700
aataggaata ctgcattaat tgatttgtac ttaataaagg gatatttaat aaatcttctt 2760
ccagaactat ctaaactatg tcaaagactt aagaaattat cagacagttg tattcaatta 2820
tcagatgact atacatatat catttatgat agtatcattc atgtacacaa taatcgctta 2880
tttggtataa agagagaaaa tgagactaag atttatgcta taattcgcgg attgataatc 2940
agtgaagaat ttagaaatgg gcacaatcat ggataa 2976
<210> 2
<211> 48
<212> DNA
<213> specific primer L1(Unknown)
<400> 2
gctatgacca tgattacgcc aagcttatga acaaaattct aaaaagtg 48
<210> 3
<211> 44
<212> DNA
<213> specific primer L2(Unknown)
<400> 3
gtttgaaaaa aattttttag tgtaaattag cagctccaac ttct 44
<210> 4
<211> 44
<212> DNA
<213> specific primer R1(Unknown)
<400> 4
agaagttgga gctgctaatt tacactaaaa aatttttttc aaac 44
<210> 5
<211> 46
<212> DNA
<213> specific primer R2(Unknown)
<400> 5
gttgtaaaac gacggccagt gaattctcat ccatcagact cctcct 46

Claims (10)

1.2-type streptococcus suis biofilm-associated gene Nsub knockout mutant strain SS 2-delta Nsub, which is characterized in that: the mutant strain SS 2-delta Nsub is obtained by knocking out a biofilm-associated gene Nsub of streptococcus suis type 2 from a coding gene between 646750 th site and 649725 th site, and the whole coding sequence of the envelope gene Nsub is SEQ ID NO. 1.
2. The Nsub knockout mutant strain SS2- Δ Nsub of Streptococcus suis biofilm-associated gene type 2 according to claim 1, wherein: the streptococcus suis type 2 biofilm-related gene Nsub is obtained by screening by utilizing the temperature sensitivity, spectinomycin resistance and homologous recombination principle of pSET4s plasmid.
3. The Nsub knockout mutant strain SS2- Δ Nsub of Streptococcus suis biofilm-associated gene type 2 according to claim 1 or 2, wherein: the streptococcus suis type 2 is streptococcus suis type 2 JS14 strain.
4. The method for constructing the Nsub knockout mutant strain SS2- Δ Nsub of Streptococcus suis biofilm-associated gene type 2 according to any one of claims 1 to 3, wherein: the method comprises the following steps:
the construction method of the recombinant plasmid pSET4s-Nsub containing homologous recombination fragments comprises the following steps:
designing specific primers L1 and L2 by taking an upstream DNA sequence of a type 2 streptococcus suis genome Nsub coding gene as a template, amplifying an upstream homology arm L of a Nsub gene, designing specific primers R1 and R2 by taking a downstream DNA sequence of the type 2 streptococcus suis genome Nsub coding gene as a template, amplifying a downstream homology arm R of the Nsub gene, and respectively purifying and recovering to obtain an upstream homology arm product L and a downstream homology arm product R;
L1：SEQ ID NO.2；
L2：SEQ ID NO.3；
R1：SEQ ID NO.4；
R2：SEQ ID NO.5；
secondly, cutting and recycling the temperature-sensitive suicide particle PSET4s after enzyme digestion by EcoRI and HindIII;
thirdly, adding the upstream homology arm product L and the downstream homology arm product R which are obtained by purification and recovery and plasmid PSET4s which is obtained by purification and recovery into the cloning reagent of the DNA fragment with the same volume, uniformly mixing, and reacting for 15min at 50 ℃;
fourthly, sucking the reaction product into the melted Mach1-T1 competent cells, evenly mixing, then freezing for 10min, placing the mixture into a 42 ℃ water bath kettle after ice bath is finished, thermally shocking for 120s, and taking out and continuously carrying out ice bath for 3 min; after the ice bath is finished, LB liquid culture medium without resistance is added, and the reaction product: the volume ratio of the LB liquid medium without resistance is 1: 20, placing the mixture in a constant-temperature shaking incubator at 37 ℃ and 220rpm for culturing for 30 min;
taking out the product in a constant-temperature shaking incubator at 37 ℃, centrifuging at 3000rpm for 4min, taking out the supernatant in a super clean bench, blowing and uniformly mixing the residual liquid, uniformly coating the mixture on a flat plate, and putting the flat plate in the incubator at 37 ℃ for overnight culture;
sixthly, picking single colony in the plate for amplification culture, extracting plasmid after 12h and sending the plasmid to a sequencing part for sequencing;
seventhly, comparing a sequencing result sent back by the sequencing part with a target sequence, screening out correct clones, and storing to obtain a recombinant plasmid pSET4 s-Nsub;
