CN114107348A - Chlamydomonas reinhardtii-based protein interaction analysis method - Google Patents

Abstract

The invention discloses a chlamydomonas reinhardtii-based protein interaction analysis method. According to the method, a resistance gene Shble and a target protein are subjected to fusion expression in Chlamydomonas reinhardtii, a flexible peptide fragment affinity Tag 12 XHis is inserted between the Sh ble and the target protein, a Strep II Tag is inserted into a carboxyl terminal of the target protein, a positive clone strain screened by bleomycin is cultured in a large scale, and the target protein and related proteins interacted with the target protein are simultaneously purified by utilizing a Strep II Tag affinity column. The method can be extended to the analysis and detection of all Chlamydomonas reinhardtii protein signal transmission channels.

Description

Chlamydomonas reinhardtii-based protein interaction analysis method

Technical Field

The invention belongs to the technical field of molecular biology, and relates to a chlamydomonas reinhardtii-based protein interaction analysis method.

Background

Chlamydomonas reinhardtii is a model organism widely studied at present and is the only species which can realize nucleus transformation, chloroplast transformation and mitochondria transformation simultaneously. The method is a favorite research object of scientists in the fields of photosynthesis, reproductive science, plant biotechnology, chloroplast transformation technology and the like. Chlamydomonas reinhardtii is a haploid eukaryotic alga, has two flagella and a chloroplast, and normally moves to an area most suitable for growth by controlling phototaxis through sensing the intensity of green light in the environment by a light channel protein (channelrhodopsin). In the nuclear transformation process, the exogenous gene is integrated in the nuclear genome of Chlamydomonas reinhardtii in a non-homologous recombination manner. Although widely studied, scientists have been lacking means for stable expression of foreign genes in Chlamydomonas reinhardtii.

The Sh ble gene is a resistance gene of bleomycin and can be used as a selective marker in Chlamydomonas reinhardtii. In Chlamydomonas reinhardtii, the Ble protein protects cells by binding antibiotics into the nucleus, and thus its expression level is proportional to the tolerance level of antibiotics.

LOV is a domain of plant phototactics. Phototactics are composed of two LOV domains and one kinase domain. The major function of the luciferin in higher plants is to control chloroplasts. The LOV domain belongs to a family of numerous members, most of which are light(s) ((LLight), oxygen (Oxygen) and voltage (vVoltage). It contains a non-covalently bound Flavin Mononucleotide (FMN) chromophore, which under irradiation with blue light binds to a serine residue and initiates a conformational change in the domain, which, when placed in the dark, returns the LOV domain through a series of conformational changes to the original energy state. In higher plants, phototactics are generally responsible for sensing the intensity of blue light in ambient light. When excited, the LOV structural domain is changed in conformation, so that protein kinase at the carboxyl terminal is activated, and then downstream protein is modified through the kinase, so that a signal transduction process is completed. The function of the phototactic element in the higher plants is mainly to control the movement of chloroplast in the leaf, realize the maximum photosynthesis under the weak light and avoid the damage of free radicals generated by over-irradiation under the strong light. Although homologous to phototactics in higher plants, phototactics in Chlamydomonas reinhardtii are apparentDoes not perform the same function as higher plant phototactic elements. Its LOV domain is highly homologous to that of higher plants, but there are large non-conserved insertions in the key active regions of its kinase domain.

Disclosure of Invention

The invention aims to provide a chlamydomonas reinhardtii-based protein interaction analysis method.

The technical scheme for realizing the purpose of the invention is as follows:

the chlamydomonas reinhardtii-based protein interaction analysis method specifically comprises the following steps: the Sh ble and the target protein of the resistance gene are fused and expressed in Chlamydomonas reinhardtii, a flexible peptide fragment affinity Tag 12 XHis is inserted between the Sh ble and the target protein, Strep II Tag is inserted at the carboxyl terminal of the target protein, the positive clone strains screened by bleomycin are cultured in a large scale, and the target protein and related proteins which interact with the target protein are simultaneously purified by utilizing a Strep II Tag affinity column.

The method for fusion expression of the resistance gene Sh ble and the target protein in Chlamydomonas reinhardtii comprises the following steps: constructing a fusion expression vector of the Sh ble gene and the target protein, carrying out enzyme digestion linearization on the fusion expression vector, and transferring the linearized DNA into Chlamydomonas reinhardtii.

The target protein of the invention can be any Chlamydomonas reinhardtii protein, and in the specific embodiment of the invention, the Chlamydomonas reinhardtii protein is LOV1 structural domain of a phototactic protein.

The chlamydomonas reinhardtii disclosed by the invention is a chlamydomonas reinhardtii strain sensitive to bleomycin, and comprises but is not limited to a cell wall defect type overexpression mutant strain UVM 4.

The invention relates to a method for fusion expression of a resistance gene Sh ble and a target protein in Chlamydomonas reinhardtii, which comprises the following steps:

(1) PCR amplifying target protein DNA, using EcoRI and MluI to respectively enzyme-cut the target protein DNA fragment and the PCYX009 vector, and connecting through T4 ligase to obtain a vector inserted with target protein DNA-Strep II tag;

(2) respectively carrying out enzyme digestion on Sh ble and a vector inserted with target protein DNA-Strep II tag by NdeI and AgeI, and connecting the Sh ble and the vector by T4 ligase to obtain an expression vector inserted with Shble-target protein DNA-Strep II tag;

(3) using a fast-cutting enzyme KpnI to carry out enzyme digestion on the expression vector inserted with the Sh ble-target protein DNA-Strep II tag to obtain linear DNA;

(4) the linear DNA was transferred to Chlamydomonas reinhardtii and positive clones were screened using bleomycin.

Compared with the prior art, the invention has the following advantages:

aiming at the problem that exogenous recombinant genes are difficult to express in chlamydomonas reinhardtii bodies, the invention utilizes fusion expression of a resistance gene Sh ble and target protein and inserts a flexible peptide fragment affinity tag 12 XHis between the Sh ble and the target protein, thereby not interfering the correct folding of the target protein. And (2) inserting Strep II Tag into the carboxyl terminal of the target protein, purifying the related protein interacted with the target protein by utilizing the high specificity of the Strep II Tag, and further purifying the target protein by utilizing a 12 × His Tag to realize the identification of the target protein interaction group. The method of the invention does not need additional screening markers, greatly reduces the screening workload of the transformant, and over 90 percent of monoclone growing on the selective TAP plate expresses the target exogenous gene. The method can be extended to the analysis and detection of almost all Chlamydomonas reinhardtii protein signal transmission channels.

Drawings

FIG. 1 is a schematic diagram of the structure of plasmid PCYX 009.

FIG. 2 is a diagram showing the result of PCR agarose gel electrophoresis of the Sh ble nucleic acid coding sequence.

FIG. 3 is a photograph of the results of PCR agarose gel electrophoresis of the LOV1-Strep II tag nucleic acid coding sequence.

FIG. 4 is a diagram showing the results of double-restriction agarose gel electrophoresis of EcoRI and MluI of PCYX009 plasmid.

FIG. 5 is a graph showing the results of double restriction enzyme digestion of EcoRI and MluI of plasmid PCY009(LOVI-Strep II tag) after large fragment ligation of LOVI-Strep II tag and vector PCY 009.

FIG. 6 is a diagram showing the electrophoresis results of a large-fragment agarose gel of a vector digested by plasmid PCY009(LOVI-Strep II tag) NdeI and AgeI in two ways.

FIG. 7 is a diagram showing the results of colony PCR verification of plasmid PCY0010 after double digestion of Sh ble with vector PCY009(LOVI-Strep II tag) NdeI and AgeI and large fragment ligation.

FIG. 8 is a graph showing the results of double restriction of NdeI and AgeI in plasmid PCY0010 after double restriction of Sh ble and vector PCY009(LOVI-Strep II tag) NdeI and AgeI together with the ligated large fragment.

FIG. 9 shows the transformants grown by the bead milling method of vector PCY0010 onto a zeocin antibiotic-containing plate.

FIG. 10 is a western blot validation chart of transformants.

FIG. 11 is a schematic diagram of the structure of the PCYX0010 plasmid.

FIG. 12 is a SDS-PAGE and western blot validation of the Sh ble-LOV1 fusion protein after purification.

FIG. 13 is a scheme showing the purification and enrichment of Sh ble-LOV1 fusion protein and a protein interacting with LOV1 protein.

Detailed Description

The invention will be further described with reference to specific embodiments and figures, but is not limited thereto. The procedures, conditions, reagents, experimental methods and the like for carrying out the present invention are general knowledge and common general knowledge in the art except for the contents specifically mentioned below, and the present invention is not particularly limited.

The materials used in the examples are as follows:

1. the source of algal strain

The Chlamydomonas reinhardtii strain selected is a cell wall-deficient overexpression mutant strain UVM4(Ralph Bock, MPIMP).

2. Source of plasmids

Reference to the construction of the PCYX009 plasmid [ chen guiqi. hyper-folding wiener yellow fluorescent protein and its study and analysis of expression in chlamydomonas reinhardtii [ D ]. university of tokyo chem, 2020 ], contains the elements in sequence from N-terminus to C-terminus: PSAD (photosystem I protein D) promoter, cloning site of target gene, PSAD terminator, HSP70A promoter, continuous promoter RBCS2 (ribose biphosphate carboxylase small chain 2), resistance selection gene APHVIII, and RBCS2 stop codon. The promoter of RBCS2 of Chlamydomonas reinhardtii can drive the high-efficiency expression of transgenes, and when the first intron of RBCS2 is added to the upstream or downstream of the promoter, the transformation efficiency and the expression level of endogenous and exogenous genes are remarkably improved. The HSP70A promoter (bacteriophage T7 promoter) can be used as a transcription activator, and when the promoter of RBCS2 is placed downstream of the HSP70A promoter, the expression level of chlamydomonas reinhardtii transgene is further increased. The cloning site of the target gene sequentially comprises a ribosome binding site, an NdeI sequence CCATGG and an AgeI site ACCGGT from the N end to the C end; 12 histidine sites and a tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; MluI cleavage site ACGCGT and EcoRI cleavage site GAATTC and the stop codon TAG. The PCYX009 plasmid (FIG. 1) and Shble (SEQ ID NO.1) and LOVI sequences are shown in the sequence table (SEQ ID NO. 2).

3. Source of primers

The synthetic primers were all from Biotechnology, Inc. of Ongbenaceae, Beijing.

4. Primary reagent

Tryptone, yeast extract, NaCl, Tris-baes were purchased from Sigma; restriction endonucleases, phusion enzymes, were purchased from Thermo Fisher; rTaq enzyme, T4 ligase, was purchased from Takara. The plasmid miniprep kit and the gel recovery kit were purchased from Axygen corporation. NTP, DEPC water and RNase inhibitor were purchased from Shanghai Biotechnology Limited.

Construction of PCYX0010 vector

a) Cloning of Sh ble and LOV1 genes

Based on the comparison of the codon used by Sh ble and LOV1 with the usage frequency of Escherichia coli codon in Kazusa online database (http:// www.kazusa.or.jp/codon /), a novel Sh ble coding sequence (SEQ ID NO.1) and a LOVI coding sequence (SEQ ID NO.2) were designed and synthesized. And then amplified by a PCR method. The PCR reaction system configuration is shown in Table 1.

TABLE 1 PCR reaction System preparation Table

Sh ble Forward primer(SEQ ID NO.4)：5’-cccatatgactagtatggccaggatg-3’；

Sh ble Reverse primer(SEQ ID NO.5)：5’-gaccggtgtcctgctcctcg-3’；

LOV1 Forward primer(SEQ ID NO.6)：5’-cgacgcgtatgaccttcgtggtggc-3’；

LOV1 Reverse primer(SEQ ID NO.7)：5’- cggaattcttacttctcgaactgggggtggctccaggtcttgctggtca-3’。

The PCR results are shown in FIGS. 2 and 3. The length of the target segment Sh ble is 387bp, and the optimal annealing temperature is 50 ℃. The target fragment LOV1-Strep II tag is 348bp in length, and the optimal annealing temperature is 64 ℃.

b) Recovering target DNA, cutting target fragments LOV1-Strep II tag and PCYX009 vector with EcoRI and MluI enzyme, performing agarose gel electrophoresis, and recovering cut products as shown in FIG. 4; the recovered target fragment and the PCYX009 vector fragment were ligated with T4 ligase at a molar ratio of 4:1 for 2 hours at 22 ℃.

c) The above ligation products were transformed into 80uL DH 5. alpha. competent cells by heat shock at 42 ℃, added with 700uL LB medium and then placed on a shaker at 37 ℃ and cultured at 200 rpm for 45 minutes.

d) Centrifuging the bacterial liquid at the rotating speed of 125000 rpm for 1 minute, and then sucking 700uL of supernatant; after the remaining medium was gently aspirated by a pipette, the medium was spread on an LB solid plate containing ampicillin, and the plate was placed upside down in an incubator at 37 ℃ and cultured for 12 hours.

e) A single colony of the plate was picked, and after a small amount of amplification, a recombinant plasmid was extracted and designated PCY009(LOVI-Strep II tag). The extracted plasmid was double digested with EcoRI and MluI, identified by agarose gel electrophoresis, and identified as correct by sequencing, as shown in FIG. 5.

f) Digesting the Sh ble of the target fragment and the PCY009(LOVI-Strep II tag) with NdeI and AgeI, and then performing agarose gel electrophoresis, as shown in FIG. 6, and recovering the digested product; the recovered desired fragment LOV1 and the large vector fragment cut with fast-cutting enzymes NdeI and AgeI were ligated at 22 ℃ for 2 hours with T4 ligase at a molar ratio of 4: 1. The obtained expression vector containing the target gene LOV1 is named as PCYX0010, the coding sequence is SEQ ID NO.3, and the structural schematic diagram of the plasmid is shown in FIG. 11. FIG. 7 is a diagram showing the results of PCR verification of the PCYX0010 colony. FIG. 8 is a diagram showing the results of double-restriction agarose gel electrophoresis of plasmid PCYX0010 with NdeI and AgeI.

Transformation of PCYX0010

a) Chlamydomonas reinhardtii strain UVM4 culture

Picking a monoclonal algal strain with toothpick in solid TAP medium, transferring into liquid TAP medium (TAP liquid medium (see www.chlamy.org): Tris base 20ml/L, phosphor buffer 10ml/L, Nutrient stock 10ml/L, Trace elements1ml/L, adjusting pH to 7.1-7.4 with glacial acetic acid, fixing volume, autoclaving, and storing), and 16h red and blue light (50% red light, 50% blue light, 6.0 × 10) at 22 deg.C¹⁹Photon/m.)/8h dark, 120rpm, as OD₆₀₀Inoculating 1ml of algae solution into 50ml of fresh TAP culture medium when the culture medium is 0.2-0.4, and continuing culturing until the Chlamydomonas reinhardtii grows to logarithmic phase (OD)₆₀₀0.8-1.0).

b) The vector pCYX0010 was digested with the fast-cutting enzyme KpnI for about 2ug 3-4h, and the linear plasmid was stored in a refrigerator at-20 ℃ for further use.

c) When Chlamydomonas reinhardtii grows to logarithmic growth phase (OD)₆₀₀0.8-1.0), placing into a 50ml centrifuge tube, centrifuging at room temperature at 1,350rcf for 5min, discarding the supernatant, and fully suspending with the unspent TAP. 2ug of linearized DNA, 100ul of 20% PEG (polyethylene glycol) and a well-suspended algal solution (total volume not exceeding 300ul) were added to a 2ml centrifuge tube containing 300mg of glass beads with radius 0.6-0.8um treated with HCl. Maximum shaking speed vortex 15s, transferred to 50ml fresh TAP medium, incubated for 12-18h at 22 ℃ in the dark at 120 rpm. Put into a 50ml centrifuge tube, centrifuged at 1,350g for 7min at normal temperature, and the supernatant was discarded. After the suspension was fully and uniformly suspended by the remaining TAP, the algal solution transferred into the vector pCYX0010 was uniformly spread on a TAP plate containing 10. mu.g/ml bleomycin, incubated in the dark for 12 hours, and then cultured at 22 ℃ under light for 1-2 weeks, so that a monoclonal algal strain appeared, as shown in FIG. 9.

Screening of PCYX0010 Positive clones

a) 8 monoclonal algae strains and a wild type strain of wild type UVM4 were randomly picked with toothpicks in solid TAP medium as a secondary control and inoculated into 50ml TAP medium at 22 ℃ for 16h of red blue light (50% red light, 50% blue light, 6.0X 10)¹⁹Photon/m.)/8h dark, 120 rpm. Grow to OD₆₀₀At 0.8, 2ml of algal solution was collected, centrifuged at 12000rcf for 1 minute at room temperature, and the supernatant was discarded. 125ul of PBS (phosphate buffer saline) is added to the precipitate for uniform suspension, 125ul of 2 Xloading buffer (SDS-PAGE) is added for uniform mixing, denaturation is carried out at 95 ℃ for 10min, the mixture is incubated on ice for 1min, centrifugation is carried out at 12,000g for 1min at normal temperature, and 20ul of supernatant is taken for sampling.

Table 212% SDS-PAGE formulation

Name of reagent	Separating glue (ml)	Concentrated glue (ml)
			ddH2O	1.7	1.525
30% gel stock solution	2.0	0.325
			4 Xgel buffer	1.25	0.625
10％SDS	0.05	0.025
			10％APS	0.05	0.025
TEMED	0.01	0.005

b) Two SDS-PAGE gels are assembled in an electrophoresis device, buffer solution is filled in the electrophoresis device, the gel is run at a constant voltage of 90V in a refrigerator at 4 ℃, when a sample runs to the junction position of the stacking gel and the separating gel, the voltage value is adjusted to be 120V, when the sample runs to a proper position, a power supply is turned off, the SDS-PAGE is taken down, one SDS-PAGE gel is used for quantification, and the other SDS-PAGE gel is used for western blot verification.

Screening of Western blot Positive clones

a) SDS-PAGE glue is assembled into a film transferring device according to a spongy cushion, 3 layers of filter paper, glue, an NC film, 3 layers of filter paper and the spongy cushion, and is filled with buffer solution.

b) Transferring into membrane at constant current of 300mA for 60min in refrigerator, turning off power supply, washing with TBST for 30s, sealing with 5% skimmed milk powder for 1.5h, and washing with TBST for 5min for 3 times.

c) Incubate primary antibody (Anti-6 × His antibody) overnight at 4 deg.C, wash 3 times with TBST, 5min each time; secondary antibody (HRP-conjugated Goat Anti-Rabbit IgG) was added, incubated at room temperature for 1.5h, and washed 3 times with TBST for 5min each.

d) And spreading the luminous liquid on the NC film, and taking a picture. The results are shown in FIG. 10.

7. Positive clone resistance gene gradient screening and mass culture

a) Preparing TAP agar plate with bleomycin 10ug/ml, 20ug/ml and 50ug/ml, screening positive clone strain in three resistant gradient plates, and screening out the most resistant monoclonal strain.

b) The most resistant positive clone was inoculated into 50ml TAP medium at 22 deg.C for 16h red and blue light (50% red light, 50% blue light, 6.0X 10)¹⁹Photon/m.)/8h dark, 120 rpm. Grow to OD₆₀₀Inoculating the bacterial liquid to 1L TAP culture medium for large-scale culture until OD is about 0.6₆₀₀The culture is stopped when the growth reaches about 0.8-1.0.

c) Cooling at 4 deg.C, centrifuging the algae liquid at 4 deg.C and 8000g for 30min, discarding the supernatant, washing the precipitate with ddH2O, centrifuging again, discarding the supernatant, weighing the algae, and freezing at-80 deg.C.

Enrichment and purification of Shble-LOV1 fusion protein and determination of potential related proteins

a) Taking out the precipitate from a refrigerator at-80 deg.C, inserting into ice for redissolving, suspending the algae body with buffer W, adding appropriate amount of PMSF, and crushing the algae body with an ultrasonic crusher.

b) Centrifuging the broken bacteria liquid in a high-speed refrigerated centrifuge at 4 deg.C and 18000g for 20min, removing uncrushed organelles and cell debris in the precipitate, filtering the supernatant with 0.22ul microporous membrane, and inserting on ice to prepare a hanging column.

c) The Strep II Tag gravity column was equilibrated to 5 bed volumes with buffer W, then the protein sample was loaded with a peristaltic pump, cycled 2 times, and then equilibrated to 5 bed volumes with buffer W.

d) And (3) eluting the protein on the Strep II Tag gravity column by buffer BXT, wherein 0.5ml is used as one elution unit volume, the elution work of the protein can be completed after 6 units of elution, and most of protein samples exist in the first 3 elution units.

f) 20ul of protein sample was taken from the first 3 elution groups, 20ul of 2 Xloading buffer (SDS-PAGE) was added and mixed well, denatured at 95 ℃ for 10min, incubated on ice for 1min, centrifuged at 12000rcf for 1min at room temperature, and 20ul of supernatant was taken for loading. Wild type served as negative control for this experiment.

e) Two groups of SDS-PAGE gels were run, one for quantification and one for western blot re-validation, as shown in FIG. 12, the Sh ble-LOV1 fusion protein was positioned at 27.9kDa, and since the purification Tag Strep II Tag was at the C-terminus of LOV1, only Sh ble-LOV1 fusion protein was purified by the Strep II Tag gravity column, and at the same time, the protein interacting with LOV1 protein was also purified, while LOV1 was an endogenous protein of Chlamydomonas reinhardtii, Sh ble was an exogenous protein, and therefore the other purified proteins were basically proteins with potential interaction with LOV 1. The purification and enrichment procedures for the Sh ble-LOV1 fusion protein and the protein interacting with the LOV1 protein are shown in FIG. 13.

Sequence listing

<110> Nanjing university of science and technology

<120> Chlamydomonas reinhardtii-based protein interaction analysis method

<141> 2021-11-24

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 387

<212> DNA

<213> Streptococcus indians (Streptococcus ichussinundastus)

<400> 1

actagtatgg ccaggatggc caagctgacc agcgccgtgc ccgtgctgac cgcccgcgac 60

gtggccggcg ccgtggagtt ctggaccgac cgcctgggct tcagccgcga cttcgtggag 120

gacgacttcg ccggcgtggt gcgcgacgac gtgaccctgt tcatcagcgc cgtgcaggac 180

caggtggtgc ccgacaacac cctggcctgg gtgtgggtgc gcggcctgga cgagctgtac 240

gccgagtgga gcgaggtggt gagcaccaac ttccgcgacg ccagcggccc cgccatgacc 300

gagatcggcg agcagccctg gggccgcgag ttcgccctgc gcgaccccgc cggcaactgc 360

gtgcacttcg tggccgagga gcaggac 387

<210> 2

<211> 324

<212> DNA

<213> Chlamydomonas reinhardtii (Chlamydomonas reinhardtii)

<400> 2

atgaccttcg tggtggccga cgccaccctg cccgactgcc ccctggtgta cgccagcgag 60

ggcttctacg ccatgaccgg ctacggcccc gacgaggtgc tgggccacaa ctgccgcttc 120

ctgcagggcg agggcaccga ccccaaggag gtgcagaaga tccgcgacgc catcaagaag 180

ggcgaggcct gcagcgtgcg cctgctgaac taccgcaagg acggcacccc cttctggaac 240

ctgctgaccg tgacccccat caagaccccc gacggccgcg tgagcaagtt cgtgggcgtg 300

caggtggacg tgaccagcaa gacc 324

<210> 3

<211> 6994

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggtacccagc ttttgttccc tttagtgagg gttaattgcg cgcttggcgt aatcatggtc 60

atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca tacgagccgg 120

aagcataaag tgtaaagcct ggggtgccta atgagtgagc taactcacat taattgcgtt 180

gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt aatgaatcgg 240

ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct cgctcactga 300

ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat 360

acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca 420

aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc 480

tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata 540

aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc 600

gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc 660

acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga 720

accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc 780

ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag 840

gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag 900

gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag 960

ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca 1020

gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga 1080

cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat 1140

cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga 1200

gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg 1260

tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga 1320

gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc 1380

agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac 1440

tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc 1500

agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc 1560

gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc 1620

catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt 1680

ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc 1740

atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg 1800

tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag 1860

cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat 1920

cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc 1980

atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa 2040

aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta 2100

ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa 2160

aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacact aaattgtaag 2220

cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat tttttaacca 2280

ataggccgaa atcggcaaaa tcccttataa atcaaaagaa tagaccgaga tagggttgag 2340

tgttgttcca gtttggaaca agagtccact attaaagaac gtggactcca acgtcaaagg 2400

gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa ccatcaccct aatcaagttt 2460

tttggggtcg aggtgccgta aagcactaaa tcggaaccct aaagggagcc cccgatttag 2520

agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc 2580

gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc 2640

gcttaatgcg ccgctacagg gcgcgtccca ttcgccattc aggctgcgca actgttggga 2700

agggcgatcg gtgcgggcct cttcgctatt acgccagctg gcgaaagggg gatgtgctgc 2760

aaggcgatta agttgggtaa cgccagggtt ttcccagtca cgacgttgta aaacgacggc 2820

cagtgagcgc gcgtaatacg actcactata gggcgaattg gagctccacc gcggtggcgg 2880

ccgctctaga actagtggat cccacacacc tgcccgtctg cctgacagga agtgaacgca 2940

tgtcgaggga ggcctcacca atcgtcacac gagccctcgt cagaaacacg tctccgccac 3000

gctctccctc tcacggccga ccccgcagcc cttttgccct ttcctaggcc accgacagga 3060

cccaggcgct ctcagcatgc ctcaacaacc cgtactcgtg ccagcggtgc ccttgtgctg 3120

gtgatcgctt ggaagcgcat gcgaagacga aggggcggag caggcggcct ggctgttcga 3180

agggctcgcc gccagttcgg gtgcctttct ccacgcgcgc ctccacacct accgatgcgt 3240

gaaggcaggc aaatgctcat gtttgcccga actcggagtc cttaaaaagc cgcttcttgt 3300

cgtcgttccg agacatgtta gcagatcgca gtgccacctt tcctgacgcg ctcggcccca 3360

tattcggacg caattgtcat ttgtagcaca attggagcaa atctggcgag gcagtaggct 3420

tttaagttgc aaggcgagag agcaaagtgg gacgcggcgt gattattggt atttacgcga 3480

cggcccggcg cgttagcggc ccttccccca ggccagggac gattatgtat caatattgtt 3540

gcgttcgggc actcgtgcga gggctcctgc gggctgggga gggggatctg ggaattggag 3600

gtacgaccga gatggcttgc tcggggggag gtttcctcgc cgagcaagcc agggttaggt 3660

gttgcgctct tgactcgttg tgcattctag gaccccactg ctactcacaa caagccatat 3720

gactagtatg gccaggatgg ccaagctgac cagcgccgtg cccgtgctga ccgcccgcga 3780

cgtggccggc gccgtggagt tctggaccga ccgcctgggc ttcagccgcg acttcgtgga 3840

ggacgacttc gccggcgtgg tgcgcgacga cgtgaccctg ttcatcagcg ccgtgcagga 3900

ccaggtggtg cccgacaaca ccctggcctg ggtgtgggtg cgcggcctgg acgagctgta 3960

cgccgagtgg agcgaggtgg tgagcaccaa cttccgcgac gccagcggcc ccgccatgac 4020

cgagatcggc gagcagccct ggggccgcga gttcgccctg cgcgaccccg ccggcaactg 4080

cgtgcacttc gtggccgagg agcaggacac cggtcaccac caccaccacc accaccacca 4140

ccaccaccac gagaacctgt acttccaggg cacgcgtatg accttcgtgg tggccgacgc 4200

caccctgccc gactgccccc tggtgtacgc cagcgagggc ttctacgcca tgaccggcta 4260

cggccccgac gaggtgctgg gccacaactg ccgcttcctg cagggcgagg gcaccgaccc 4320

caaggaggtg cagaagatcc gcgacgccat caagaagggc gaggcctgca gcgtgcgcct 4380

gctgaactac cgcaaggacg gcaccccctt ctggaacctg ctgaccgtga cccccatcaa 4440

gacccccgac ggccgcgtga gcaagttcgt gggcgtgcag gtggacgtga ccagcaagac 4500

ctggagccac ccccagttcg agaagtaaga attctggcag cagctggacc gcctgtacca 4560

tggagaagag ctttacttgc cgggatggcc gatttcgctg attgatacgg gatcggagct 4620

cggaggcttt cgcgctaggg gctaggcgaa gggcagtggt gaccagggtc ggtgtggggt 4680

cggcccacgg tcaattagcc acaggaggat cagggggagg taggcacgtc gacttggttt 4740

gcgaccccgc agttttggcg gacgtgctgt tgtagatgtt agcgtgtgcg tgagccagtg 4800

gccaacgtgc cacacccatt gagaagacca accaacttac tggcaatatc tgccaatgcc 4860

atactgcatg taatggccag gccatgtgag agtttgccgt gcctgcgcgc gccccggggg 4920

cggggggggg acgggtgggg ggtagggggt ctcacgggaa cagcacgcta ggggtcaggg 4980

gggggggggg gcgcagttta gctgaccagc cgtgggatga tgcacgcatt tgcaaggaca 5040

gggtaatcac agcagcaaca tggtgggctt aggacagctg tgggtcagtg gacggacggc 5100

aggggaggga cggcgcagct cgggagacag ggggagacag cgtgactgtg cacatcaagc 5160

ttatcgatac cgtcgaccct cgagcgggga gctcgctgag gcttgacatg attggtgcgt 5220

atgtttgtat gaagctacag gactgatttg gcgggctatg agggcgcggg aagctctgga 5280

agggccgcga tggggcgcgc ggcgtccaga aggcgccata cggcccgctg gcggcaccca 5340

tccggtataa aagcccgcga ccccgaacgg tgacctccac tttcagcgac aaacgagcac 5400

ttatacatac gcgactattc tgccgctata cataaccact cagctagctt aagatcccat 5460

caagcttgca tgccgggcgc gccagaagga gcgcagccaa accaggatga tgtttgatgg 5520

ggtatttgag cacttgcaac ccttatccgg aagccccctg gcccacaaag gctaggcgcc 5580

aatgcaagca gttcgcatgc agcccctgga gcggtgccct cctgataaac cggccagggg 5640

gcctatgttc tttacttttt tacaagagaa gtcactcaac atcttaaaat ggccaggtga 5700

gtcgacgagc aagcccggcg gatcaggcag cgtgcttgca gatttgactt gcaacgcccg 5760

cattgtgtcg acgaaggctt ttggctcctc tgtcgctgtc tcaagcagca tctaaccctg 5820

cgtcgccgtt tccatttgca ggatggccac tccgccctcc ccggtgctga agaatttcga 5880

agcatggacg atgcgttgcg tgcactgcgg ggtcggtatc ccggttgtga gtgggttgtt 5940

gtggaggatg gggcctcggg ggctggtgtt tatcggcttc ggggtggtgg gcgggagttg 6000

tttgtcaagg tggcagctct gggggccggg gtgggcttgt tgggtgaggc tgagcggctg 6060

gtgtggttgg cggaggtggg gattcccgta cctcgtgttg tggagggtgg tggggacgag 6120

agggtcgcct ggttggtcac cgaagcggtt ccggggcgtc cggccagtgc gcggtggccg 6180

cgggagcagc ggctggacgt ggcggtggcg ctcgcggggc tcgctcgttc gctgcacgcg 6240

ctggactggg agcggtgtcc gttcgatcgc agtctcgcgg tgacggtgcc gcaggcggcc 6300

cgtgctgtcg ctgaagggag cgtcgacttg gaggatctgg acgaggagcg gaaggggtgg 6360

tcgggggagc ggcttctcgc cgagctggag cggactcggc ctgcggacga ggatctggcg 6420

gtttgccacg gtcacctgtg cccggacaac gtgctgctcg accctcgtac ctgcgaggtg 6480

accgggctga tcgacgtggg gcgggtcggc cgtgcggacc ggcactccga tctcgcgctg 6540

gtgctgcgcg agctggccca cgaggaggac ccgtggttcg ggccggagtg ttccgcggcg 6600

ttcctgcggg agtacgggcg cgggtgggat ggggcggtat cggaggaaaa gctggcgttt 6660

taccggctgt tggacgagtt cttctgaggg acctgatggt gttggtggct gggtagggtt 6720

gcgtcgcgtg ggtgacagca cagtgtggac gttgggatcc ccgctccgtg taaatggagg 6780

cgctcgttga tctgagcctt gccccctgac gaacggcggt ggatggaaga tactgctctc 6840

aagtgctgaa gcggtagctt agctccccgt ttcgtgctga tcagtctttt tcaacacgta 6900

aaaagcggag gagttttgca attttgttgg ttgtaacgat cctccgttga ttttggcctc 6960

tttctccatg ggcgggctgg gcgtatttga agcg 6994

<210> 4

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cccatatgac tagtatggcc aggatg 26

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gaccggtgtc ctgctcctcg 20

<210> 6

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgacgcgtat gaccttcgtg gtggc 25

<210> 7

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cggaattctt acttctcgaa ctgggggtgg ctccaggtct tgctggtca 49

Claims (6)

1. The chlamydomonas reinhardtii-based protein interaction analysis method is characterized by comprising the following specific steps of: the Sh ble and the target protein of the resistance gene are fused and expressed in Chlamydomonas reinhardtii, a flexible peptide section affinity Tag 12 XHis is inserted between the Sh ble and the target protein, a carboxyl section of the target protein is inserted into Strep II Tag, a positive clone strain screened by bleomycin is cultured in a large scale, and the target protein and related protein which interacts with the target protein are simultaneously purified by utilizing a Strep II Tag affinity column.

2. The analysis method according to claim 1, wherein the fusion expression method of the Sh ble resistance gene and the target protein in Chlamydomonas reinhardtii comprises the following steps: constructing a fusion expression vector of the Sh ble gene and the target protein, carrying out enzyme digestion linearization on the fusion expression vector, and transferring the linearized DNA into Chlamydomonas reinhardtii.

3. The assay of claim 1, wherein the target protein is the LOV1 domain.

4. The assay of claim 1, wherein the Chlamydomonas reinhardtii is a bleomycin-sensitive Chlamydomonas reinhardtii species.

5. The assay of claim 1, wherein the Chlamydomonas reinhardtii is a cell wall-deficient overexpression mutant strain UVM 4.

6. The analysis method according to claim 2, wherein the fusion expression method of the resistance gene Shble and the target protein in Chlamydomonas reinhardtii specifically comprises the following steps:

(1) PCR amplifying target protein DNA, using EcoRI and MluI to respectively enzyme-cut the target protein DNA fragment and the PCYX009 vector, and connecting through T4 ligase to obtain a vector inserted with target protein DNA-Strep II tag;

(2) respectively carrying out enzyme digestion on Sh ble and a vector inserted with the target protein DNA-Strep II tag by NdeI and AgeI, and connecting the Sh ble and the vector by T4 ligase to obtain an expression vector inserted with the Sh ble-target protein DNA-Strep II tag;

(3) using a fast-cutting enzyme KpnI to carry out enzyme digestion on the expression vector inserted with the Sh ble-target protein DNA-Strep II tag to obtain linear DNA;

(4) the linear DNA was transferred to Chlamydomonas reinhardtii and positive clones were screened using bleomycin.

Images