CN109371058A - A kind of method for building up of poplar plastid expression system - Google Patents
A kind of method for building up of poplar plastid expression system Download PDFInfo
- Publication number
- CN109371058A CN109371058A CN201811313449.8A CN201811313449A CN109371058A CN 109371058 A CN109371058 A CN 109371058A CN 201811313449 A CN201811313449 A CN 201811313449A CN 109371058 A CN109371058 A CN 109371058A
- Authority
- CN
- China
- Prior art keywords
- poplar
- plastid
- culture
- building
- expression system
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8251—Amino acid content, e.g. synthetic storage proteins, altering amino acid biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Nutrition Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Insects & Arthropods (AREA)
- Pest Control & Pesticides (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to field of biotechnology, disclose a kind of method for building up of poplar plastid expression system, utilize this expression system successful expression green fluorescent protein GFP gene (gfp), first, Turpinia arguta high-efficiency blade regenerating system is established, then constructs poplar Plastid Transformation Vectors using different kinds of molecules biology techniques.The present invention is analyzed through Southern blot and is confirmed in GFP channel genes plastid genome, and homogeneity is reached, Northern bolt is analysis shows that the transcriptional level of GFP gene, green fluorescent protein successful expression in poplar plastid is illustrated in Western blot analytical table, to establish solid foundation for the research of poplar plastid gene engineering and the exploitation of new varieties of poplar.
Description
Technical field
The invention belongs to field of biotechnology more particularly to a kind of method for building up of poplar plastid expression system.Specific packet
Include poplar leaf regenerating system, the foundation of poplar Plastid Transformation Vectors and poplar plastogene rifle method for transformation.
Background technique
Currently, the prior art commonly used in the trade is such that
Poplar is a kind of important commodity trees and mode xylophyta.Turpinia arguta is a kind of excellent Poplar Varieties, it
To pick up from Nenjiang County peak forest farm aspen as female parent, male parent Xinjiang poplar derives from Urumchi, in progress cross combination in 1964,
Through experiment in cultivation in 20 years, performance was good, and character is stablized.Adaptable, good stress resistance is usually used in checking winds and fixing drifting sand.Trunk is logical straight, tree
The smooth light green of skin drapes over one's shoulders white powder, and raw bark not yet cracks within 20 years, and infructescence falls off naturally and not willow catkins flying in the air.
In recent years, plastogene transformation technology becomes one of the hot spot of plant genetic engineering research, and plastogene conversion has
Many advantages, such as: matrilinear inheritance, high efficient expression, without gene silencing, without position effect, without gene contamination the advantages that, and mountain is new
The breeding of poplar is vegetative propagation, not the features such as willow catkins flying in the air, keeps its plastid transgene safer.
Poplar endangers the pest and disease damage kind of poplar as Timber stands, shelter-forest and the chief species turned the four sides green at present
There are many class, seriously endangered the normal growth of poplar.With plastid transgene technology transform insect-resistant gene, disease-resistant gene and adversity gene
Into poplar plastid, corresponding resistance effect can either be reached, and increase biological safety.
In conclusion problem of the existing technology is:
(1) in the prior art, mature poplar plastid expression system is not established.Although in 2006, Okumura et al.
Express Green fluorescent protein fusion vector in white poplar (Populus alba), but more than 10 years in the past, never again
Report in terms of poplar plastid transformation, that is, do not establish mature and stable poplar plastid transformation system.
(2) poplar is xylophyta, and the regeneration of most xylophytas is more difficult, and is used for the material of poplar plastid transformation
It regenerates more difficult.
(3) it is not suitable for the more perfect method for transformation of poplar plastid transformation.
(4) Plastid Transformation Vectors of Turpinia arguta plastid transformation are not used for.
Solve the meaning of above-mentioned technical problem:
By years of researches, the present invention has searched out the leaf regeneration system of Turpinia arguta plastid transformation, and it is new to construct mountain
Poplar Plastid Transformation Vectors and foundation simultaneously optimize poplar gene gun conversion method, to successfully establish for poplar plastid transgene
Solid foundation, poplar plastid transgene are successfully established again for poplar plastid transform insect-resistant gene, disease-resistant gene and adversity gene
Determine solid foundation, and provides a kind of effective approach for the improvement of Poplar Varieties.
Summary of the invention
In view of the problems of the existing technology, the present invention provides a kind of method for building up of poplar plastid expression system.This
The purpose of invention is to establish mature poplar plastid expression system, including poplar leaf regenerating system, poplar Plastid Transformation Vectors
With poplar plastogene rifle method for transformation.It is studied for poplar plastid gene engineering and application provides effective tool.
The invention is realized in this way invention proposes a kind of method for building up of poplar plastid expression system, including poplar
Leaf regeneration system, poplar Plastid Transformation Vectors and poplar plastogene rifle method for transformation.To turn pest-resistant base for poplar plastid
Solid foundation is established in the improvement of cause, disease-resistant gene and adversity gene and Poplar Varieties.It specifically includes:
The foundation of step 1, Turpinia arguta high-efficiency blade regenerating system
Choose healthy and strong sterile Turpinia arguta (Populus davidiana x P.bolleana) young leaflet tablet, blade again
It is cultivated in raw culture medium PaSIM2, Multiple Buds is transferred to culture in fast breeding culture medium (same to root media), when tissue-cultured seedling is raw
When long 4 weeks or so (1/2-2/3 for reaching bottle height), the stem section for choosing the 3-4 tubercle length in top is placed into root media
Growth chooses the 2-3 piece leaf on poplar tissue-cultured seedling top when this tissue-cultured seedling grows 4 weeks or so (1/2-2/3 for reaching bottle height)
Blade material of the piece as conversion.Condition of culture: 25 DEG C of illumination/20 DEG C 16h 8h dark；Intensity of illumination: 30-40 μ Em-2·s-1.The 2-3 piece blade on this poplar tissue-cultured seedling top is cut into the square of 3mm*3mm size, is transferred to leaf regeneration culture medium PaSIM1
Middle regeneration, the regeneration rate of blade are 100%, and adventitious buds proliferation number is about 90.97 on each callus square.
The building of step 2, Turpinia arguta Plastid Transformation Vectors
To remove the plasmid pBluescriptII ks (+) of multiple cloning sites as carrier framework (SEQ:ID:NO:1), gram
Left homologous sequence (SEQ:ID:NO:2), right homologous sequence (SEQ:ID:NO:3), tobacco in grand Turpinia arguta plastid genome
AadA expression cassette and gfp expression cassette (SEQ:ID:NO:4) in Plastid Transformation Vectors pYY12 are cloned into removal multiple cloning sites
Plasmid pBluescriptII ks (+) in, construct poplar Plastid Transformation Vectors pYY20.
The foundation of step 3, poplar plastogene rifle transformation system
Blade material is placed in osmotic medium PaOM first after carrying out dark culturing 24 hours, wraps up poplar with bronze
It sets Plastid Transformation Vectors pYY20 Plasmid DNA and leaf regeneration efficient in step 1 is utilized by biolistic bombardment blade conversion method
System screens resistant buds on the PaSIM1 culture medium containing 30mg/L spectinomycin, condition of culture: 25 DEG C of illumination/20 DEG C 16h
8h is dark；Intensity of illumination: 20-25 μ Em-2·s-1.6 bombardments have obtained 8 positive seedlings, and obtained resistant buds are transferred to and are contained
Have on the PaSIM2 culture medium of 30mg/L spectinomycin, after the leaf regeneration using 2-3 wheel, Southern bolt identification
Homogeneous resistance seedling, to obtain the transgenic poplar tissue-cultured seedling of homogeneity.
Step 4, the hardening of transgenic poplar and transplanting
Obtained homogeneous transgenic poplar tissue-cultured seedling is moved into earth culture matrix (earth culture matrix formulations are as follows: vermiculite: turf
Soil: perlite=5:3:2) in, and at growth cabinet culture 1-2 months, then after hardening, it is transferred to greenhouse and carries out gradually
Enhance intensity of illumination and reduce the culture of humidity, is finally transplanted to outdoor field cultivation culture.
Step 5
Green fluorescent protein GFP gene is transcribed and expression in poplar plastid
For Northern bolt analysis shows that the transcriptional level of GFP gene, it is glimmering that green is illustrated in Western blot analytical table
Photoprotein GFP gene successful expression in poplar plastid.
One of the bright spot of foundation of poplar plastid expression system of the invention is to reappear poplar plastid transformation, and can be with
It repeats, and has also converted other genes, such as anti insect gene, besides kind of the invention and originally delivered in the prior art
Poplar kind it is different, the white poplar of the prior art, the present invention's is Turpinia arguta.
In conclusion advantages of the present invention and good effect are as follows:
The present invention utilizes this expression system successful expression green fluorescent protein GFP gene (gfp).In Turpinia arguta plastid
In conversion, biolistic bombardment 4 times, 23 resistant buds are obtained, after Southern blot identification, positive bud is 8, positive
Rate is 34.78%.And in 2006, in the white poplar plastid transformation reported in the literature that Okumura etc. is delivered, biolistic bombardment
8 times, 106 resistant buds are obtained, after Southern blot identification, positive bud is 21, positive rate 19.81%.We
The positive bud positive rate obtained after conversion Turpinia arguta is higher than the positive rate of white poplar, but because kind is different, without comparativity.
But the present invention utilizes Turpinia arguta plastid transformation system, present invention successful conversion Bt protein gene again, and has successfully obtained same
The pest-resistant poplar of matter illustrates that this of the invention system is mature, and be it is stable, survival rate is after positive transplantation of seedlings
100%.To which solid foundation has been established in the exploitation of research and new varieties of poplar for poplar plastid gene engineering.
Detailed description of the invention
Fig. 1 is poplar conversion carrier pYY20 structure figures provided in an embodiment of the present invention.
Fig. 2 is that poplar plastid provided in an embodiment of the present invention turns the verifying of the positive seedling of GFP gene homogeneity and GFP gene exists
Transcript and expression figure in plastid.
In figure: A: wild type poplar genome and turning GFP gene poplar gene group picture；B:Southern blot figure；C:
Northern blot figure；D:Western blot figure.
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to embodiments, to the present invention
It is further elaborated.It should be appreciated that described herein, specific examples are only used to explain the present invention, is not used to limit
The fixed present invention.
In the prior art, mature poplar plastid expression system is not established, poplar leaf regenerating system, poplar are not utilized
Tree Plastid Transformation Vectors and poplar plastogene rifle method for transformation provide effectively for the plastid gene engineering research and application of poplar
Tool.
Application of the invention is further described below with reference to concrete analysis.
The method for building up of poplar plastid expression system provided in an embodiment of the present invention, comprising the following steps:
The foundation of step 1, Turpinia arguta high-efficiency blade regenerating system
Choose healthy and strong sterile Turpinia arguta (Populus davidiana x P.bolleana) young leaflet tablet, blade again
Life culture medium PaSIM2 (4.4g/L MS (Duchefa Biochemie M0245), 0.08mg/L NAA, 0.3mg/L 6-BA,
3% (w/v) sucrose, 0.54% (w/v) agar powder, pH5.7) in culture, Multiple Buds are transferred to fast breeding culture medium (with taking root training
It supports base PaRIM:4.4g/L MS (Duchefa Biochemie M0245), 0.1mg/L NAA, 3% (w/v) sucrose, 0.54%
(w/v) agar powder, pH5.7) in culture, when tissue-cultured seedling grow 4 weeks or so (1/2-2/3 for reaching bottle height) when, selection top 3-4
The stem section of a tubercle length, which places into root media, to be grown, and (reaches the 1/2-2/ of bottle height when this tissue-cultured seedling is grown 4 weeks or so
3) when, blade material of the 2-3 piece blade on poplar tissue-cultured seedling top as conversion is chosen, condition of culture: 25 DEG C of 16h illumination/
20 DEG C of 8h dark；Intensity of illumination: 30-40 μ Em-2·s-1.The 2-3 piece blade on this poplar tissue-cultured seedling top is cut into 3mm*3mm
The square of size is transferred to regeneration culture medium PaSIM1 (4.4g/L MS (Duchefa Biochemie M0245), 0.1mg/L
NAA, 0.2mg/L 6-BA, 0.01mg/L TDZ, 3% (w/v) sucrose, 0.54% (w/v) agar powder, pH5.7) on regenerate, leaf
The regeneration rate of piece is 100%, and adventitious buds proliferation number is about 90.97 on each callus square.Blade is on PaSIM1 culture medium
Reproduction ratio regeneration efficiency on PaSIM2 culture medium is high, but the Multiple Buds after regeneration compare on PaSIM2 culture medium in PaSIM1 training
It is grown on feeding base faster and more healthy and stronger.
The building of step 2, Turpinia arguta Plastid Transformation Vectors
To remove the plasmid pBluescriptII ks (+) of multiple cloning sites for carrier framework, the Turpinia arguta matter of clone
Left homologous sequence (trnfM-psaB sections) and right homologous sequence (trnG-psbZ sections), Tobacco plastid transformation in body genome
AadA expression cassette and gfp expression cassette in carrier pYY12 are cloned into the plasmid pBluescriptII of removal multiple cloning sites
In ks (+), poplar Plastid Transformation Vectors pYY20 is constructed.Specific construction method is shown in Fig. 1.
The foundation of step 3, poplar plastogene rifle transformation system
First blade material be placed in osmotic medium PaOM (4.4g/L, MS (Duchefa Biochemie M0245),
0.1M sorbierite, 0.1M mannitol, 3% (w/v) sucrose, 0.54% (w/v) agar powder, pH5.7) in carry out dark culturing 24 it is small
When after, step utilized by biolistic bombardment blade conversion method with bronze package poplar Plastid Transformation Vectors pYY20 Plasmid DNA
Efficient leaf regeneration system, screens resistant buds on the PaSIM1 culture medium containing 30mg/L spectinomycin, about exists in rapid 1
It will appear within 2 months or so first resistant buds, continue culture 8 months or so in this culture medium, it during which can resistant bud successively
Occur.
Condition of culture: 25 DEG C of illumination/20 DEG C 16h 8h dark；Intensity of illumination: 20-25 μ Em-2·s-1.6 bombardments obtain
8 positive seedlings are placed in obtained positive seedling leaf on the PaSIM2 culture medium of the spectinomycin containing 30mg/L by 2-3 wheel
Then leaf regeneration identifies homogeneous resistance seedling by Southern bolt, sees Fig. 2A and Fig. 2 B, to obtain homogeneity
Transgenic poplar tissue-cultured seedling.
Step 4, the hardening of transgenic poplar and transplanting
Obtained homogeneous transgenic poplar tissue-cultured seedling is moved into earth culture matrix (earth culture matrix formulations are as follows: vermiculite: turf
Soil: perlite=5:3:2) in, and at growth cabinet culture 1-2 months, then after hardening, it is transferred to greenhouse and carries out gradually
Enhance intensity of illumination and reduce the culture of humidity, is finally transplanted to outdoor field cultivation culture.
The transcription and expression of step 5, gfp gene in plastid
Northern bolt is shown in Fig. 2 C analysis shows that the transcriptional level of GFP gene, Western blot analysis shows
Green fluorescent protein GFP gene successful expression in poplar plastid.See Fig. 2 D.
The foundation and application of poplar plastid expression system of the present invention.
The present invention provides a kind of perfect poplar plastid expression system, including poplar leaf regenerating system, poplar plastid turn
Change carrier and poplar plastogene rifle method for transformation.It is studied for poplar plastid gene engineering and application provides effective tool.
Application of the invention is further described below with reference to concrete analysis.
Embodiment one
The foundation of Turpinia arguta high-efficiency blade regenerating system: healthy and strong sterile Turpinia arguta (Populus davidiana x is chosen
P.bolleana) young leaflet tablet is cultivated in leaf regeneration culture medium PaSIM2, and it is (same that Multiple Buds are transferred to fast breeding culture medium
Root media: 4.4g/L MS (Duchefa Biochemie M0245), 0.1mg/L NAA, 3% (w/v) sucrose, 0.54%
(w/v) agar powder, pH5.7) in culture, when tissue-cultured seedling grow 4 weeks or so (1/2-2/3 for reaching bottle height) when, selection top 3-4
The stem section of a tubercle length, which places into root media, to be grown, and (reaches the 1/2- of bottle height when this tissue-cultured seedling regrowth 4 weeks or so
2/3) when, blade material of the 2-3 piece blade on poplar tissue-cultured seedling top as conversion, condition of culture: 25 DEG C of 16h light are chosen
According to/20 DEG C of 8h dark；Intensity of illumination: 30-40 μ Em-2·s-1.The 2-3 piece blade on this poplar tissue-cultured seedling top is cut into 3mm*
The square of 3mm size is transferred to regeneration culture medium PaSIM1 (4.4g/L MS (Duchefa Biochemie M0245), 0.1mg/L
NAA, 0.2mg/L 6-BA, 0.01mg/L TDZ, 3% (w/v) sucrose, 0.54% (w/v) agar powder, pH5.7) regeneration in, leaf
The regeneration rate of piece is 100%, and adventitious buds proliferation number is about 90.97 on each callus square.Blade is on PaSIM1 culture medium
Reproduction ratio regeneration efficiency on PaSIM2 culture medium is high, but the Multiple Buds after regeneration compare on PaSIM2 culture medium in PaSIM1 training
It is grown on feeding base faster and more healthy and stronger.See Fig. 1.
Embodiment two
The building of Turpinia arguta Plastid Transformation Vectors: select poplar chloroplast trnG and trnfM genetic interval as target patch
Section obtains insertion point.Turpinia arguta Plastid Transformation Vectors pYY20 carrier is constructed with this.
First after Tobacco plastid transformation carrier pYY12 Plasmid DNA restriction enzyme NcoI and XbaI double digestion, return
Large fragment is received, can get the pYY12 carrier framework of removal GFP gene, then using pYY12 Plasmid DNA as template, with GPF-NotI-F
(5’CTTTAAGAAGGAGATATACCCATGGTGAGTAAAGGAGAAGAACTTTTCACTG 3 ') and GPF-NotI-R (5 'AG CCTTTCGTTTTATTTGATGCGGCCGCTCATTGTACAGCTCGTCCATGCC 3 ') this obtains gfp gene to primer amplification
Both ends have the segment of restriction enzyme site NcoI and NotI sequence, then obtained gfp genetic fragment are passed through again seamless
No enzyme is connected on pYY12 carrier framework, by digestion verification Preliminary Identification recon, finally by this recombination of sequence verification
Son is named as pYY11 correct recon is verified.
According to white poplar (Populus alba L.) phytyl because of psbZ-psaB sector sequence in group DNA
(AP008956.1) pair of primers psbZ-psaB-F (5 ' gatgtaggatctagaataagcatttgtg 3 ') and psbZ- are designed
psaB-R(5'tggcattggaagcacataacatta 3').Using Turpinia arguta chloroplast genomic dna as template, psbZ- is used
PsaB-F and psbZ-psaB-R this to primer amplification psbZ-psaB sector sequence, the segment that PCR amplification is obtained is cloned into gram
On grand carrier pMD18-T, Escherichia coli Xl10-gold is converted, transformant turns after PCR verifying and sequence verification correct
Beggar is named as pYY15.Turpinia arguta Chloroplast gene psbZ-psaB sector sequence after sequencing is after BLAST, discovery and silver
PsbZ-psaB sector sequence (AP008956.1) nucleotide identity is 96% in white poplar chloroplast genomic dna, with Xinjiang poplar
PsbZ-psaB sector sequence (MG262344.1) in (Populus alba var.pyramidalis) chloroplast genomic dna
Nucleotide identity is 98%, with psbZ-psaB section sequence in aspen (Populus davidiana) chloroplast genomic dna
Arranging (KX306825.1) nucleotide identity is 98%.These all prove that the DNA fragmentation that we are cloned is Turpinia arguta plastid base
Because of a group psbZ-psaB sector sequence.
With restriction enzyme SacI and KpnI double digestion pBluescriptII ks (+) Plasmid DNA, polyclonal position is cut off
The large fragment that point sequence (MCS) obtains is named as segment 1 as carrier framework；With the bis- enzymes of restriction enzyme SpeI and SalI
PYY11 Plasmid DNA is cut, obtains being named as segment 2 containing the section of aadA expression cassette and gfp expression cassette；With pYY15 Plasmid DNA
For template, (SalI enzyme is had with LHRR-F (5 ' TTTTgtcgaccttaagctcgagtcttttctttcctcccccctc 3 ')
Sequence acceptor) and LHRR-R (5 ' TTTTggtacctggcattggaagcacataacatta 3 ') (connect with KpnI enzyme sequence
Head), to primer amplification trnfM-psaB sector sequence, obtained PCR product uses the bis- enzymes of restriction enzyme SalI and KpnI again for this
It cuts, the segment of acquisition is named as segment 3；Using pYY15 Plasmid DNA as template, with RHRR-F (5 'TTTTgagctcgatgtagga
Tctagaataagcatttgtg 3 ') (having SacI enzyme sequence connector) and RHRR-R (5 ' TTTTgctagccccgggagatct
Ccgcgggggtagaattagactattagggtcaac 3 ') (have NheI enzyme sequence connector) this to primer amplification psbZ-
TrnG sector sequence, obtained PCR product use restriction enzyme SacI and NheI double digestion again, and the segment of acquisition is named as piece
Section 4 mixes this four segments according to the amount that molar ratio is 1:2:2:2, is ligated and transformed into Escherichia coli with SolutionI enzyme
Xl10-gold, is screened on the dual anti-plate containing ampicillin and spectinomycin, is then selected and is excited in blue light again
Such bacterium colony is extracted its DNA by the bacterium colony of lower fluoresced green, through digestion verification and PCR verifying after correctly recon again
Sequencing company is sent to carry out sequence verification, verified correct recon is named as pYY20, that is, acquires Turpinia arguta plastid transformation load
Body.See Fig. 2.
Embodiment three
Poplar plastogene rifle method for transformation step:
1, the infiltration processing of plant leaf material is converted
Blade material of the poplar tissue-cultured seedling top 2-3 piece blade as conversion Jing Guo subculture is chosen, blade
Distal shaft be placed in up osmotic medium PaOM (4.4g/L, MS (Duchefa Biochemie M0245), 0.1M sorbierite,
0.1M mannitol, 3% (w/v) sucrose, 0.54% (w/v) agar powder, pH5.7) on dark 24 hours it is spare.
2, the preparation of Plasmid DNA
Single colonie is obtained after plasmid pYY20 is converted Escherichia coli Xl10-gold, picking single bacterium is fallen within containing ammonia benzyl mould
It is incubated overnight, is no more than 16 hours in 37 DEG C in the LB liquid medium of plain resistance, collect thallus anion exchange reagent box
(such as NucleoBond@Xtra plasmid purification) extracts plasmid, and the DNA of extraction is dissolved in sterile MilliQ water.
3, bronze wraps up DNA
(1) 1.5 milligrams of bronzes are weighed to be placed in 1.5 milliliters of Eppendorf pipes, 600 microlitres of dehydrated alcohols are added in pipe,
It is vortexed 1 minute；
(2) 1150g is centrifuged 15 seconds；
(3) supernatant is carefully removed；
(4) 600 microlitres of sterile MiliQ water are added, are uniformly mixed with Eppendorf pipette tips, 1150g, are centrifuged 15 seconds；
(5) supernatant is carefully removed；
(6) 172 microlitres of sterile MiliQ water are added, are uniformly mixed with Eppendorf pipette tips；
(7) 175 microlitres of 2.5M calcium chloride solution are added in pipe, vortex 1s adds 35 microlitres of 0.1M spermidine solution,
Vortex 1s；
(8) it is placed in 10min on ice, is resuspended 1 time within every 1 minute；
(9) 1150g is centrifuged 15 seconds；
(10) supernatant is carefully removed；
(11) 600 microlitres of dehydrated alcohols are added, are uniformly mixed；
(12) 1150g is centrifuged 15 seconds；
(13) supernatant is carefully removed；
(14) step 11-13 is repeated；
(15) 50 microlitres of dehydrated alcohols are added to be resuspended；
(16) when bombarding, each micro- slide glass uses 6.5 microlitres of suspensions.
4, biolistic bombardment
(1) it is impregnated micro- slide glass 5 minutes with 95% ethyl alcohol, film can be split 1 minute with the immersion of 95% ethyl alcohol, impregnated with 95% ethyl alcohol
It barrier 10 minutes, is put them in sterile big culture dish respectively, it is dry on superclean bench.
(2) operate particle gun, parameter is as follows: the blade distance of vacuum degree 28, helium pressure 900psi, barrier to tiling is
9 centimetres or so.
(3) blade after bombarding is cut into 3mm*3 ㎜ size, and distal shaft, which is placed in up on regeneration screening and culturing medium, to be grown.
Example IV
The screening of poplar resistance seedling:
(1) blade material after biolistic bombardment is cut into 3mm*3 ㎜ size, and distal shaft is placed in grand containing 30mg/L up
Until resistant buds occur on the PaSIM1 screening and culturing medium of mycin, 1 subculture is changed every the 1-2 month on this culture medium, about
It will appear first resistant buds at 2 months or so, continue culture 8 months or so in this culture medium, it during which can be resistant successively
Bud occurs.Screening and culturing condition are as follows: 25 DEG C of illumination/20 DEG C 16h 8h dark, intensity of illumination: 20-25 μ Em-2·s-1。
(2) resistant buds are transferred on the PaSIM2 culture medium of the spectinomycin containing 30mg/L and continue to cultivate, after growing blade,
Resistance seedling is analyzed by Southern bolt.Southern bolt analysis Roche digoxin kit (DIG High
Prime DNA Labeling and Detection Starter Kit II).It makes a concrete analysis of as follows: extraction resistance seedling first
Leaves genomic DNA and wild type poplar leaf genomic DNA, the genomic DNA restriction enzyme Bgl II of extraction,
37 DEG C digestion 20 hours, then after 1% agarose gel electrophoresis, electrophoresis, with half-dried capillary transfer the DNA in gel
Segment is transferred on positively charged nylon membrane (GE Healthcare, USA).Using poplar genomic DNA as template, psaB- is used
Probe-F (5 ' TTAGCCAAAGGTGTACGTTCATGAG3 ') and psaB-probe-R (5 '
TTGCCCGGCTGGTTAAATGC3 ') this prepares the psaB probe of digoxigenin labeled to the segment for the 587bp that primer amplification obtains,
The label of probe and hybridization are operated according to Roche digoxin kits manuals.It is big that wild type poplar leaf hybridizes 3504bp out
Small band, the resistance seedling leaf for reaching homogeneity only hybridizes the band of 4789bp size out, and is not up to the resistance seedling of homogeneity
Blade can hybridize this two band of 3504bp out and 4789bp.See Fig. 2A and Fig. 2 B.
(3) blade of the not up to positive seedling of homogeneity is cut into 3 ㎜ *, 3 ㎜ size, in the spectinomycin containing 30mg/L
After carrying out the regeneration of 2-3 impeller blade on PaSIM2 culture medium, detect whether regenerated resistance seedling reaches by Southern bolt
Homogeneity is transferred to the resistance seedling of homogeneity and continues to cultivate in root media.
(4) 6 bombardments have obtained 8 positive seedlings, take turns on the PaSIM2 culture medium of the spectinomycin containing 30mg/L by 2-3
Leaf regeneration, homogeneous resistance seedling is identified through Southern bolt, to obtain the transgenic poplar tissue-cultured seedling of homogeneity.
Embodiment five
The hardening and transplanting of transgenic poplar homogeneity tissue-cultured seedling: homogeneous resistance seedling is placed in 30mg/L spectinomycin
It is cultivated in root media, intact taking root, the culture bottle of the homogeneous resistance seedling of robust growth is gradually uncapped, to full open end
Appropriate distilled water is poured into culture bottle, 3-4 days hardenings of uncapping, addition distilled water easy to clean, general so that solid medium softens
The culture medium on root system is cleaned after homogeneous resistance seedling removal after hardening, then root is immersed in distilled water overnight, so that root
The culture medium fastened thoroughly removes.Condition of culture: 25 DEG C of illumination/20 DEG C 16h 8h dark, intensity of illumination :~30-40 μ Em-2·
s-1, it is transplanted into earth culture matrix (earth culture matrix formulations are as follows: vermiculite: turfy soil: perlite=5:3:2), is placed in incubator, often
It watered 1 time every 2-3 days, the 1 basic salt of 1/8MS was poured every 1 week, illumination condition is 25 DEG C of illumination/20 DEG C 16h 8h dark, illumination
Intensity is gradually reinforced, and is increased to 80 μ Em from 40 μ Em-2s-1 or so-2·s-1Left and right, every 3 days 10 μ E of raising or so
Intensity, humidity drops to 65% from 90% and is gradually reduced, every the humidity of decline 5% in 3 days or so, about in incubator culture
It can be transplanted in greenhouse to 30 centimetres of plant height or so and use the culture of basin alms bowl, condition of culture: 25 DEG C of illumination/20 DEG C 16h 8h dark, it is wet
Degree 50% or so.
Embodiment six
Transcription and expression of the gfp gene in plastid: Northern bolt analysis shows that the transcriptional level of GFP gene,
See that green fluorescent protein GFP gene successful expression in poplar plastid is illustrated in Fig. 2 C, Western blot analytical table.See Fig. 2 D.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention
Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.
Sequence table
<110>Hubei University
<120>a kind of method for building up of poplar plastid expression system
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2865
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ggtacccagc ttttgttccc tttagtgagg gttaattgcg cgcttggcgt aatcatggtc 60
atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca tacgagccgg 120
aagcataaag tgtaaagcct ggggtgccta atgagtgagc taactcacat taattgcgtt 180
gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt aatgaatcgg 240
ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct cgctcactga 300
ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat 360
acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca 420
aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc 480
tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata 540
aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc 600
gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc 660
acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga 720
accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc 780
ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag 840
gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag 900
gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag 960
ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca 1020
gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga 1080
cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat 1140
cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga 1200
gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg 1260
tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga 1320
gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc 1380
agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac 1440
tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc 1500
agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc 1560
gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc 1620
catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt 1680
ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc 1740
atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg 1800
tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag 1860
cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat 1920
cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc 1980
atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa 2040
aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta 2100
ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa 2160
aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccaccta aattgtaagc 2220
gttaatattt tgttaaaatt cgcgttaaat ttttgttaaa tcagctcatt ttttaaccaa 2280
taggccgaaa tcggcaaaat cccttataaa tcaaaagaat agaccgagat agggttgagt 2340
gttgttccag tttggaacaa gagtccacta ttaaagaacg tggactccaa cgtcaaaggg 2400
cgaaaaaccg tctatcaggg cgatggccca ctacgtgaac catcacccta atcaagtttt 2460
ttggggtcga ggtgccgtaa agcactaaat cggaacccta aagggagccc ccgatttaga 2520
gcttgacggg gaaagccggc gaacgtggcg agaaaggaag ggaagaaagc gaaaggagcg 2580
ggcgctaggg cgctggcaag tgtagcggtc acgctgcgcg taaccaccac acccgccgcg 2640
cttaatgcgc cgctacaggg cgcgtcccat tcgccattca ggctgcgcaa ctgttgggaa 2700
gggcgatcgg tgcgggcctc ttcgctatta cgccagctgg cgaaaggggg atgtgctgca 2760
aggcgattaa gttgggtaac gccagggttt tcccagtcac gacgttgtaa aacgacggcc 2820
agtgagcgcg cgtaatacga ctcactatag ggcgaattgg agctc 2865
<210> 2
<211> 1186
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
tcttttcttt cctcccccct caaaaaaaaa aaaagaaaaa tggtaattaa ttatttacta 60
gttaacaggg acaatcctca ttttttttgt caaaaaagtg ttgcggagac gggatttgaa 120
cccgtgacct caaggttatg agccttgcga gttaccaagc tgctctaccc cgcgtgatga 180
agagaagaag tgggaactaa tggacaaaca aggattgaat gcgcccctct accatatctg 240
tataaataga atagcacatt tatacagaat ggtaaagagg ctcctctatg atcgatgatc 300
gtggaaatga ctagaaaaat gaaggaaaaa ttggaatctt taccaacttg atcttgttgc 360
ccccggcaac aaacatgcat gaacctttgc acgaagtatg tgtccggata gcccaaagtc 420
tcgataatta gctcttggtc ttccagtcaa aaaacaacgt cggtgaagac gtgttggtgc 480
actatttcgc ggtggggatt gtaactttcc atgaatttcc catttatcac tcaacgacgg 540
aactttgctt atttcttttt ttgaggatcg acgaatcaaa tgatattttt gttccaattt 600
ttgcctcttc ttctcccgct gaatcaaact tttccttgcc ataatgtttc acttcctatt 660
agtatcgctg atacaagtcg gatcctagat gtagaaatat ataaaataac cttttccatc 720
gaaagaaatg atattcttgc ggatacagca cataaaagaa ttaaccaaat ttgcccgatg 780
tagaggcaat caagaaagcc gcataagtga agatataacc tacagaaaag tgggctaatc 840
caaccaatct tgcttgcaca atggaaagag ctactggttt atctctccat cgaatcaaat 900
tagccaaagg tgtacgttca tgagcccatg ctaaagtttc aatcaattcc tgccaatatc 960
cgcgccagga aattaagaac ataaatccag tagcccaaac aagatgtcca aataagaaca 1020
tccatgccca gaccgataaa ctattcatcc caaaggggtt atacccattg ataagatgtg 1080
aagagtttaa ccataaataa tctcttaacc atcccatcaa ataagtagaa gattcattaa 1140
actgtgaaac gttactctgc cataatgtta tgtgcttcca atgcca 1186
<210> 3
<211> 1093
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gatgtaggat ctagaataag catttgtgaa ataaaaaagg actctcaact ctatgttcga 60
ataaagtggg aaaggggtgg aaataagtca tatagaatca atggattcat ggtataatcc 120
ccccatgatg cgtttttttt tgcctgatag agggatcaaa tggtataatt cttttgttgg 180
tagcttggag gattaaaaac atgactattg ctttccaatt ggctgttttt gcattaattg 240
ctacttcgtc aatcttatta attagtgtac ctgttgtttt ttcttctcct gacggttggt 300
caagcaacaa aaatgttgta ttttccggta catcattatg gattggatta gtctttctgg 360
taggtattct taattctctc atctcttgaa cccagataca aaaatggaaa agacccctcc 420
cccaattctt tagagttgcg agacgcattt aaattcaata aaagtcctca aaattcaaaa 480
tacaaaaaaa aattagaggg aggggtcaaa ctttcttata atttgtatgt aatttataaa 540
tgaaagtaaa tgtaaaatta agtgtaattt gataaaataa ttatattatt agaaaatcat 600
tctaaattat cattctaaat tctaatttag aataataaat tctaagaaat tctaaattct 660
atttttaata aattctaaat gaatataaat ttgaattcta ttcaaataaa atggaataaa 720
aaattaaata tataaataat atatataaat atatataaat atattatata aattaaataa 780
attaaatgta ttagatgtaa tctattaatt aaatataata taattaaata taataggaat 840
atattaaata ggtaatagga atggtcctga aaagaatatc tggcatagct attcacaaat 900
aggatccagg tactgcgtgt caatatcaag atcaagacaa aaaaaaatgc ggatatagtc 960
gaatggtaaa atttctcttt gccaaggaga agacgcgggt tcgattcccg ctatccgccc 1020
aagtcgattt atttaatagg ataaagagga taaaggattc agtatagttg accctaatag 1080
tctaattcta ccc 1093
<210> 4
<211> 2714
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
actagtataa cttcgtataa tgtatgctat acgaagttat ggatcgcact ctaccgattg 60
agttacatcc gctttagtat gttactattt cttttattat aacttataaa atataataca 120
taaagataaa ttctataata aaaagctaag attttatttt tctggcacat cgtaatttat 180
aaagacaggc aaatttaaac aaaagataac tttagaactt aattttaaaa atgtaaaatg 240
atgtttaggt atttaaccta aacaccataa aaataaaaac gatgtttatg ctattcacat 300
aaacatcatg aaaaataaaa attaaagttt gtcaatagta tcaaattcga atttaatttc 360
tttccaaact tcacatgcag cagcaagttc tggagaccat ttacaagctg aacgaattac 420
gtcgccacct tcacgagcaa ggtcacgacc ttcgttacga gcttgagtac aagcttgcat 480
gccctagaca ttatttgccg actaccttgg tgatctcgcc tttcacgtag tggacaaatt 540
cttccaactg atctgcgcgc gaggccaagc gatcttcttc ttgtccaaga taagcctgtc 600
tagcttcaag tatgacgggc tgatactggg ccggcaggcg ctccattgcc cagtcggcag 660
cgacatcctt cggcgcgatt ttgccggtta ctgcgctgta ccaaatgcgg gacaacgtaa 720
gcactacatt tcgctcatcg ccagcccagt cgggcggcga gttccatagc gttaaggttt 780
catttagcgc ctcaaataga tcctgttcag gaaccggatc aaagagttcc tccgccgccg 840
gacctaccaa ggcaacgcta tgttctcttg cttttgtcag caagatagcc agatcaatgt 900
cgatcgtggc tggctcgaag atacctgcaa gaatgtcatt gcgctgccat tctccaaatt 960
gcagttcgcg cttagctgga taacgccacg gaatgatgtc gtcgtgcaca acaatggtga 1020
cttctacagc gcggagaatc tcgctctctc caggggaagc cgaagtttcc aaaaggtcgt 1080
tgatcaaagc tcgccgcgtt gtttcatcaa gccttacggt caccgtaacc agcaaatcaa 1140
tatcactgtg tggcttcagg ccgccatcca ctgcggagcc gtacaaatgt acggccagca 1200
acgtcggttc gagatggcgc tcgatgacgc caactacctc tgatagttga gtcgatactt 1260
cggcgatcac cgcttccccc atgatgttaa tttttttaaa gttttaattt ctccgtaaaa 1320
tattgtaaaa atattttaat ttataaattc aagcttctat taaaagcatg gtacatatat 1380
tataccacaa aaaatcaaac gttagttacc tagcacattt atgtacctac gtccccttcc 1440
ccttacggga cgccagtgga cgtcccctta cccttacggg acgtcagtgg cagttgcctg 1500
ccaactgcct ccttcggagt attaaaatag gacgcgttaa tagctcactt ttcttataac 1560
ttcgtataat gtatgctata cgaagttatg gtaccgggcc cgtagaaacg caaaaaggcc 1620
atccgtcagg atggccttct gcttaatttg atgcctggca gtttatggcg ggcgtcctgc 1680
ccgccaccct ccgggccgtt gcttcgcaac gttcaaatcc gctcccggcg gatttgtcct 1740
actcaggaga gcgttcaccg acaaacaaca gataaaacga aaggcccagt ctttcgactg 1800
agcctttcgt tttatttgat gcggccgctt acttgtacag ctcgtccatg ccatgtgtaa 1860
tcccagcagc tgttacaaac tcaagaagga ccatgtggtc tctcttttcg ttgggatctt 1920
tcgaaagggc agattgtgtg gacaggtaat ggttgtctgg taaaaggaca gggccatcgc 1980
caattggagt attttgttga taatggtctg ctagttgaac gcttccatct tcaatgttgt 2040
gtctaatttt gaagttgact ttgattccat tcttttgttt gtctgccatg atgtatacat 2100
tgtgtgagtt atagatgtat tccaatttgt gtccaagaat gtttccatcc tctttaaaat 2160
caataccttt taactcgatt ctattaacaa gggtatcacc ttcaaacttg acttcagcac 2220
gtgtcttgta gttcccgtca tctttgaaaa atatggttct ttcctgtaca taaccttcgg 2280
gcatggcact cttgaaaaag tcatgctgtt tcatatgatc tgggtatctc gcaaagcatt 2340
gaagaccata cgcgaaagta gtgacaagtg ttggccacgg aacaggtagt tttccagtag 2400
tgcaaataaa tttaagggta agttttccgt atgttgcatc accttcaccc tctccactga 2460
ctgaaaattt gtgcccatta acatcaccat ctaattcaac aagaattggg acaactccag 2520
tgaaaagttc ttctccttta ctcaccatgg gtatatctcc ttcttaaagt taaactgcag 2580
tatttggatc cgtatccaag cgcttcgtat tcgcccggag ttcgctccca gaaatatagc 2640
catccctgcc ccctcacgtc aatcccacga gcctcttatc cattctcatt gaacgacggc 2700
gggggagcgt cgac 2714
Claims (6)
1. a kind of method for building up of poplar plastid expression system, which is characterized in that the foundation side of the poplar plastid expression system
Method includes:
The first step establishes Turpinia arguta high-efficiency blade regenerating system；
Second step constructs poplar Plastid Transformation Vectors using different kinds of molecules biology techniques, and the carrier is to remove polyclonal position
Plasmid pBluescript II ks (+) carrier of point is skeleton；It is led using bronze package pYY20 Plasmid DNA by particle bombardment
Enter in Turpinia arguta plastid genome, after bombarding, screens multiple sun on the PaSIM1 culture medium of the spectinomycin containing 30mg/L
Property resistance seedling；
Third step, positive resistance seedling leaf after regeneration, are analyzed on the PaSIM2 culture medium of the spectinomycin containing 30mg/L
Whether GFP gene imports in plastid genome, if reaches homogeneity.
2. the method for building up of poplar plastid expression system as described in claim 1, which is characterized in that in the first step, Turpinia arguta
The method for building up of high-efficiency blade regenerating system includes:
Healthy and strong sterile Turpinia arguta young leaflet tablet is chosen, is cultivated in leaf regeneration culture medium PaSIM2, Multiple Buds is transferred to
It is cultivated in fast breeding culture medium, when tissue-cultured seedling is grown 4 weeks, the stem section for choosing the 3-4 tubercle length in top places into culture of rootage
It is grown in base, when this tissue-cultured seedling is grown 4 weeks, chooses blade material of the 2-3 piece blade on poplar tissue-cultured seedling top as conversion
Material；
Condition of culture: 25 DEG C of illumination/20 DEG C 16h 8h dark；Intensity of illumination: 30-40 μ Em-2·s-1；This poplar tissue-cultured seedling top
2-3 piece blade be cut into the square of 3mm*3mm size, be transferred in leaf regeneration culture medium PaSIM1 and regenerate.
3. the method for building up of poplar plastid expression system as described in claim 1, which is characterized in that
In second step, the construction method of Turpinia arguta Plastid Transformation Vectors includes:
To remove plasmid pBluescript II ks (+) SEQ:ID:NO:1 of multiple cloning sites as carrier framework, clone's
Left homologous sequence SEQ:ID:NO:2, right homologous sequence SEQ:ID:NO:3, Tobacco plastid transformation in Turpinia arguta plastid genome
AadA expression cassette and gfp expression cassette SEQ:ID:NO:4 in carrier pYY12 are cloned into the plasmid of removal multiple cloning sites
In pBluescript II ks (+), poplar Plastid Transformation Vectors pYY20 is constructed.
4. the method for building up of poplar plastid expression system as described in claim 1, which is characterized in that
In second step, the method for building up of poplar plastogene rifle transformation system includes:
Blade material is placed in osmotic medium PaOM first after carrying out dark culturing 24 hours, wraps up poplar matter with bronze
Body conversion carrier pYY20 Plasmid DNA, by biolistic bombardment blade conversion method, using the efficient leaf regeneration system of Turpinia arguta,
Screen resistant buds on the PaSIM1 culture medium containing 30mg/L spectinomycin, condition of culture: 25 DEG C of illumination/20 DEG C 16h 8h are black
Secretly；Intensity of illumination: 20-25 μ Em-2·s-1；6 bombardments have obtained 8 positive seedlings, obtained resistant buds be transferred to containing
On the PaSIM2 culture medium of 30mg/L spectinomycin, after the leaf regeneration using 2-3 wheel, Southern bolt identification is same
Matter resistance seedling, to obtain the transgenic poplar tissue-cultured seedling of homogeneity.
5. the method for building up of poplar plastid expression system as described in claim 1, which is characterized in that
In third step, the hardening and method for transplanting of transgenic poplar include:
Obtained homogeneous transgenic poplar tissue-cultured seedling is moved into earth culture matrix, earth culture matrix formulations are as follows: vermiculite: turfy soil:
Perlite=5:3:2, and at growth cabinet culture 1-2 months, then after hardening, it is transferred to greenhouse and carries out gradually increasing light
According to the culture of intensity and reduction humidity, it is finally transplanted to outdoor field cultivation culture.
6. the method for building up of poplar plastid expression system as described in claim 1, which is characterized in that in third step, green is glimmering
Photoprotein GFP gene is transcribed in poplar plastid with expression
By Northern bolt analysis shows that the transcriptional level of GFP gene, by Western blot analysis shows green glimmering
Photoprotein GFP gene successful expression in poplar plastid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811313449.8A CN109371058A (en) | 2018-11-06 | 2018-11-06 | A kind of method for building up of poplar plastid expression system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811313449.8A CN109371058A (en) | 2018-11-06 | 2018-11-06 | A kind of method for building up of poplar plastid expression system |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109371058A true CN109371058A (en) | 2019-02-22 |
Family
ID=65397354
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811313449.8A Pending CN109371058A (en) | 2018-11-06 | 2018-11-06 | A kind of method for building up of poplar plastid expression system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109371058A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115088621A (en) * | 2022-07-18 | 2022-09-23 | 南京林业大学 | Method for promoting massive and rapid differentiation of poplar explants into buds by vacuum pumping treatment |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102373235A (en) * | 2011-10-17 | 2012-03-14 | 南京林业大学 | Method for performing transient expression by introducing foreign gene into poplar bioplast |
| CN103555757A (en) * | 2012-12-25 | 2014-02-05 | 西北大学 | Cichorium intybus chloroplast transformation system establishment method |
| CN104278040A (en) * | 2013-07-12 | 2015-01-14 | 中国科学院上海生命科学研究院 | Method for improving adversity resistance of plants |
| CN104561090A (en) * | 2015-01-14 | 2015-04-29 | 北京市农林科学院 | Method for improving agrobacterium tumefacien-mediated genetic transformation efficiency of poplar |
| CN104711285A (en) * | 2015-03-24 | 2015-06-17 | 北京市农林科学院 | Constructing method of stable self-luminous recombinant vector and application of recombinant vector |
| CN107267538A (en) * | 2017-06-12 | 2017-10-20 | 湖北大学 | A kind of construction method of plant plastid expression vector and application |
-
2018
- 2018-11-06 CN CN201811313449.8A patent/CN109371058A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102373235A (en) * | 2011-10-17 | 2012-03-14 | 南京林业大学 | Method for performing transient expression by introducing foreign gene into poplar bioplast |
| CN103555757A (en) * | 2012-12-25 | 2014-02-05 | 西北大学 | Cichorium intybus chloroplast transformation system establishment method |
| CN104278040A (en) * | 2013-07-12 | 2015-01-14 | 中国科学院上海生命科学研究院 | Method for improving adversity resistance of plants |
| CN104561090A (en) * | 2015-01-14 | 2015-04-29 | 北京市农林科学院 | Method for improving agrobacterium tumefacien-mediated genetic transformation efficiency of poplar |
| CN104711285A (en) * | 2015-03-24 | 2015-06-17 | 北京市农林科学院 | Constructing method of stable self-luminous recombinant vector and application of recombinant vector |
| CN107267538A (en) * | 2017-06-12 | 2017-10-20 | 湖北大学 | A kind of construction method of plant plastid expression vector and application |
Non-Patent Citations (3)
| Title |
|---|
| SATORU OKUMURA等: "Transformation of poplar (Populus alba) plastids and expression of foreign proteins in tree chloroplasts", 《TRANSGENIC RES》 * |
| 王建革等: "基因枪转多基因库安托杨的获得", 《科学通报》 * |
| 纪丽丽: "杨树基因枪多基因共转化研究", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115088621A (en) * | 2022-07-18 | 2022-09-23 | 南京林业大学 | Method for promoting massive and rapid differentiation of poplar explants into buds by vacuum pumping treatment |
| CN115088621B (en) * | 2022-07-18 | 2023-09-26 | 南京林业大学 | Method for promoting mass and rapid differentiation of poplar explants into buds by utilizing vacuumizing treatment |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107686848A (en) | The stable of transposons collaboration CRISPR/Cas9 systems knocks out single plasmid vector and its application | |
| CN110079551B (en) | Circular RNA expression vector and construction method and application thereof | |
| CN109735480A (en) | A kind of recombined bacillus subtilis synthesizing the new tetrose of lactoyl-N- and its construction method and application | |
| CN111149730B (en) | Method for rapidly cultivating homozygous individuals of pluripotent stem cell fluorescence-labeled zebra fish | |
| CN111378785A (en) | Pseudo virus standard substance for nucleic acid diagnosis of novel coronavirus 2019-nCov and application thereof | |
| CN109810958B (en) | Saffron-derived CCD2 mutant, coding sequence and application thereof, and recombinant yeast strain for producing crocetin | |
| CN107475297B (en) | Recombinant fowlpox virus transfer vector for expressing duck type 2 adenovirus fiber2 gene and construction method and application thereof | |
| CN107475296A (en) | A kind of recombinant Borrel virus transfer vector for expressing the type adenovirus fiber2 genes of chicken 4 and its construction method and application | |
| CN110257403B (en) | Infectious laryngotracheitis virus gB gene expression, recombinant fowlpox virus thereof, construction method and application | |
| CN109371058A (en) | A kind of method for building up of poplar plastid expression system | |
| CN113754783B (en) | Application of recombinant RLK in plant immune regulation | |
| CN101397570B (en) | Intermediate vector for gene targeting, preparation method and use thereof | |
| US6781044B2 (en) | Plant selectable marker and plant transformation method | |
| CN113354718A (en) | Piranin precursor, expression cassette and preparation method thereof | |
| CN107400679A (en) | Plasmid vector and its application for being overexpressed stability series are established based on transposase | |
| KR102096282B1 (en) | Method for effective purification of human TREM2 proteins using recombinant baculovirus | |
| CN110079530A (en) | A kind of gene editing tool and its preparation method and application from lactobacillus buchneri | |
| KR101898214B1 (en) | A recombinant vector comprising MYH1 gene and use thereof | |
| KR101578441B1 (en) | Foot-and-mouth disease virus expressing P1-protective antigen of O-PanAsia-2 strain and the manufacturing methods | |
| CN103952407A (en) | GAL1 promoter relieving glucose inhibiting effect and application thereof | |
| KR101578425B1 (en) | Foot-and-mouth disease virus expressing P1-protective antigen of SAT1-WZ topotype and the manufacturing methods | |
| CN114657197B (en) | Application of Gsm1p as positive control factor in improving protein expression in host cell | |
| CN114107348A (en) | Chlamydomonas reinhardtii-based protein interaction analysis method | |
| CN114773441B (en) | Application of Hot1p as positive control factor in improving protein expression in host cell | |
| CN111454962B (en) | Fixed-point modification based on bovine safe site and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190222 |