electrically transforming the obtained recombinant plasmid pSET4s-Nsub into a virulent strain of Streptococcus suis type 2, and screening by using temperature, spectinomycin and a homologous recombination principle to obtain a knockout mutant strain SS 2-delta Nsub of the gene Nsub related to the biofilm of Streptococcus suis type 2.
5. The method for constructing the Nsub knockout mutant strain SS2- Δ Nsub of Streptococcus suis biofilm-associated gene type 2 according to claim 4, wherein the method comprises the following steps: the Cloning reagent of the DNA fragment in the third step is Seamless Cloning and recombination Mix2 multiplied by Seamless Cloning Mix;
picking single bacterial colony in a flat plate and carrying out amplification culture in a test tube filled with a liquid culture medium.
6. The method for constructing the Streptococcus suis biofilm-associated gene Nsub knockout mutant strain SS2- Δ Nsub of claim 4 or 5, wherein the method comprises the following steps: the method comprises the following specific steps:
resuscitating type 2 streptococcus suis strain, transferring into fresh culture medium according to a ratio of 1:100 the next day, and culturing at 37 ℃ until OD600The value is 0.6 +/-0.3, ice bath is carried out for 15-30min, bacterial liquid is taken, centrifugation is carried out for 5min at 4000r/min, and supernatant is discarded at 4 ℃; add Pre-chilled ddH2O resuspending the thallus, bacterial liquid: pre-chilled ddH2The volume ratio of O is 1: centrifuging at 1,4000 r/min for 5min, at 4 deg.C, and removing supernatant; repeating the above steps with pre-cooled ddH2O resuspending the thallus, centrifuging for 5min at 4000r/min, and discarding the supernatant at 4 ℃; by ddH2O resuspending the thalli, adding recombinant plasmids, transferring to a precooled 2mm electric rotating cup, and adjusting the parameters of an electroporator: 2.25kv, 200 Ω, 25uF, shock; rapidly transferring the electric shock product into a fresh culture medium, recovering for 2-3h at 28 ℃, coating recovered bacterial liquid on a THB plate containing 100 mu g/mL spectinomycin, and culturing at 28 ℃ until a single colony appears;
secondly, carrying out PCR amplification identification on the single colony obtained in the step (i) by using primers L1 and R2, wherein the colony capable of obtaining a 2700bp strip in amplification is a colony which is successfully electrically transformed, inducing recombination exchange between plasmids and genomes by using temperature and resistance, carrying out PCR amplification identification by using primers L1 and R2, and detecting to obtain a colony with only one 2700bp strip which is a knock-out mutant strain, namely the Nsub knock-out mutant strain SS 2-delta Nsub of the gene related to the streptococcus suis biofilm of the type 2 is obtained.
7. Use of the Nsub knock-out mutant strain SS2- Δ Nsub of Streptococcus suis biofilm-associated gene type 2 according to any one of claims 1 to 3 for the analysis of molecular mechanisms by which Nsub affects the pathogenicity of SS2 for non-diagnostic and therapeutic purposes.
8. Use according to claim 7, characterized in that: the application is as follows:
the mutant strain SS 2-delta Nsub is applied to research on the aspect that Nsub mediates the formation of streptococcus suis serotype 2 biofilm by serving as a cell surface protein;
alternatively, the mutant strain SS2- Δ Nsub is used as a virulence factor to influence the pathogenicity of S.suis type 2.
9. Use of the Nsub knockout mutant strain SS2- Δ Nsub of Streptococcus suis biofilm-associated gene type 2 as defined in any one of claims 1 to 3 for the preparation of attenuated and multivalent genetically engineered Streptococcus suis vaccines type 2.
10. Use of the Nsub knockout mutant strain SS2- Δ Nsub of a Streptococcus suis biofilm-associated gene of type 2 according to any one of claims 1 to 3 for the manufacture of a medicament for the treatment or prevention of Streptococcus suis infection type 2.
CN202110079019.XA 2021-01-21 2021-01-21 Streptococcus suis serotype 2 biofilm-related gene Nsub knockout mutant strain, construction method and application Active CN112980757B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110079019.XA CN112980757B (en) 2021-01-21 2021-01-21 Streptococcus suis serotype 2 biofilm-related gene Nsub knockout mutant strain, construction method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110079019.XA CN112980757B (en) 2021-01-21 2021-01-21 Streptococcus suis serotype 2 biofilm-related gene Nsub knockout mutant strain, construction method and application

Publications (2)

Publication Number Publication Date
CN112980757A CN112980757A (en) 2021-06-18
CN112980757B true CN112980757B (en) 2021-10-26

Family

ID=76344551

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110079019.XA Active CN112980757B (en) 2021-01-21 2021-01-21 Streptococcus suis serotype 2 biofilm-related gene Nsub knockout mutant strain, construction method and application

Country Status (1)

Country Link
CN (1) CN112980757B (en)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109810933A (en) * 2019-03-25 2019-05-28 江西省农业科学院畜牧兽医研究所 2 type Streptococcus suis apuA gene knockout mutant strains of one kind and its application

Also Published As

Publication number Publication date
CN112980757A (en) 2021-06-18

Similar Documents

Publication Publication Date Title
Foroni et al. Genetic analysis and morphological identification of pilus-like structures in members of the genus Bifidobacterium
Das et al. Multiple adhesin-like functions of Xanthomonas oryzae pv. oryzae are involved in promoting leaf attachment, entry, and virulence on rice
Tegetmeyer et al. ISApl1, a novel insertion element of Actinobacillus pleuropneumoniae, prevents ApxIV-based serological detection of serotype 7 strain AP76
JPH07508649A (en) Mycobacterial membrane-associated immunogens
Totten et al. Characterization of the hemolytic activity of Haemophilus ducreyi
CN108126190B (en) Preparation and application of mycobacterium phage lyase Lysin-Guo1
Liu et al. Multiple genetic tools for editing the genome of Riemerella anatipestifer using a counterselectable marker
Derakhshandeh et al. Surface display of uropathogenic Escherichia coli FimH in Lactococcus lactis: In vitro characterization of recombinant bacteria and its protectivity in animal model
JP2006510612A (en) Live attenuated vaccine for porcine pleurisy pneumonia
CN113005072A (en) Streptococcus equi subsp zooepidemicus gene deletion strain and preparation method and application thereof
CN110452895B (en) Lysozyme from bacteriophage and gene and application thereof
CN112980757B (en) Streptococcus suis serotype 2 biofilm-related gene Nsub knockout mutant strain, construction method and application
CN114149494B (en) Application of flavobacterium columniform virulence protein in pathogen detection and attenuated strain preparation
CN104789576B (en) Yersinia pestis virulence regulator TyrR and its application
JP2004512817A (en) B2 / D + A-type polynucleotides isolated from Escherichia coli and biological uses of these polynucleotides and their polypeptides
Song et al. The growth phase-dependent regulation of the pilus locus genes by two-component system TCS08 in Streptococcus pneumoniae
CN104498417A (en) Streptococcus suis chorismate-synthase gene deletion strain, and construction method and application thereof
CN104611282A (en) Streptococcussuis serotype 2 SsnA gene knockout mutant strain, and preparation method and application of mutant strain
CN110669714B (en) Preparation and application of salmonella enteritidis attenuated vaccine candidate strain
CN109593761B (en) Small RNA related to Brucella virulence and application thereof in preparation of attenuated Brucella
CN102839144A (en) Construction method of anti-tuberculosis medicine high-throughput screening model
WO2010081282A1 (en) Gene cluster for thuringiensin synthesis
Bigi et al. Mutation in the P36 gene of Mycobacterium bovis provokes attenuation of the bacillus in a mouse model
Zou et al. Streptococcus xiaochunlingii sp. nov. E24 isolated from the oropharynx of healthy Chinese children
Raio et al. Evidence of pAgK84 transfer from Agrobacterium rhizogenes K84 to natural pathogenic Agrobacterium spp. in an Italian peach nursery

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant