CN111848766A - Hyper-folding Venus yellow fluorescent protein and expression thereof in Chlamydomonas reinhardtii - Google Patents
Hyper-folding Venus yellow fluorescent protein and expression thereof in Chlamydomonas reinhardtii Download PDFInfo
- Publication number
- CN111848766A CN111848766A CN201910347575.3A CN201910347575A CN111848766A CN 111848766 A CN111848766 A CN 111848766A CN 201910347575 A CN201910347575 A CN 201910347575A CN 111848766 A CN111848766 A CN 111848766A
- Authority
- CN
- China
- Prior art keywords
- sfvyfp
- expression
- chlamydomonas reinhardtii
- recombinant plasmid
- fluorescent protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43595—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8209—Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
- C12N15/821—Non-antibiotic resistance markers, e.g. morphogenetic, metabolic markers
- C12N15/8212—Colour markers, e.g. beta-glucoronidase [GUS], green fluorescent protein [GFP], carotenoid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Abstract
The invention discloses a hyper-folding Venus yellow fluorescent protein and expression thereof in Chlamydomonas reinhardtii. The super-folding Venus yellow fluorescent protein also contains mutagenized amino acids of the Venus yellow fluorescent protein and the super-folding green fluorescent protein on the basis of the amino acid sequence of the green fluorescent protein, and the amino acid sequence is SEQ NO.1 of a sequence table. The expression quantity of the SfvYFP is about 1.5 times of that of venus YFP, the expression quantity of two SfvYFP in series connection is 1.2 times of that of single SfvYFP, and the expression quantity of three SfvYFP in series connection is 0.6 times of that of single SfvYFP, so that the SfvYFP and the target protein are subjected to fusion expression, transformed and integrated into the chlamydomonas reinhardtii nuclear genome, the expression quantity of the foreign protein can be improved, and the expression position of the foreign protein can be more conveniently positioned.
Description
Technical Field
The invention belongs to the technical field of protein expression, and relates to a hyper-folding Venus yellow fluorescent protein and expression thereof in a model organism single cell Chlamydomonas reinhardtii nuclear genome.
Background
Chlamydomonas reinhardtii (Chlamydomonas reinhardtii) is a eukaryotic, bi-flagellate, freshwater green alga, a model organism for studying various vital activities, such as photosynthesis, flagellar assembly, phototaxis and circadian rhythms. Chlamydomonas reinhardtii has many common characteristics with yeast cells, and the element is called "photosynthetic yeast". In addition, chlamydomonas reinhardtii is safe, low in culture cost, short in growth cycle and easy to culture, the whole genome sequencing work thereof has been completed, and genetic transformation systems for nuclear, chloroplast and mitochondrial genomes have also been relatively mature. Thus, Chlamydomonas reinhardtii has promise as a platform for the production of human and animal therapeutic proteins and industrial enzymes.
At present, Green Fluorescent Protein (GFP) has been widely used in the study of chlamydomonas reinhardtii, and not only a nuclear codon optimized gene (CrGFP) integrated into the nuclear genome but also a chloroplast codon optimized gene integrated into the chloroplast genome has been constructed. Although integration into the chloroplast genome and expression of GFP has several advantages over integration into the nuclear genome and expression of proteins, including higher protein accumulation which facilitates fluorescence detection and utilization, a disadvantage is that the proteins are always localized within the chloroplast. Therefore, many applications of Fluorescent Proteins (FP) cannot be realized, including labeling proteins that are not in chloroplasts, organelle labeling, nuclear promoter studies, and the like. However, the level of protein expression of foreign genes integrated into the chlamydomonas reinhardtii nuclear genome is very low, probably due to the presence of unusual epigenetic repressive behavior in the nuclear genome and/or the extremely compact chromosomal structure that does not allow for active transcription of the transgene. In addition, Chlamydomonas reinhardtii itself can produce a variety of high fluorescent pigments, such as chlorophyll and flavonoids, that interfere with the detection of GFP, which further complicates the problem of low GFP expression levels.
GFP can also be expressed as a fusion with endogenous genes. For example, GFP is expressed as a fusion with flagellin and can be successfully imaged in living cells by fluorescence microscopy. However, this often requires specialized live cell imaging techniques to overwhelm the autofluorescence produced by the cell bodies to detect the GFP signal. These techniques include the use of mosaic digital illumination systems to control the area of the illuminated sample, or confocal or total internal reflection fluorescence microscopy, but all require the attachment of flagella to the cover slip, placing the autofluorescent cell bodies outside the illumination area. GFP has also been expressed as a fusion with proteins of the cell body, for example, GFP is expressed as a fusion with the cytoplasmic membrane protein Rh 1. However, in order to overcome autofluorescence, it is necessary to use a white mutant strain of Chlamydomonas reinhardtii, which is obtained by blocking the first step of carotenoid biosynthesis.
Nevertheless, stable expression of monomeric FP and FP fusion proteins in the Chlamydomonas reinhardtii nuclear genome has met with some success. The Venus Yellow Fluorescent Protein (venus YFP, venus Yellow Fluorescent Protein) or CrGFP and an antibiotic resistance gene APH VIII are put into the same plasmid pJR39 or pJR38, expression is started by different promoters, and termination is ended by different terminators respectively, and both the venus YFP and the APH VIII can be stably expressed in Chlamydomonas reinhardtii mutant strain UVM4 or UVM 11. The antibiotic resistance gene APH VIII acts by drug isolation rather than enzyme inactivation, is resistant to both paromomycin and kanamycin, and a single clone of the transformant can be picked up on a plate containing these antibiotics. UVM4 and UVM11 are mutagenized strains which overexpress foreign proteins and are obtained by subjecting cell wall-deficient Chlamydomonas reinhardtii cw15 to ultraviolet mutagenesis. In addition, FP and antibiotic resistance gene sh-ble are fused and expressed, and the protein is positioned in cell nucleus. The antibiotic resistance gene sh-ble is resistant to bleomycin and is a good fusion partner because high levels of protein expression are required to survive the antibiotic selection process. In addition, insertion of self-splicing 2A peptide fragments from foot-and-mouth disease virus (FMDV) between sh-ble and FP can aggregate unfused, untargeted monomeric FP (red mCherry, orange tdTomato, yellow venus, green CrGFP, cyan mcerulen, or blue mTagBFP). Research has shown that FMDV 2A peptide can undergo efficient self-cleavage in Chlamydomonas reinhardtii, and thus ble-2A expression vectors can achieve high levels of CrGFP accumulation, about 0.25% of Soluble whole Proteins (TSPs), and fluorescence can be detected under a live cell microscope. The fluorescence intensity of CrGFP is minimal due to its low signal-to-noise ratio, while FP (venus, tdTomato and mCherry) with longer emission wavelength has a higher signal-to-noise ratio and a stronger fluorescence intensity.
So far, although the use of FP in the field of microalgae is gradually expanding, the very low protein expression level of foreign genes integrated into the nuclear genome and the very high autofluorescence such as chlamydomonas reinhardtii still hinder the further use of FP in the field of microalgae.
Disclosure of Invention
The invention provides a novel reporter gene for chlamydomonas reinhardtii nuclear genome transformation, which is a superfolder Venus Yellow fluorescent protein (SfvYFP, superfolder Yellow fluorescent protein) containing 16 mutagenic amino acids, is optimized by 100 percent aiming at the codon preference of the chlamydomonas reinhardtii nuclear genome, constructs plasmids containing single, two and three superfolder Venus Yellow fluorescent proteins in series respectively, and is respectively transferred and integrated into the chlamydomonas reinhardtii nuclear genome to carry out protein expression.
The technical scheme of the invention is as follows:
the Superfolder yellow fluorescent protein SfvYFP of the invention changes 16 amino acids on the basis of the original GFP amino acid sequence, namely, on the basis of 9 mutagenic amino acids F46L, F64L, S65G, V68L, S72L, M153L, V163L, S175L and T203L of venus YFP, 7 mutagenic amino acids S30L, Y39L, F99L, N105L, Y145L, I171L and A206L from Superfolder GFP are added, namely, S30L, Y39L, F46L, F64L, S65L, V68L, S72L, F99L, N105L, Y36145, M153, V163L, I171L, S175L, T175A L and A206 are respectively shown in a sequence table No. 1.
The invention also provides a gene sequence of the super-folding Venus yellow fluorescent protein SfvYFP, which is optimized by 100 percent aiming at the codon preference of a chlamydomonas reinhardtii nuclear genome, and the nucleotide sequence of the gene sequence is shown as a sequence table SEQ NO. 2.
The invention further provides a recombinant plasmid containing a single SfvYFP, two SfvYFP in series and three SfvYFP in series, wherein the two SfvYFP in series are connected by two glycine GGCGGC.
As a specific embodiment of the invention, the recombinant plasmid containing single SfvYFP is pCYX003 with the nucleotide sequence shown in a sequence table SEQ NO. 11.
As a specific embodiment of the invention, the recombinant plasmid containing two SfvYFP in series is pCYX004 with the nucleotide sequence shown in a sequence table SEQ NO. 14.
As a specific embodiment of the invention, the recombinant plasmid containing three SfvYFP in series is pCYX006 with the nucleotide sequence shown in SEQ NO.17 of the sequence table.
Furthermore, the invention provides the expression of the single SfvYFP, the two tandem SfvYFP or the three tandem SfvYFP in the Chlamydomonas reinhardtii, a single digestion linearization Reaction is carried out on plasmids containing the single SfvYFP, the two tandem SfvYFP or the three tandem SfvYFP, the plasmids containing the single SfvYFP, the two tandem SfvYFP or the three tandem SfvYFP are transferred into the Chlamydomonas reinhardtii and integrated into a nuclear genome, transformants are picked to carry out an algal-colony Polymerase Chain Reaction (PCR) and an algal-colony western blotting Reaction (WesternBlotting), and positive transformants with stable expression are obtained by screening.
Preferably, the plasmid vector may also contain a selectable marker such as ble or aphviii, which is expressed by a separate promoter and terminated by a separate terminator.
Preferably, the plasmid vector containing the antibiotic resistance gene ble or aphviii and its promoter and terminator may also be co-transformed with a plasmid containing a single sfyfp, two tandem sfyfps and three tandem sfyfps and integrated into a chlamydomonas reinhardtii strain.
Compared with the prior art, the invention has the following advantages:
under otherwise identical conditions, the protein yield of sfyfp of the invention in chlamydomonas reinhardtii nuclear genome is about 1.5 times that of venus yellow fluorescent protein (venussyfp); the protein yield of two tandem sfyfps was about 1.2 times that of a single sfyfp, while the expression level of three tandem sfyfps was about 0.6 times that of a single sfyfp. Therefore, the two SfvYFP in series are fused with the target protein for expression, transformed and integrated into the Chlamydomonas reinhardtii nuclear genome, so that the expression level of the foreign protein can be improved, and the expression position of the foreign protein can be more conveniently positioned. In addition, the invention also discovers that the Chlamydomonas reinhardtii nuclear genome has an N-terminal rule, namely, the N-terminal added amino acid of SfvYFP has the influence on the up-regulation or down-regulation of the expression level of SfvYFP.
Drawings
FIG. 1 is a schematic representation of GFP, YFP, venus YFP, Superfolder GFP and SfvYFP. YFP contains 1 mutagenic amino acid T203Y compared to GFP; venus YFP contains 9 mutagenic amino acids, F46L, F64L, S65G, V68L, S72A, M153T, V163A, S175G and T203Y; superfolder GFP contains 11 mutagenized amino acids, S30R, Y39N, F64L, S65T, F99S, N105T, Y145F, M153T, V163A, I171V, and a206V, respectively; SfvYFP contains 16 mutagenized amino acids, S30R, Y39N, F46L, F64L, S65G, V68L, S72A, F99S, N105T, Y145F, M153T, V163A, I171V, S175G, T203Y and a 206V. 50aa (amino acids) are to scale.
FIG. 2 is a line graph showing the Relative Codon optimization (RCA) of venus YFP and SfvYFP as compared to the Codon bias of Chlamydomonas reinhardtii nuclear genome.
FIG. 3 is a schematic representation of plasmids pJR39(venus YFP) and pCYX005 (SfvYFP).
FIG. 4 is a schematic representation of plasmids pCYX003(1SfvYFP), pCYX004(2SfvYFP) and pCYX006(3 SfvYFP).
FIG. 5 is a comparison of the protein expression levels of venus YFP (pJR39) and SfvYFP (pCYX005) in Chlamydomonas reinhardtii overexpression mutant strain UVM 4.
FIG. 6 shows a comparison of protein expression levels of 1SfvYFP (pCYX003), 2SfvYFP (pCYX004) and 3SfvYFP (pCYX006) in Chlamydomonas reinhardtii overexpression mutant strain UVM 4.
FIG. 7 is a comparison of the protein expression levels of SfvYFP in two different plasmid vectors pCYX005 and pCYX003 in Chlamydomonas reinhardtii overexpression mutant strain UVM 4.
Detailed Description
The invention will be explained in more detail below with reference to specific examples and figures and the accompanying tables, without however restricting the scope of protection of the invention to the examples.
1. Chlamydomonas reinhardtii strain and culture conditions
The recipient strain selected in the invention is Chlamydomonas reinhardtii cell wall defect type overexpression mutant strain UVM 4. UVM4 was originally derived from a cell wall-deficient and arginine auxotrophic algal strain CW15-302(cwd mt)+arg 7). Firstly, an emetine resistance gene CRY1-1 (plasmid pCRY1-1) and an arginine prototrophy providing gene ARG7 (plasmid pCB412) are co-transformed into an algal strain CW15-302, and the algal strain Elow47 is obtained by drug emetine screening; then, ultraviolet light induced mutation was performed on Elow 47; then, selecting mutagenic strains with improved drug resistance, namely candidate strains, by ipecac screening again; finally, other plasmids pJR38(CrGFP), pJR39(venus YFP) and pJR40(CrGFP) are transformed into candidate strains, and the candidate strains over expressing the foreign genes are the target alga strains, namely UVM 4.
The original algal species in this laboratory were stored on YA (Yeast-Acetate, Yeast-acetic acid) solid plates at 22 ℃ with illumination parameters of 16h white light/8 h dark. In the experiment, the algae strain in the solid YA culture medium is inoculated into liquid TAP (Tris-Acetate-Phosphate, Tris alkali-Acetate-Phosphate) for shaking culture, and the culture parameters are as follows: 16h Red blue (50% Red + 50% blue)/8 h dark, 120rpm, 22 ℃.
2. Preparation of competent cells of Escherichia coli
The competent cell used for molecular cloning in this experiment was E.coli DH5 alpha. Firstly, selecting a single clone of Escherichia coli DH5 alpha, streaking and inoculating on a non-resistant LB (Lysogeny Broth) plate, and culturing at 37 ℃ for 12 h; then, a single clone was picked from the non-anti LB plate and inoculated into LB or SOB (Super Optimal Broth) culture medium, cultured at 37 ℃ and 180rpm for 12 hours; then, 125. mu.l to 50ml of LB or SOB culture medium was inoculated at a ratio of 1:400, and cultured at 37 ℃ and 180rpm for 3 hours (OD in this case)578Value between 0.3 and 0.7A), OD is adjusted578The bacterial solution with the reached value is placed on ice. Subpackaging the bacterial solution with 50ml centrifuge tube, centrifuging at 4 deg.C and 4000rpm for 7min, removing supernatantAnd adding 15ml of T into the precipitated strainfBI buffer (30mM KAc, 100mM KCl, 50mM MnCl)2·2H20, 15% glycerol, adjusting pH to 5.8 with HAc, filtering with 0.22 μm filter membrane for sterilization, storing at 4 deg.C), and incubating for 10 min; then centrifuged at 4000rpm for 5min at 4 ℃ to remove the supernatant and the pellet resuspended in 2ml of TfBII buffer (6.57mM MoPS, 5mM KCl, 37.48mM CaCl)27.5% glycerol, pH adjusted to 7.0 with NaOH, filter sterilized with a 0.22 μm filter, stored at 4 ℃). The bacterial suspension was then aliquoted in 80. mu.l portions and rapidly cooled in liquid nitrogen and stored frozen at-80 ℃.
3. Construction of transformation vectors
The high fidelity DNA polymerase, fast cutter and T4DNA ligase used in constructing the plasmid vector were purchased from Saimer Feishil science and technology (Thermo Fisher), and the kits used, such as AxyPrep plasmid DNA small quantity extraction kit, AxyPrepDNA gel recovery kit and AxyPrep PCR cleaning kit, were purchased from Corning Life sciences (Wu Jiang) Co.
First, the codon of SfvYFP (see FIG. 1, sequence listing SEQ NO.1) was designed to be 100% corresponding to the codon preference of Chlamydomonas reinhardtii nuclear genome (examined in web pages http:// www.kazusa.or.jp/codon /) (see sequence listing NO. 2). As shown in fig. 2, the x-axis indicates the codon positions of venus YFP and sfyfp, both of which contain 239 codons, respectively; the y-axis represents the degree of nuclear codon optimization.
pBluescript II SK (+) is used as a vector, SmaI and pstI are respectively used as enzyme cutting sites of 5 'end and 3' end of SfvYFP, and the plasmid pCYX001(SfvYFP) is synthesized by one Biotech company Limited in Nanjing (as shown in a sequence table NO. 3).
TABLE 1 primers
Note: the restriction sites Bsm I, Nco I, EcoR I, Nde I, Mlu I, BamH I, Apa I and Cla I are underlined, the start codon ATG and the stop codon TAA are bolded, and the positions of the plasmids and primers in the sequence listing are indicated by parentheses.
Primers CYX013 and CYX014 (shown in Table 1, sequence listing SEQ NO.8 and NO.9) were designed, plasmid pCYX001(SfvYFP) was used as a template, and SfvYFP target fragment was PCR-amplified using high fidelity DNA polymerase, wherein the annealing temperature was 60.8-67.1 ℃ and the extension time at 72.0 ℃ was 23s for 32 cycles. The AxyPrep DNA gel recovery kit is used for gel cutting recovery, and 25 mu l of A with the concentration of 62.051 ng/mu l is obtained260/280The PCR product was 1.84. Then, the small fragment was digested with the fast-cutting enzymes Bsm I and EcoRI for 1-2h at 37 ℃ and recovered by PCR clean-up using AxyPrep PCR clean-up kit to obtain 25. mu.l of A with a concentration of 12.734 ng/. mu.l260/280The product is a double-enzyme digestion product of 2.08, and is stored at minus 20 ℃ for later use. Cutting plasmid vector pJR39 (containing paromomycin resistance gene APH VIII, as shown in sequence table SEQINO. 4) with fast cutting enzyme Bsm I and EcoRI, reacting at 37 deg.C for 1-2h, recovering gel to obtain 25 μ l with concentration of 121.739ng/μ l, A260/280The vector fragment was 1.87 and stored at-20 ℃ until use. T4DNA ligase, small fragments SfvYFP stored at-20 ℃ and carrier fragments are used, an enzyme linked system is designed according to the instruction (the mol ratio of the small fragments to the carrier is 4:1-9:1), and the enzyme linked product pCYX005(SfvYFP) is obtained after reaction for 2h at 22 ℃ (such as a sequence table SEQNO. 7).
As shown in FIG. 3, plasmid pJR39 contains the reporter gene venus YFP, plasmid pCYX005 contains SfvYFP, both venus YFP and SfvYFP are P PSADInitiation of expression, TPSADAnd (6) terminating. Antibiotic resistance gene APH VIII as marker gene, PHSP70And PRBCS2Initiation of expression, TRBCS2Intron is an Intron. Bsm I, EcoR I and Kpn I are the restriction sites. 1kb is scale bar.
Primers CYX009 and CYX010 (shown in Table 1, sequence listing SEQ NO.12 and SEQ NO.13) were designed, and plasmid pCYX001(SfvYFP) was used as a template for PCR amplification to obtain a target fragment of SfvYFP, wherein the annealing temperature was 60.8-67.1 ℃, the extension time at 72.0 ℃ was 23s, and the total cycle time was 32 cycles. The gel was recovered to give 25. mu.l of 53.198 ng/. mu.l, A260/280The PCR product was 1.79. Then, the small fragment was digested with fast-cutting enzymes Nde I and BamH I at 37 ℃ for 1-2h, PCR was performed to obtain 25. mu.l, A with a concentration of 25.631 ng/. mu.l260/280The product was cleaved at-20 ℃ and stored at 2.22 ℃. By usingFast-cutting enzyme Nde I and BamH I enzyme digestion vector pCM013 (unpublished, self-made in laboratories, such as sequence table SEQINO. 10, containing bleomycin resistance gene ble) reacts for 1-2h at 37 ℃, and 25 mul of gel with the concentration of 37.574 ng/mul and A is recovered260/280The vector fragment at-1.77 was stored at-20 ℃ until use. T4DNA ligase, small fragments SfvYFP preserved at-20 ℃ and vector fragments are used for reaction at 22 ℃ for 2h to obtain an enzyme-linked product pCYX003(1SfvYFP) (shown as a sequence table SEQINO. 11).
Primers CYX011 and CYX012 (shown in Table 1, sequence listing SEQNO.15 and NO.16) are designed, and plasmid pCYX001(SfvYFP) is used as a template for PCR amplification to obtain a SfvYFP target fragment, wherein the annealing temperature is 60.1-64.5 ℃, the extension time at 72.0 ℃ is 23s, and 32 cycles are total. The gel was recovered to give 25. mu.l of 55.103 ng/. mu.l, A260/280The PCR product was 1.93. Then, the small fragment was digested with fast-cutting enzymes Nde I and Mlu I for 1-2h at 37 ℃ and cleaned by PCR to obtain 25. mu.l, A, with a concentration of 39.732 ng/. mu.l260/280The product was 1.98 digested at-20 ℃ for further use. The vector pCYX003(1SfvYFP) was digested with fast-cutting enzymes Nde I and Mlu I, reacted at 37 ℃ for 1-2 hours, and recovered on gel to give 25. mu.l of A with a concentration of 26.977 ng/. mu.l260/280The vector fragment was 1.80, and stored at-20 ℃ until use. T4DNA ligase, small fragments SfvYFP stored at-20 ℃ and a vector fragment are used for reaction at 22 ℃ for 2h to obtain an enzyme-linked product pCYX004(2SfvYFP) (shown as a sequence table SEQ NO. 14).
Primers CYX015 and CYX016 (shown in Table 1, SEQ ID NO.18 and SEQ ID NO.19 of the sequence Listing) are designed, and plasmid pCYX001(SfvYFP) is used as a template for PCR amplification to obtain a target SfvYFP fragment, wherein the annealing temperature is 66.1-71.0 ℃, the extension time at 72.0 ℃ is 23s, and 32 cycles are total. The gel was recovered to give 25. mu.l of 64.771 ng/. mu.l, A 260/280The PCR product was 2.03. The small fragment was then digested with fast-cutting enzymes Nde I and Apa I for 1-2h at 37 ℃ and cleaned by PCR to 25. mu.l, A at a concentration of 20.659 ng/. mu.l260/280The product was 1.81 and stored at-20 ℃ until use. The vector pCYX004(2SfvYFP) is digested by fast cutting enzymes Nde I and Apa I and reacted for 1-2h at 37 ℃, and 25 mul of gel with the concentration of 20.306 ng/mul and A is recovered260/280The vector fragment was 2.24 and stored at-20 ℃ until use. Using T4DNA ligase, -small fragment SfvYFP preserved at 20 ℃ and carrier fragment, and reacting for 2h at 22 ℃ to obtain the target productAnd an enzyme linked product pCYX006(3SfvYFP) (shown as a sequence table SEQ NO. 17).
As shown in fig. 4, plasmid pCYX003 contains one sfyfp, plasmid pCYX004 contains two identical tandem sfyfps, and plasmid pCYX006 contains three identical tandem sfyfps. Every two SfvYFP are connected by two glycin (GGCGGC), and each nSfvYFP is PPSADInitiation of expression, TPSADAnd (6) terminating. Antibiotic resistance gene ble is a marker gene consisting of PHSP70And PRBCS2Initiation of expression, TRBCS2Intron is an Intron. Kpn I, EcoR I, Nde I, Cla I, Apa I, Mlu I, BamH I, and Not I are all cleavage sites. 1kb is scale bar.
4. Transformation of E.coli
Mu.l of 4 ligation products pCYX005(SfvYFP), pCYX003(1SfvYFP), pCYX004(2SfvYFP) and pCYX006(3SfvYFP) were added to 4 different 80. mu.l E.coli competent DH 5. alpha. (-80 ℃ preservation), incubated on ice for 30min, heat-shocked at 42 ℃ for 90s, incubated on ice for 2min, added with 700. mu.l LB medium and incubated at 37 ℃ and 180rpm for 30-60 min. Centrifugation was carried out at 7000rpm for 1min, and 100. mu.l of the supernatant was retained, and the remainder was discarded, and the ligation product was sufficiently suspended and spread on an LB plate containing 100. mu.g/ml Amp (Ampcilin, ampicillin, stock concentration of 100mg/ml) resistance and cultured at 37 ℃ for 8-12 h.
5. Colony PCR screening, plasmid enzyme digestion verification and sequencing verification
Single clones on Amp resistant LB plates were picked and colony PCR screening was performed using Tag polymerase (purified in this laboratory), similar to the commercial Tag polymerase. Among them, for the Escherichia coli colony PCR transferred with plasmid pCYX005(SfvYFP) or pCYX003(1SfvYFP) (for the Escherichia coli transferred with plasmid pCYX004(2SfvYFP) or pCYX006(3SfvYFP), the colony PCR could not be used for screening because one or two SfvYFP existed in the plasmid vector), the annealing temperature was 60.8-67.1 ℃, and the extension time at 72.0 ℃ was 45 s. PCR products were run on a 1% agarose gel, run on a DL 5000 DNA Marker at 100V/m for 35min, observed using a Tanon instrument and photographed.
Then, for Escherichia coli into which plasmids pCYX005(SfvYFP) and pCYX003(1SfvYFP) had been transferred, positive single clones obtained by colony PCR were picked up in LB medium containing 100. mu.g/ml Amp; in the case of E.coli which had been transformed with plasmids pCYX004(2SfvYFP) and pCYX006(3SfvYFP), some single clones were picked up separately in LB medium containing 100. mu.g/ml Amp. Culturing at 37 ℃ overnight for 12-16h, extracting plasmids by using an AxyPrep plasmid DNA miniprep kit, and then performing single-enzyme digestion and double-enzyme digestion verification by using fast-cutting enzymes Bsm I, EcoR I, Nde I, Mlu I, BamH I, Apa I and the like.
Finally, the correct plasmids pCYX005(SfvYFP), pCYX003(1SfvYFP), pCYX004(2SfvYFP) and pCYX006(3SfvYFP) for enzyme digestion verification were submitted to the Biotech Limited company of Nanjing Ongkogaceae for sequencing verification.
6. Chlamydomonas reinhardtii pearl mill conversion
The plasmid pJR39(venus YFP), pCYX005(SfvYFP), pCYX003(1SfvYFP), pCYX004(2SfvYFP) and pCYX006(3SfvYFP) are respectively subjected to single digestion reaction by using fast cutter KpnI, 300-400ng of linearized plasmid is taken and DNA gel is run, and after the digestion result is correct, the rest linearized plasmids are placed into a refrigerator at the temperature of-20 ℃ for storage and standby.
50ml of UVM4 algal broth was cultured in TAP medium in 125ml Erlenmeyer flasks and each plasmid was transformed by 4 bead mills simultaneously. When Chlamydomonas reinhardtii grows to logarithmic growth phase (OD)6000.8-1.0), placing into a 50ml centrifuge tube, centrifuging at room temperature and 1350rcf for 5min, discarding the supernatant, and fully suspending with the unspent TAP. 2. mu.g of linearized DNA, 100. mu.l of 20% PEG (Polyethylene glycol) and a well-suspended algae suspension (total volume not exceeding 300. mu.l) are added to a 2ml centrifuge tube containing 300mg of glass beads with radius of 0.6-0.8. mu.m, treated with HCl. Maximum shaking vortex 15s, transferred to 50ml fresh TAP, incubated for 12-18h at 22 ℃ in the dark at 120 rpm. The resulting mixture was centrifuged at 1350rcf at room temperature for 7min, the supernatant was discarded, and after sufficiently and uniformly suspending the mixture with the remaining TAP, the algal solution into which the plasmids pJR39(venus YFP) and pCYX005(SfvYFP) had been transferred was spread on a TAP plate containing 10. mu.g/ml paromomycin, and the plasmids into which the plasmids pCYX003(1SfvYFP), pCYX004(2SfvYFP) and pCYX006(3SfvYFP) had been transferred on a TAP plate containing 10. mu.g/ml bleomycin. After culturing at 22 deg.C under illumination for 1-2 weeks, transformation occurs The strain appeared singly.
7. Algal colony PCR screening
For each transformed plasmid 16-32 single clones were picked from four plates onto fresh TAP plates containing 10. mu.g/ml paromomycin or bleomycin for one week of culture. Then, the algae were picked and dropped to 50. mu.l of 10mM Na2EDTA solution (pH 8.0) was suspended uniformly. Incubating at 100 deg.C for 10-20min, incubating at 4 deg.C for 1min, suspending, and centrifuging at 12500 rcf for 1 min. Mu.l of the supernatant was added to 20. mu.l of a PCR reaction using the primer pairs CM029 and CM030 (see SEQ ID NO.5 and NO.6 of the sequence Listing), CYX013 and CYX014, CYX009 and CYX010, CYX011 and CYX012, CYX015 and CYX016, respectively, and 4. mu.l of 5 × CES (2.7M betaine, 6.7mM dimercaptothreitol, 6.7% dimethyl sulfoxide, 55. mu.g/ml bovine serum albumin) was added to the PCR reaction. Wherein the annealing temperature of the transferred plasmid pJR39(venus YFP) was 59.3 ℃, the annealing temperature of pCYX005(SfvYFP) or pCYX003(1SfvYFP) was 60.8 to 67.1 ℃, the annealing temperature of the transferred plasmid pCYX004(2SfvYFP) was 60.1 to 64.5 ℃, the annealing temperature of the transferred plasmid pCYX006(3SfvYFP) was 66.1 to 71.0 ℃, and the extension time at 72 ℃ was 45 s. Although the algal colony PCR is convenient to operate, the nuclear genome PCR is not accurate, only can the fact that plasmids are transferred into certain monoclonals be roughly seen, the negative monoclonals are probably false negative, and the positive monoclonals cannot necessarily express the foreign proteins at a high level due to the position effect.
8. Western Blotting of algae colonies
Transformation with TAP to logarithmic growth phase (OD)6000.8-1.0), 4ml of algae solution is taken, centrifuged for 1min at room temperature at 12500 rcf, and the supernatant is discarded. To the pellet was added 250 μ l PBS and 250 μ l2 × sample buffer (250mM Tris-HCl pH 6.8, 25% glycerol, 0.01% bromophenol blue, 0.05% β -mercaptoethanol) and suspended homogeneously. Denaturation at 95 ℃ for 10min, incubation at 4 ℃ for 1min, centrifugation at 4 ℃ at 12500 rcf for 10min, and taking 15-20. mu.l of supernatant to spot on 10%, 12% or 15% SDS-PAGE. Positive control was the venus yfp +12 His tag induced by e.coli BL21 and purified. It was diluted to 10000-100000 times with 2 Xsample buffer and PBS, denatured at 65 ℃ for 5min, and then 15-20. mu.l was loaded.
Two pieces of SDS-PAGE gel are taken to assemble an electrophoresis device, SDS electrophoresis liquid (25mM Tris alkali, 192mM glycine and 3.48mM SDS) is filled in the electrophoresis device, gel is run at constant voltage of 90V in a refrigerator at 4 ℃, and after the sample runs out of accumulation gel and Protein markers (Protein markers) are dispersed, the voltage is adjusted to be 180V at 120 ℃. And waiting until the Protein marker is in a proper position, and turning off the power supply. SDS-PAGE gels were removed from the electrophoresis apparatus and the stacking gel excised, one for Western Blotting validation and the other for quantitative counterstaining. SDS-PAGE gel for Western Blotting is wrapped in a sponge pad + thick filter paper + thin filter paper + gel + NC membrane + thin filter paper + thick filter paper + sponge pad sequence, put into a membrane transferring device, filled with membrane transferring solution (25mM Tris alkali, 192mM glycine, 3.48mM SDS, 20% methanol), and subjected to constant flow 300mA membrane transferring for 60-90min in a refrigerator at 4 ℃. The NC membrane was placed in a plastic capsule, washed with TBST (20mM Tris base-HCl pH 7.5,100mM NaCl, 0.1% Tween-20) for 30s, and then incubated with fresh 5% skim milk powder on a destaining shaker at 20rpm for 90min at ambient temperature. Skim milk was poured out, primary antibody (diluted 1: 4000) was added and incubated overnight at 4 ℃. Primary antibody was recovered and washed 5 times with TBST at 5min intervals and 40 rpm. Secondary antibody (diluted 1: 4000) was added and incubated at room temperature at 20rpm for 90 min. The secondary antibody was recovered and washed 5 times with TBST at 5min intervals and 40 rpm. 300. mu.l of ECL (Electrochemiluminescence, 150. mu.l of white bottle, 150. mu.l of black bottle) developer was uniformly spread on the NC film, and photographed.
Putting another piece of SDS-PAGE gel for quantitative staining into a glass bowl, pouring about 200ml staining solution (10% koog-250, 50% methanol or ethanol, 10% acetic acid), heating with a microwave oven for 2min, oscillating at room temperature and 20rpm for 90min, and pouring out the staining solution. About 200ml of destaining solution (50% methanol or ethanol, 10% acetic acid) is poured in, and the destaining solution is poured out after shaking at normal temperature and 40rpm for 60 min. About 200ml of secondary water was poured, shaken at 40rpm at room temperature for 60-90min, observed and photographed.
As shown in FIG. 5, the upper panel is a Western Blotting image of algae, the exposure time is 1s, and the lower panel is a quantitative staining image made simultaneously. Venus YFP +12 His purified from E.coli BL21 was used as a positive control, 28.9kDa in size and 1.43ng in amount. Two chlamydomonas reinhardtii transformants successfully transformed and integrated with plasmids pCYX005(SfvYFP) and pJR39(venus YFP) were picked respectively for comparison of protein expression amounts, and both venus YFP and SfvYFP were 26.9kDa in size. Protein marker was used.
As shown in FIG. 6, the upper panel is a Western Blotting image of algae, the exposure time is 30s, and the lower panel is a quantitative staining image made simultaneously. Venus YFP +12 His purified from E.coli BL21 was used as a positive control, 28.9kDa in size and 0.54ng in amount. Three Chlamydomonas reinhardtii transformants transformed with plasmid pCYX003(1SfvYFP), two plasmids pCYX004(2SfvYFP) and three plasmids pCYX006(3SfvYFP) were picked up for comparison of protein expression amounts, and the sizes of 1SfvYFP, 2SfvYFP and 3SfvYFP were 26.9kDa, 54.2kDa and 81.6kDa, respectively. Proteinmarker was used.
As shown in FIG. 7, the upper panel is a Western Blotting image of algae, the exposure time is 30s, and the lower panel is a quantitative staining image made simultaneously. Venus YFP +12 His purified from E.coli BL21 was used as a positive control, 28.9kDa in size and 1.79ng in amount. Two Chlamydomonas reinhardtii transformants successfully transformed and integrated with plasmids pCYX005(SfvYFP) and pCYX003(1SfvYFP), respectively, were picked up for comparison of protein expression amounts, and the size of SfvYFP was 26.9 kDa. Proteinmarker was used.
TABLE 2
aThe brightness of SfvYFP expressed in plasmid pCYX005 was taken as a reference of 100.0.
Table 2 shows the expression of plasmids pJR39(venus YFP), pCYX005(SfvYFP), pCYX003(1SfvYFP), pCYX004(2SfvYFP) and pCYX006(3SfvYFP) after transfer into Chlamydomonas reinhardtii over-expression mutant strain UVM 4. As shown in the table, the plasmids pJR39(venus YFP), pCYX005(SfvYFP), pCYX003(1SfvYFP), pCYX004(2SfvYFP) and pCYX006(3SfvYFP) which were introduced into the Chlamydomonas reinhardtii overexpression mutant were compared in detail in terms of the length of the target gene, the degree of optimization of relative codon, the relative brightness, and the positive strain. The invention discovers that the difficulty of screening single SfvYFP successfully expressed is lower, the labor capacity is less, the difficulty of screening two Chlamydomonas reinhardtii positive transformants which are connected in series with SfvYFP or three SfvYFP in series is higher, and the labor capacity is larger.
Sequence listing
<110> Nanjing university of science and technology
<120> hyper-folding Venus yellow fluorescent protein and expression thereof in Chlamydomonas reinhardtii
<160>19
<170>SIPOSequenceListing 1.0
<210>1
<211>238
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>1
Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val
1 5 10 15
Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Arg Gly Glu
20 25 30
Gly Glu Gly Asp Ala Thr Asn Gly Lys Leu Thr Leu Lys Leu Ile Cys
35 4045
Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu
50 55 60
Gly Tyr Gly Leu Gln Cys Phe Ala Arg Tyr Pro Asp His Met Lys Arg
65 70 75 80
His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg
85 90 95
Thr Ile Ser Phe Lys Asp Asp Gly Thr Tyr Lys Thr Arg Ala Glu Val
100 105 110
Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile
115 120 125
Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn
130 135 140
Phe Asn Ser His Asn Val Tyr Ile Thr Ala Asp Lys Gln Lys Asn Gly
145 150 155 160
Ile Lys Ala Asn Phe Lys Ile Arg His Asn Val Glu Asp Gly Gly Val
165 170 175
Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro
180 185 190
Val Leu Leu Pro Asp Asn His Tyr Leu Ser Tyr Gln Ser Val Leu Ser
195 200 205
Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val
210 215 220
Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys
225 230 235
<210>2
<211>717
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
atggtgagca agggcgagga gctgttcacc ggcgtggtgc ccatcctggt ggagctggac 60
ggcgacgtga acggccacaa gttcagcgtg cgcggcgagg gcgagggcga cgccaccaac 120
ggcaagctga ccctgaagct gatctgcacc accggcaagc tgcccgtgcc ctggcccacc 180
ctggtgacca ccctgggcta cggcctgcag tgcttcgccc gctaccccga ccacatgaag 240
cgccacgact tcttcaagag cgccatgccc gagggctacg tgcaggagcg caccatcagc 300
ttcaaggacg acggcaccta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360
gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctgggccac 420
aagctggagt acaacttcaa cagccacaac gtgtacatca ccgccgacaa gcagaagaac 480
ggcatcaagg ccaacttcaa gatccgccac aacgtggagg acggcggcgt gcagctggcc 540
gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600
tacctgagct accagagcgt gctgagcaag gaccccaacg agaagcgcga ccacatggtg 660
ctgctggagt tcgtgaccgc cgccggcatc acccacggca tggacgagct gtacaag 717
<210>3
<211>3687
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt 60
caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa 120
ggaagagtat gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt 180
gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt 240
tgggtgcacg agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt 300
ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg 360
tattatcccg tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga 420
atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa 480
gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga 540
caacgatcgg aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa 600
ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca 660
ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta 720
ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac 780
ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc 840
gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag 900
ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga 960
taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca tatatacttt 1020
agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata 1080
atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag 1140
aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa 1200
caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt 1260
ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc 1320
cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa 1380
tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa 1440
gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc 1500
ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa 1560
gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa 1620
caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg 1680
ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc 1740
tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg 1800
ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg 1860
agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg 1920
aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat 1980
gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg 2040
tgagttagct cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt 2100
tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg 2160
ccaagcgcgc aattaaccct cactaaaggg aacaaaagct ggagctccac cgcggtggcg 2220
gccgctctag aactagtgga tcccccggga tggtgagcaa gggcgaggag ctgttcaccg 2280
gcgtggtgcc catcctggtg gagctggacg gcgacgtgaa cggccacaag ttcagcgtgc 2340
gcggcgaggg cgagggcgac gccaccaacg gcaagctgac cctgaagctg atctgcacca 2400
ccggcaagct gcccgtgccc tggcccaccc tggtgaccac cctgggctac ggcctgcagt 2460
gcttcgcccg ctaccccgac cacatgaagc gccacgactt cttcaagagc gccatgcccg 2520
agggctacgt gcaggagcgc accatcagct tcaaggacga cggcacctac aagacccgcg 2580
ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat cgagctgaag ggcatcgact 2640
tcaaggagga cggcaacatc ctgggccaca agctggagta caacttcaac agccacaacg 2700
tgtacatcac cgccgacaag cagaagaacg gcatcaaggc caacttcaag atccgccaca 2760
acgtggagga cggcggcgtg cagctggccg accactacca gcagaacacc cccatcggcg 2820
acggccccgt gctgctgccc gacaaccact acctgagcta ccagagcgtg ctgagcaagg 2880
accccaacga gaagcgcgac cacatggtgc tgctggagtt cgtgaccgcc gccggcatca 2940
cccacggcat ggacgagctg tacaagtaag gcggcctgca ggaattcgat atcaagctta 3000
tcgataccgt cgacctcgag ggggggcccg gtacccaatt cgccctatag tgagtcgtat 3060
tacgcgcgct cactggccgt cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc 3120
caacttaatc gccttgcagc acatccccct ttcgccagct ggcgtaatag cgaagaggcc 3180
cgcaccgatc gcccttccca acagttgcgc agcctgaatg gcgaatggga cgcgccctgt 3240
agcggcgcat taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc tacacttgcc 3300
agcgccctag cgcccgctcc tttcgctttc ttcccttcct ttctcgccac gttcgccggc 3360
tttccccgtc aagctctaaa tcgggggctc cctttagggt tccgatttag tgctttacgg 3420
cacctcgacc ccaaaaaact tgattagggt gatggttcac gtagtgggcc atcgccctga 3480
tagacggttt ttcgcccttt gacgttggag tccacgttct ttaatagtgg actcttgttc 3540
caaactggaa caacactcaa ccctatctcg gtctattctt ttgatttata agggattttg 3600
ccgatttcgg cctattggtt aaaaaatgag ctgatttaac aaaaatttaa cgcgaatttt 3660
aacaaaatat taacgcttac aatttag 3687
<210>4
<211>6904
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
ccgcttcaaa tacgcccagc ccgcccatgg agaaagaggc caaaatcaac ggaggatcgt 60
tacaaccaac aaaattgcaa aactcctccg ctttttacgt gttgaaaaag actgatcagc 120
acgaaacggg gagctaagct accgcttcag cacttgagag cagtatcttc catccaccgc 180
cgttcgtcag ggggcaaggc tcagatcaac gagcgcctcc atttacacgg agcggggatc 240
ccaacgtcca cactgtgctg tcacccacgc gacgcaaccc tacccagcca ccaacaccat 300
caggtccctc agaagaactc gtccaacagc cggtaaaacg ccagcttttc ctccgatacc 360
gccccatccc acccgcgccc gtactcccgc aggaacgccg cggaacactc cggcccgaac 420
cacgggtcct cctcgtgggc cagctcgcgc agcaccagcg cgagatcgga gtgccggtcc 480
gcacggccga cccgccccac gtcgatcagc ccggtcacct cgcaggtacg agggtcgagc 540
agcacgttgt ccgggcacag gtgaccgtgg caaaccgcca gatcctcgtc cgcaggccga 600
gtccgctcca gctcggcgag aagccgctcc cccgaccacc ccttccgctc ctcgtccaga 660
tcctccaagt cgacgctccc ttcagcgaca gcacgggccg cctgcggcac cgtcaccgcg 720
agactgcgat cgaacggaca ccgctcccag tccagcgcgt gcagcgaacg agcgagcccc 780
gcgagcgcca ccgccacgtc cagccgctgc tcccgcggcc accgcgcact ggccggacgc 840
cccggaaccg cttcggtgac caaccaggcg accctctcgt ccccaccacc ctccacaaca 900
cgaggtacgg gaatccccac ctccgccaac cacaccagcc gctcagcctc acccaacaag 960
cccaccccgg cccccagagc tgccaccttg acaaacaact cccgcccacc accccgaagc 1020
cgataaacac cagcccccga ggccccatcc tccacaacaa cccactcaca accgggatac 1080
cgaccccgca gtgcacgcaa cgcatcgtcc atgcttcgaa attcttcagc accggggagg 1140
gcggagtggc catcctgcaa atggaaacgg cgacgcaggg ttagatgctg cttgagacag 1200
cgacagagga gccaaaagcc ttcgtcgaca caatgcgggc gttgcaagtc aaatctgcaa 1260
gcacgctgcc tgatccgccg ggcttgctcg tcgactcacc tggccatttt aagatgttga 1320
gtgacttctc ttgtaaaaaa gtaaagaaca taggccccct ggccggttta tcaggagggc 1380
accgctccag gggctgcatg cgaactgctt gcattggcgc ctagcctttg tgggccaggg 1440
ggcttccgga taagggttgc aagtgctcaa ataccccatc aaacatcatc ctggtttggc 1500
tgcgctcctt ctggcgcgcc cggcatgcaa gcttgatggg atcttaagct agctgagtgg 1560
ttatgtatag cggcagaata gtcgcgtatg tataagtgct cgtttgtcgc tgaaagtgga 1620
ggtcaccgtt cggggtcgcg ggcttttata ccggatgggt gccgccagcg ggccgtatgg 1680
cgccttctgg acgccgcgcg ccccatcgcg gcccttccag agcttcccgc gccctcatag 1740
cccgccaaat cagtcctgta gcttcataca aacatacgca ccaatcatgt caagcctcag 1800
cgagctcccc gctcgagggt cgacggtatc gataagcttg atgtgcacag tcacgctgtc 1860
tccccctgtc tcccgagctg cgccgtccct cccctgccgt ccgtccactg acccacagct 1920
gtcctaagcc caccatgttg ctgctgtgat taccctgtcc ttgcaaatgc gtgcatcatc 1980
ccacggctgg tcagctaaac tgcgcccccc cccccccctg acccctagcg tgctgttccc 2040
gtgagacccc ctacccccca cccgtccccc ccccgccccc ggggcgcgcg caggcacggc 2100
aaactctcac atggcctggc cattacatgc agtatggcat tggcagatat tgccagtaag 2160
ttggttggtc ttctcaatgg gtgtggcacg ttggccactg gctcacgcac acgctaacat 2220
ctacaacagc acgtccgcca aaactgcggg gtcgcaaacc aagtcgacgt gcctacctcc 2280
ccctgatcct cctgtggcta attgaccgtg ggccgacccc acaccgaccc tggtcaccac 2340
tgcccttcgc ctagccccta gcgcgaaagc ctccgagctc cgatcccgta tcaatcagcg 2400
aaatcggcca tcccggcaag taaagctctt ctccatggta caggcggtcc agctgctgcc 2460
agaattctta cttgatcagc tcgtccatgc cgagagtgat cccggcggcg gtcacgaact 2520
ccagcaggac catgtgatcg cgcttctcgt tggggtcttt gctcagggcg gactggtagc 2580
tcaggtagtg gttgtcgggc agcagcacgg ggccgtcgcc gatgggggtg ttctgctggt 2640
agtggtcggc gagctgcacg ccgccgtcct cgatgttgtg gcggatcttg aagttggcct 2700
tgatgccgtt cttctgcttg tcggcggtga tatagacgtt gtggctgttg tagttgtact 2760
ccagcttgtg ccccaggatg ttgccgtcct ccttgaagtc gatgcccttc agctcgatgc 2820
ggttcaccag ggtgtcgccc tcgaacttca cctcggcgcg ggtcttgtag ttgccgtcgt 2880
ccttgaagaa gatggtgcgc tcctggacgt agccttcggg catggcggac ttgaagaagt 2940
cgtgctgctt catgtggtcg gggtagcggg cgaagcactg caggccgtag cccagggtgg 3000
tcacgagggt gggccagggc acgggcagct tgccggtggt gcagatcagc ttcagggtca 3060
gcttgccgta ggtggcatcg ccctcgccct cgccggacac gctgaacttg tggccgttta 3120
cgtcgccgtc cagctcgacc aggatgggca ccaccccggt gaacagctcc tcgcccttgc 3180
tcaccatggg gcttgttgtg agtagcagtg gggtcctaga atgcacaacg agtcaagagc 3240
gcaacaccta accctggctt gctcggcgag gaaacctccc cccgagcaag ccatctcggt 3300
cgtacctcca attcccagat ccccctccccagcccgcagg agccctcgca cgagtgcccg 3360
aacgcaacaa tattgataca taatcgtccc tggcctgggg gaagggccgc taacgcgccg 3420
ggccgtcgcg taaataccaa taatcacgcc gcgtcccact ttgctctctc gccttgcaac 3480
ttaaaagcct actgcctcgc cagatttgct ccaattgtgc tacaaatgac aattgcgtcc 3540
gaatatgggg ccgagcgcgt caggaaaggt ggcactgcga tctgctaaca tgtctcggaa 3600
cgacgacaag aagcggcttt ttaaggactc cgagttcggg caaacatgag catttgcctg 3660
ccttcacgca tcggtaggtg tggaggcgcg cgtggagaaa ggcacccgaa ctggcggcga 3720
gcccttcgaa cagccaggcc gcctgctccg ccccttcgtc ttcgcatgcg cttccaagcg 3780
atcaccagca caagggcacc gctggcacga gtacgggttg ttgaggcatg ctgagagcgc 3840
ctgggtcctg tcggtggcct aggaaagggc aaaagggctg cggggtcggc cgtgagaggg 3900
agagcgtggc ggagacgtgt ttctgacgag ggctcgtgtg acgattggtg aggcctccct 3960
cgacatgcgt tcacttcctg tcaggcagac gggcaggtgt gtgggatcca ctagttctag 4020
agcggccgcc accgcggtgg agctccaatt cgccctatag tgagtcgtat tacgcgcgct 4080
cactggccgt cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc 4140
gccttgcagc acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc 4200
gcccttccca acagttgcgc agcctgaatg gcgaatggga cgcgccctgt agcggcgcat 4260
taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc tacacttgcc agcgccctag 4320
cgcccgctcc tttcgctttc ttcccttcct ttctcgccac gttcgccggc tttccccgtc 4380
aagctctaaa tcgggggctc cctttagggt tccgatttag tgctttacgg cacctcgacc 4440
ccaaaaaact tgattagggt gatggttcac gtagtgggcc atcgccctga tagacggttt 4500
ttcgcccttt gacgttggag tccacgttct ttaatagtgg actcttgttc caaactggaa 4560
caacactcaa ccctatctcg gtctattctt ttgatttata agggattttg ccgatttcgg 4620
cctattggtt aaaaaatgag ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat 4680
taacgcttac aatttagtgt ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt 4740
tatttttcta aatacattca aatatgtatc cgctcatgag acaataaccc tgataaatgc 4800
ttcaataata ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc gcccttattc 4860
ccttttttgc ggcattttgc cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa 4920
aagatgctga agatcagttg ggtgcacgag tgggttacat cgaactggat ctcaacagcg 4980
gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag 5040
ttctgctatg tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa ctcggtcgcc 5100
gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta 5160
cggatggcat gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg 5220
cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca 5280
acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac 5340
caaacgacga gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat 5400
taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg5460
ataaagttgc aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata 5520
aatctggagc cggtgagcgt gggtctcgcg gtatcattgc agcactgggg ccagatggta 5580
agccctcccg tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa 5640
atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag 5700
tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg 5760
tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact 5820
gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg 5880
taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc 5940
aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata 6000
ctgtccttct agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta 6060
catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc 6120
ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg 6180
ggggttcgtg cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac 6240
agcgtgagct atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg 6300
taagcggcag ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt 6360
atctttatag tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct 6420
cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg 6480
ccttttgctg gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata 6540
accgtattac cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca 6600
gcgagtcagt gagcgaggaa gcggaagagc gcccaatacg caaaccgcct ctccccgcgc 6660
gttggccgat tcattaatgc agctggcacg acaggtttcc cgactggaaa gcgggcagtg 6720
agcgcaacgc aattaatgtg agttagctca ctcattaggc accccaggct ttacacttta 6780
tgcttccggc tcgtatgttg tgtggaattg tgagcggata acaatttcac acaggaaaca 6840
gctatgacca tgattacgcc aagcgcgcaa ttaaccctca ctaaagggaa caaaagctgg 6900
gtac 6904
<210>5
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
catgccatgg tgagcaaggg c 21
<210>6
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
cgcgtcgact tgtacagctc gtcc 24
<210>7
<211>6904
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
gtacccagct tttgttccct ttagtgaggg ttaattgcgc gcttggcgta atcatggtca 60
tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat acgagccgga 120
agcataaagt gtaaagcctg gggtgcctaa tgagtgagct aactcacatt aattgcgttg 180
cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc 240
caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac 300
tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata 360
cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa 420
aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct 480
gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa 540
agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg 600
cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca 660
cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa 720
ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg 780
gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg 840
tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg 900
acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc 960
tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag 1020
attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac 1080
gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc 1140
ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag 1200
taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt 1260
ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag 1320
ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca 1380
gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact 1440
ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca 1500
gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg 1560
tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc 1620
atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg 1680
gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca 1740
tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt 1800
atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc 1860
agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc 1920
ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca 1980
tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa 2040
aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat 2100
tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa 2160
aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacacta aattgtaagc 2220
gttaatattt tgttaaaatt cgcgttaaat ttttgttaaa tcagctcatt ttttaaccaa 2280
taggccgaaa tcggcaaaat cccttataaa tcaaaagaat agaccgagat agggttgagt 2340
gttgttccag tttggaacaa gagtccacta ttaaagaacg tggactccaa cgtcaaaggg 2400
cgaaaaaccg tctatcaggg cgatggccca ctacgtgaac catcacccta atcaagtttt 2460
ttggggtcga ggtgccgtaa agcactaaat cggaacccta aagggagccc ccgatttaga 2520
gcttgacggg gaaagccggc gaacgtggcg agaaaggaag ggaagaaagc gaaaggagcg 2580
ggcgctaggg cgctggcaag tgtagcggtc acgctgcgcg taaccaccac acccgccgcg 2640
cttaatgcgc cgctacaggg cgcgtcccat tcgccattca ggctgcgcaa ctgttgggaa 2700
gggcgatcgg tgcgggcctc ttcgctatta cgccagctgg cgaaaggggg atgtgctgca 2760
aggcgattaa gttgggtaac gccagggttt tcccagtcac gacgttgtaa aacgacggcc 2820
agtgagcgcg cgtaatacga ctcactatag ggcgaattgg agctccaccg cggtggcggc 2880
cgctctagaa ctagtggatc ccacacacct gcccgtctgc ctgacaggaa gtgaacgcat 2940
gtcgagggag gcctcaccaa tcgtcacacg agccctcgtc agaaacacgt ctccgccacg 3000
ctctccctct cacggccgac cccgcagccc ttttgccctt tcctaggcca ccgacaggac 3060
ccaggcgctc tcagcatgcc tcaacaaccc gtactcgtgc cagcggtgcc cttgtgctgg 3120
tgatcgcttg gaagcgcatg cgaagacgaa ggggcggagc aggcggcctg gctgttcgaa3180
gggctcgccg ccagttcggg tgcctttctc cacgcgcgcc tccacaccta ccgatgcgtg 3240
aaggcaggca aatgctcatg tttgcccgaa ctcggagtcc ttaaaaagcc gcttcttgtc 3300
gtcgttccga gacatgttag cagatcgcag tgccaccttt cctgacgcgc tcggccccat 3360
attcggacgc aattgtcatt tgtagcacaa ttggagcaaa tctggcgagg cagtaggctt 3420
ttaagttgca aggcgagaga gcaaagtggg acgcggcgtg attattggta tttacgcgac 3480
ggcccggcgc gttagcggcc cttcccccag gccagggacg attatgtatc aatattgttg 3540
cgttcgggca ctcgtgcgag ggctcctgcg ggctggggag ggggatctgg gaattggagg 3600
tacgaccgag atggcttgct cggggggagg tttcctcgcc gagcaagcca gggttaggtg 3660
ttgcgctctt gactcgttgt gcattctagg accccactgc tactcacaac aagccccatg 3720
gtgagcaagg gcgaggagct gttcaccggc gtggtgccca tcctggtgga gctggacggc 3780
gacgtgaacg gccacaagtt cagcgtgcgc ggcgagggcg agggcgacgc caccaacggc 3840
aagctgaccc tgaagctgat ctgcaccacc ggcaagctgc ccgtgccctg gcccaccctg 3900
gtgaccaccc tgggctacgg cctgcagtgc ttcgcccgct accccgacca catgaagcgc 3960
cacgacttct tcaagagcgc catgcccgag ggctacgtgc aggagcgcac catcagcttc 4020
aaggacgacg gcacctacaa gacccgcgcc gaggtgaagt tcgagggcga caccctggtg 4080
aaccgcatcg agctgaaggg catcgacttc aaggaggacg gcaacatcct gggccacaag 4140
ctggagtaca acttcaacag ccacaacgtg tacatcaccg ccgacaagca gaagaacggc 4200
atcaaggcca acttcaagat ccgccacaac gtggaggacg gcggcgtgca gctggccgac 4260
cactaccagc agaacacccc catcggcgac ggccccgtgc tgctgcccga caaccactac 4320
ctgagctacc agagcgtgct gagcaaggac cccaacgaga agcgcgacca catggtgctg 4380
ctggagttcg tgaccgccgc cggcatcacc cacggcatgg acgagctgta caagtaagaa 4440
ttctggcagc agctggaccg cctgtaccat ggagaagagc tttacttgcc gggatggccg 4500
atttcgctga ttgatacggg atcggagctc ggaggctttc gcgctagggg ctaggcgaag 4560
ggcagtggtg accagggtcg gtgtggggtc ggcccacggt caattagcca caggaggatc 4620
agggggaggt aggcacgtcg acttggtttg cgaccccgca gttttggcgg acgtgctgtt 4680
gtagatgtta gcgtgtgcgt gagccagtgg ccaacgtgcc acacccattg agaagaccaa 4740
ccaacttact ggcaatatct gccaatgcca tactgcatgt aatggccagg ccatgtgaga 4800
gtttgccgtg cctgcgcgcg ccccgggggc ggggggggga cgggtggggg gtagggggtc 4860
tcacgggaac agcacgctag gggtcagggg gggggggggg cgcagtttag ctgaccagcc 4920
gtgggatgat gcacgcattt gcaaggacag ggtaatcaca gcagcaacat ggtgggctta 4980
ggacagctgt gggtcagtgg acggacggca ggggagggac ggcgcagctc gggagacagg 5040
gggagacagc gtgactgtgc acatcaagct tatcgatacc gtcgaccctc gagcggggag 5100
ctcgctgagg cttgacatga ttggtgcgta tgtttgtatg aagctacagg actgatttgg 5160
cgggctatga gggcgcggga agctctggaa gggccgcgat ggggcgcgcg gcgtccagaa 5220
ggcgccatac ggcccgctgg cggcacccat ccggtataaa agcccgcgac cccgaacggt 5280
gacctccact ttcagcgaca aacgagcact tatacatacg cgactattct gccgctatac 5340
ataaccactc agctagctta agatcccatc aagcttgcat gccgggcgcg ccagaaggag 5400
cgcagccaaa ccaggatgat gtttgatggg gtatttgagc acttgcaacc cttatccgga 5460
agccccctgg cccacaaagg ctaggcgcca atgcaagcag ttcgcatgca gcccctggag 5520
cggtgccctc ctgataaacc ggccaggggg cctatgttct ttactttttt acaagagaag 5580
tcactcaaca tcttaaaatg gccaggtgag tcgacgagca agcccggcgg atcaggcagc 5640
gtgcttgcag atttgacttg caacgcccgc attgtgtcga cgaaggcttt tggctcctct 5700
gtcgctgtct caagcagcat ctaaccctgc gtcgccgttt ccatttgcag gatggccact 5760
ccgccctccc cggtgctgaa gaatttcgaa gcatggacga tgcgttgcgt gcactgcggg 5820
gtcggtatcc cggttgtgag tgggttgttg tggaggatgg ggcctcgggg gctggtgttt 5880
atcggcttcg gggtggtggg cgggagttgt ttgtcaaggt ggcagctctg ggggccgggg 5940
tgggcttgtt gggtgaggct gagcggctgg tgtggttggc ggaggtgggg attcccgtac 6000
ctcgtgttgt ggagggtggt ggggacgaga gggtcgcctg gttggtcacc gaagcggttc 6060
cggggcgtcc ggccagtgcg cggtggccgc gggagcagcg gctggacgtg gcggtggcgc 6120
tcgcggggct cgctcgttcg ctgcacgcgc tggactggga gcggtgtccg ttcgatcgca 6180
gtctcgcggt gacggtgccg caggcggccc gtgctgtcgc tgaagggagc gtcgacttgg 6240
aggatctgga cgaggagcgg aaggggtggt cgggggagcg gcttctcgcc gagctggagc 6300
ggactcggcc tgcggacgag gatctggcgg tttgccacgg tcacctgtgc ccggacaacg 6360
tgctgctcga ccctcgtacc tgcgaggtga ccgggctgat cgacgtgggg cgggtcggcc 6420
gtgcggaccg gcactccgat ctcgcgctgg tgctgcgcga gctggcccac gaggaggacc 6480
cgtggttcgg gccggagtgt tccgcggcgt tcctgcggga gtacgggcgc gggtgggatg 6540
gggcggtatc ggaggaaaag ctggcgtttt accggctgtt ggacgagttc ttctgaggga 6600
cctgatggtg ttggtggctg ggtagggttg cgtcgcgtgg gtgacagcac agtgtggacg 6660
ttgggatccc cgctccgtgt aaatggaggc gctcgttgat ctgagccttg ccccctgacg 6720
aacggcggtg gatggaagat actgctctca agtgctgaag cggtagctta gctccccgtt 6780
tcgtgctgat cagtcttttt caacacgtaa aaagcggagg agttttgcaa ttttgttggt 6840
tgtaacgatc ctccgttgat tttggcctct ttctccatgg gcgggctggg cgtatttgaa 6900
gcgg 6904
<210>8
<211>59
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
gtgcattcta ggaccccact gctactcaca acaagcccca tggtgagcaa gggcgagga 59
<210>9
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
ggaattctta cttgtacagc tcgtcca 27
<210>10
<211>6066
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
cacctaaatt gtaagcgtta atattttgtt aaaattcgcg ttaaattttt gttaaatcag 60
ctcatttttt aaccaatagg ccgaaatcgg caaaatccct tataaatcaa aagaatagac 120
cgagataggg ttgagtgttg ttccagtttg gaacaagagt ccactattaa agaacgtgga 180
ctccaacgtc aaagggcgaa aaaccgtcta tcagggcgat ggcccactac gtgaaccatc 240
accctaatca agttttttgg ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg 300
gagcccccga tttagagctt gacggggaaa gccggcgaac gtggcgagaa aggaagggaa 360
gaaagcgaaa ggagcgggcg ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac 420
caccacaccc gccgcgctta atgcgccgct acagggcgcg tcccattcgc cattcaggct 480
gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa 540
agggggatgt gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg 600
ttgtaaaacg acggccagtg aattgtaata cgactcacta tagggcgaat tgggtaccct 660
tgacatgatt ggtgcgtatg tttgtatgaa gctacaggac tgatttggcg ggctatgagg 720
gcgcgggaag ctctggaagg gccgcgatgg ggcgcgcggc gtccagaagg cgccatacgg 780
cccgctggcg gcacccatcc ggtataaaag cccgcgaccc cgaacggtga cctccacttt 840
cagcgacaaa cgagcactta tacatacgcg actattctgc cgctatacat aaccactcag 900
ctagcttaag atcccatcaa gcttgcatgc cgggcgcgcc agaaggagcg cagccaaacc 960
aggatgatgt ttgatggggt atttgagcac ttgcaaccct tatccggaag ccccctggcc 1020
cacaaaggct aggcgccaat gcaagcagtt cgcatgcagc ccctggagcg gtgccctcct 1080
gataaaccgg ccagggggcc tatgttcttt acttttttac aagagaagtc actcaacatc 1140
ttaaaatggc caggtgagtc gacgagcaag cccggcggat caggcagcgt gcttgcagat 1200
ttgacttgca acgcccgcat tgtgtcgacg aaggcttttg gctcctctgt cgctgtctca 1260
agcagcatct aaccctgcgt cgccgtttcc atttgcagga actagtatgg ccaggatggc 1320
caagctgacc agcgccgtgc ccgtgctgac cgcccgcgac gtggccggcg ccgtggagtt 1380
ctggaccgac cgcctgggct tcagccgcga cttcgtggag gacgacttcg ccggcgtggt 1440
gcgcgacgac gtgaccctgt tcatcagcgc cgtgcaggac caggtggtgc ccgacaacac 1500
cctggcctgg gtgtgggtgc gcggcctgga cgagctgtac gccgagtgga gcgaggtggt 1560
gagcaccaac ttccgcgacg ccagcggccc cgccatgacc gagatcggcg agcagccctg 1620
gggccgcgag ttcgccctgc gcgaccccgc cggcaactgc gtgcacttcg tggccgagga 1680
gcaggactag ctcgagcgct ccgtgtaaat ggaggcgctc gttgatctga gccttgcccc 1740
ctgacgaacg gcggtggatg gaagatactg ctctcaagtg ctgaagcggt agcttagctc 1800
cccgtttcgt gctgatcagt ctttttcaac acgtaaaaag cggaggagtt ttgcaatttt 1860
gttggttgta acgatcctcc gttgattttg gcctctttct ccatgggcgg gctgggcgta 1920
tttgaagcga attcgatcccacacacctgc ccgtctgcct gacaggaagt gaacgcatgt 1980
cgagggaggc ctcaccaatc gtcacacgag ccctcgtcag aaacacgtct ccgccacgct 2040
ctccctctca cggccgaccc cgcagccctt ttgccctttc ctaggccacc gacaggaccc 2100
aggcgctctc agcatgcctc aacaacccgt actcgtgcca gcggtgccct tgtgctggtg 2160
atcgcttgga agcgcatgcg aagacgaagg ggcggagcag gcggcctggc tgttcgaagg 2220
gctcgccgcc agttcgggtg cctttctcca cgcgcgcctc cacacctacc gatgcgtgaa 2280
ggcaggcaaa tgctcatgtt tgcccgaact cggagtcctt aaaaagccgc ttcttgtcgt 2340
cgttccgaga catgttagca gatcgcagtg ccacctttcc tgacgcgctc ggccccatat 2400
tcggacgcaa ttgtcatttg tagcacaatt ggagcaaatc tggcgaggca gtaggctttt 2460
aagttgcaag gcgagagagc aaagtgggac gcggcgtgat tattggtatt tacgcgacgg 2520
cccggcgcgt tagcggccct tcccccaggc cagggacgat tatgtatcaa tattgttgcg 2580
ttcgggcact cgtgcgaggg ctcctgcggg ctggggaggg ggatctggga attggaggta 2640
cgaccgagat ggcttgctcg gggggaggtt tcctcgccga gcaagccagg gttaggtgtt 2700
gcgctcttga ctcgttgtgc attctaggac cccactgcta ctcacaacaa gcccccatat 2760
gatggccccc aagaaggccg ccaagggtga tgaggccccc aaggaggtgg tgagcctggg 2820
ccccaccgtc cgcgagggcg agcacgtctt cggcgttgct cacatcttcg ccagcttcaa 2880
cgacacgttc gtgcatgtga ccgacctgtc gggccgggaa actatttcgc gcgtcaccgg 2940
cggcatgaag gtcaaggccg accgcgacga gtcgtcgccc tacgcggcca tgcttgccgc 3000
gcaggacgtg gcccagaagt gcaaggagct gggcatcact gccctgcaca tcaagctgcg 3060
cgccaccggc ggcaaccgga ccaagacccc cggccccggt gcccagtccg ccctgcgtgc 3120
cctggcccgc gcgggcatga agattggccg catcgaggac gtgaccccca tccccaccga 3180
ctccacccgc cggaagggtg gtcgccgcgg tcgccgcccc taaggatccc tggcagcagc 3240
tggaccgcct gtaccatgga gaagagcttt acttgccggg atggccgatt tcgctgattg 3300
atacgggatc ggagctcgga ggctttcgcg ctaggggcta ggcgaagggc agtggtgacc 3360
agggtcggtg tggggtcggc ccacggtcaa ttagccacag gaggatcagg gggaggtagg 3420
cacgtcgact tggtttgcga ccccgcagtt ttggcggacg tgctgttgta gatgttagcg 3480
tgtgcgtgag ccagtggcca acgtgccaca cccattgaga agaccaacca acttactggc 3540
aatatctgcc aatgccatac tgcatgtaat ggccaggcca tgtgagagtt tgccgtgcct 3600
gcgcgcgccc cgggggcggg ggggggacgg gtggggggta gggggtctca cgggaacagc 3660
acgctagggg tcaggggggg gggggggcgc agtttagctg accagccgtg ggatgatgca 3720
cgcatttgca aggacagggt aatcacagca gcaacatggt gggcttagga cagctgtggg 3780
tcagtggacg gacggcaggg gagggacggc gcagctcggg agacaggggg agacagcgtg 3840
actggcggcc gccaccgcgg tggagctcca gcttttgttc cctttagtga gggttaattt 3900
cgagcttggc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa 3960
ttccacacaa catacgagcc ggaagcataa agtgtaaagc ctggggtgcc taatgagtga 4020
gctaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt 4080
gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct 4140
cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat 4200
cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga 4260
acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt 4320
ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt 4380
ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc 4440
gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa 4500
gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct 4560
ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta 4620
actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg 4680
gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc 4740
ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta 4800
ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg 4860
gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt 4920
tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg 4980
tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta 5040
aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg 5100
aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg 5160
tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc 5220
gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg 5280
agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg 5340
aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag 5400
gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat 5460
caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc 5520
cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc 5580
ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa 5640
ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac 5700
gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt 5760
cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc 5820
gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa 5880
caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca 5940
tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat 6000
acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa 6060
aagtgc 6066
<210>11
<211>6333
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
cacctaaatt gtaagcgtta atattttgtt aaaattcgcg ttaaattttt gttaaatcag 60
ctcatttttt aaccaatagg ccgaaatcgg caaaatccct tataaatcaa aagaatagac 120
cgagataggg ttgagtgttg ttccagtttg gaacaagagt ccactattaa agaacgtgga 180
ctccaacgtc aaagggcgaa aaaccgtcta tcagggcgat ggcccactac gtgaaccatc 240
accctaatca agttttttgg ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg 300
gagcccccga tttagagctt gacggggaaa gccggcgaac gtggcgagaa aggaagggaa 360
gaaagcgaaa ggagcgggcg ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac 420
caccacaccc gccgcgctta atgcgccgct acagggcgcg tcccattcgc cattcaggct 480
gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa 540
agggggatgt gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg 600
ttgtaaaacg acggccagtg aattgtaata cgactcacta tagggcgaat tgggtaccct 660
tgacatgatt ggtgcgtatg tttgtatgaa gctacaggac tgatttggcg ggctatgagg 720
gcgcgggaag ctctggaagg gccgcgatgg ggcgcgcggc gtccagaagg cgccatacgg 780
cccgctggcg gcacccatcc ggtataaaag cccgcgaccc cgaacggtga cctccacttt 840
cagcgacaaa cgagcactta tacatacgcg actattctgc cgctatacat aaccactcag 900
ctagcttaag atcccatcaa gcttgcatgc cgggcgcgcc agaaggagcg cagccaaacc 960
aggatgatgt ttgatggggt atttgagcac ttgcaaccct tatccggaag ccccctggcc 1020
cacaaaggct aggcgccaat gcaagcagtt cgcatgcagc ccctggagcg gtgccctcct 1080
gataaaccgg ccagggggcc tatgttcttt acttttttac aagagaagtc actcaacatc 1140
ttaaaatggc caggtgagtc gacgagcaag cccggcggat caggcagcgt gcttgcagat 1200
ttgacttgca acgcccgcat tgtgtcgacg aaggcttttg gctcctctgt cgctgtctca 1260
agcagcatct aaccctgcgt cgccgtttcc atttgcagga actagtatgg ccaggatggc 1320
caagctgacc agcgccgtgc ccgtgctgac cgcccgcgac gtggccggcg ccgtggagtt 1380
ctggaccgac cgcctgggct tcagccgcga cttcgtggag gacgacttcg ccggcgtggt 1440
gcgcgacgac gtgaccctgt tcatcagcgc cgtgcaggac caggtggtgc ccgacaacac 1500
cctggcctgg gtgtgggtgc gcggcctgga cgagctgtac gccgagtgga gcgaggtggt 1560
gagcaccaac ttccgcgacg ccagcggccc cgccatgacc gagatcggcg agcagccctg 1620
gggccgcgag ttcgccctgc gcgaccccgc cggcaactgc gtgcacttcg tggccgagga 1680
gcaggactag ctcgagcgct ccgtgtaaat ggaggcgctc gttgatctga gccttgcccc 1740
ctgacgaacg gcggtggatg gaagatactg ctctcaagtg ctgaagcggt agcttagctc 1800
cccgtttcgt gctgatcagt ctttttcaac acgtaaaaag cggaggagtt ttgcaatttt 1860
gttggttgta acgatcctcc gttgattttg gcctctttct ccatgggcgg gctgggcgta 1920
tttgaagcga attcgatccc acacacctgc ccgtctgcct gacaggaagt gaacgcatgt 1980
cgagggaggc ctcaccaatc gtcacacgag ccctcgtcag aaacacgtct ccgccacgct 2040
ctccctctca cggccgaccc cgcagccctt ttgccctttc ctaggccacc gacaggaccc 2100
aggcgctctc agcatgcctc aacaacccgt actcgtgcca gcggtgccct tgtgctggtg 2160
atcgcttgga agcgcatgcg aagacgaagg ggcggagcag gcggcctggc tgttcgaagg 2220
gctcgccgcc agttcgggtg cctttctcca cgcgcgcctc cacacctacc gatgcgtgaa 2280
ggcaggcaaa tgctcatgtt tgcccgaact cggagtcctt aaaaagccgc ttcttgtcgt 2340
cgttccgaga catgttagca gatcgcagtg ccacctttcc tgacgcgctc ggccccatat 2400
tcggacgcaa ttgtcatttg tagcacaatt ggagcaaatc tggcgaggca gtaggctttt 2460
aagttgcaag gcgagagagc aaagtgggac gcggcgtgat tattggtatt tacgcgacgg 2520
cccggcgcgt tagcggccct tcccccaggc cagggacgat tatgtatcaa tattgttgcg 2580
ttcgggcact cgtgcgaggg ctcctgcggg ctggggaggg ggatctggga attggaggta 2640
cgaccgagat ggcttgctcg gggggaggtt tcctcgccga gcaagccagg gttaggtgtt 2700
gcgctcttga ctcgttgtgc attctaggac cccactgcta ctcacaacaa gcccccatat 2760
gggcacgcgt atggtgagca agggcgagga gctgttcacc ggcgtggtgc ccatcctggt 2820
ggagctggac ggcgacgtga acggccacaa gttcagcgtg cgcggcgagg gcgagggcga 2880
cgccaccaac ggcaagctga ccctgaagct gatctgcacc accggcaagc tgcccgtgcc 2940
ctggcccacc ctggtgacca ccctgggcta cggcctgcag tgcttcgccc gctaccccga 3000
ccacatgaag cgccacgact tcttcaagag cgccatgccc gagggctacg tgcaggagcg 3060
caccatcagc ttcaaggacg acggcaccta caagacccgc gccgaggtga agttcgaggg 3120
cgacaccctg gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat 3180
cctgggccac aagctggagt acaacttcaa cagccacaac gtgtacatca ccgccgacaa 3240
gcagaagaac ggcatcaagg ccaacttcaa gatccgccac aacgtggagg acggcggcgt 3300
gcagctggcc gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc 3360
cgacaaccac tacctgagct accagagcgt gctgagcaag gaccccaacg agaagcgcga 3420
ccacatggtg ctgctggagt tcgtgaccgc cgccggcatc acccacggca tggacgagct 3480
gtacaagtaa ggatccctgg cagcagctgg accgcctgta ccatggagaa gagctttact 3540
tgccgggatg gccgatttcg ctgattgata cgggatcgga gctcggaggc tttcgcgcta 3600
ggggctaggc gaagggcagt ggtgaccagg gtcggtgtgg ggtcggccca cggtcaatta 3660
gccacaggag gatcaggggg aggtaggcac gtcgacttgg tttgcgaccc cgcagttttg 3720
gcggacgtgc tgttgtagat gttagcgtgt gcgtgagcca gtggccaacg tgccacaccc 3780
attgagaaga ccaaccaact tactggcaat atctgccaat gccatactgc atgtaatggc 3840
caggccatgt gagagtttgc cgtgcctgcg cgcgccccgg gggcgggggg gggacgggtg 3900
gggggtaggg ggtctcacgg gaacagcacg ctaggggtca gggggggggg ggggcgcagt 3960
ttagctgacc agccgtggga tgatgcacgc atttgcaagg acagggtaat cacagcagca 4020
acatggtggg cttaggacag ctgtgggtca gtggacggac ggcaggggag ggacggcgca 4080
gctcgggaga cagggggaga cagcgtgact ggcggccgcc accgcggtgg agctccagct 4140
tttgttccct ttagtgaggg ttaatttcga gcttggcgta atcatggtca tagctgtttc 4200
ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat acgagccgga agcataaagt 4260
gtaaagcctg gggtgcctaa tgagtgagct aactcacatt aattgcgttg cgctcactgc 4320
ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg 4380
ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac tcgctgcgct 4440
cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca 4500
cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga 4560
accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc 4620
acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg 4680
cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat 4740
acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt 4800
atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc 4860
agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg 4920
acttatcgcc actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg 4980
gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg acagtatttg 5040
gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg 5100
gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca 5160
gaaaaaaagg atctcaagaa gatcctttgatcttttctac ggggtctgac gctcagtgga 5220
acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga 5280
tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt 5340
ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt 5400
catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat 5460
ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag 5520
caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct 5580
ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt 5640
tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg 5700
cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca 5760
aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt 5820
tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat 5880
gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac 5940
cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc agaactttaa 6000
aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt 6060
tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt 6120
tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa 6180
gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat tgaagcattt 6240
atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa 6300
taggggttcc gcgcacattt ccccgaaaag tgc 6333
<210>12
<211>42
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
ggaattccat atgggcacgc gtatggtgag caagggcgag ga 42
<210>13
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
cgggatcctt acttgtacag ctcgtcca 28
<210>14
<211>7062
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
cacctaaatt gtaagcgtta atattttgtt aaaattcgcg ttaaattttt gttaaatcag 60
ctcatttttt aaccaatagg ccgaaatcgg caaaatccct tataaatcaa aagaatagac 120
cgagataggg ttgagtgttg ttccagtttg gaacaagagt ccactattaa agaacgtgga 180
ctccaacgtc aaagggcgaa aaaccgtcta tcagggcgat ggcccactac gtgaaccatc 240
accctaatca agttttttgg ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg 300
gagcccccga tttagagctt gacggggaaa gccggcgaac gtggcgagaa aggaagggaa 360
gaaagcgaaa ggagcgggcg ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac 420
caccacaccc gccgcgctta atgcgccgct acagggcgcg tcccattcgc cattcaggct 480
gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa 540
agggggatgt gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg 600
ttgtaaaacg acggccagtg aattgtaata cgactcacta tagggcgaat tgggtaccct 660
tgacatgatt ggtgcgtatg tttgtatgaa gctacaggac tgatttggcg ggctatgagg 720
gcgcgggaag ctctggaagg gccgcgatgg ggcgcgcggc gtccagaagg cgccatacgg 780
cccgctggcg gcacccatcc ggtataaaag cccgcgaccc cgaacggtga cctccacttt 840
cagcgacaaa cgagcactta tacatacgcg actattctgc cgctatacat aaccactcag 900
ctagcttaag atcccatcaa gcttgcatgc cgggcgcgcc agaaggagcg cagccaaacc 960
aggatgatgt ttgatggggt atttgagcac ttgcaaccct tatccggaag ccccctggcc 1020
cacaaaggct aggcgccaat gcaagcagtt cgcatgcagc ccctggagcg gtgccctcct 1080
gataaaccgg ccagggggcc tatgttcttt acttttttac aagagaagtc actcaacatc 1140
ttaaaatggc caggtgagtc gacgagcaag cccggcggat caggcagcgt gcttgcagat 1200
ttgacttgca acgcccgcat tgtgtcgacg aaggcttttg gctcctctgt cgctgtctca 1260
agcagcatct aaccctgcgt cgccgtttcc atttgcagga actagtatgg ccaggatggc 1320
caagctgacc agcgccgtgc ccgtgctgac cgcccgcgac gtggccggcg ccgtggagtt 1380
ctggaccgac cgcctgggct tcagccgcga cttcgtggag gacgacttcg ccggcgtggt 1440
gcgcgacgac gtgaccctgt tcatcagcgc cgtgcaggac caggtggtgc ccgacaacac 1500
cctggcctgg gtgtgggtgc gcggcctgga cgagctgtac gccgagtgga gcgaggtggt 1560
gagcaccaac ttccgcgacg ccagcggccc cgccatgacc gagatcggcg agcagccctg 1620
gggccgcgag ttcgccctgc gcgaccccgc cggcaactgc gtgcacttcg tggccgagga 1680
gcaggactag ctcgagcgct ccgtgtaaat ggaggcgctc gttgatctga gccttgcccc 1740
ctgacgaacg gcggtggatg gaagatactg ctctcaagtg ctgaagcggt agcttagctc 1800
cccgtttcgt gctgatcagt ctttttcaac acgtaaaaag cggaggagtt ttgcaatttt 1860
gttggttgta acgatcctcc gttgattttg gcctctttct ccatgggcgg gctgggcgta 1920
tttgaagcga attcgatccc acacacctgc ccgtctgcct gacaggaagt gaacgcatgt 1980
cgagggaggc ctcaccaatc gtcacacgag ccctcgtcag aaacacgtct ccgccacgct 2040
ctccctctca cggccgaccc cgcagccctt ttgccctttc ctaggccacc gacaggaccc 2100
aggcgctctc agcatgcctc aacaacccgt actcgtgcca gcggtgccct tgtgctggtg 2160
atcgcttgga agcgcatgcg aagacgaagg ggcggagcag gcggcctggc tgttcgaagg 2220
gctcgccgcc agttcgggtg cctttctcca cgcgcgcctc cacacctacc gatgcgtgaa 2280
ggcaggcaaa tgctcatgtt tgcccgaact cggagtcctt aaaaagccgc ttcttgtcgt 2340
cgttccgaga catgttagca gatcgcagtg ccacctttcc tgacgcgctc ggccccatat 2400
tcggacgcaa ttgtcatttg tagcacaatt ggagcaaatc tggcgaggca gtaggctttt2460
aagttgcaag gcgagagagc aaagtgggac gcggcgtgat tattggtatt tacgcgacgg 2520
cccggcgcgt tagcggccct tcccccaggc cagggacgat tatgtatcaa tattgttgcg 2580
ttcgggcact cgtgcgaggg ctcctgcggg ctggggaggg ggatctggga attggaggta 2640
cgaccgagat ggcttgctcg gggggaggtt tcctcgccga gcaagccagg gttaggtgtt 2700
gcgctcttga ctcgttgtgc attctaggac cccactgcta ctcacaacaa gcccccatat 2760
gggcgggccc atggtgagca agggcgagga gctgttcacc ggcgtggtgc ccatcctggt 2820
ggagctggac ggcgacgtga acggccacaa gttcagcgtg cgcggcgagg gcgagggcga 2880
cgccaccaac ggcaagctga ccctgaagct gatctgcacc accggcaagc tgcccgtgcc 2940
ctggcccacc ctggtgacca ccctgggcta cggcctgcag tgcttcgccc gctaccccga 3000
ccacatgaag cgccacgact tcttcaagag cgccatgccc gagggctacg tgcaggagcg 3060
caccatcagc ttcaaggacg acggcaccta caagacccgc gccgaggtga agttcgaggg 3120
cgacaccctg gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat 3180
cctgggccac aagctggagt acaacttcaa cagccacaac gtgtacatca ccgccgacaa 3240
gcagaagaac ggcatcaagg ccaacttcaa gatccgccac aacgtggagg acggcggcgt 3300
gcagctggcc gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc 3360
cgacaaccac tacctgagct accagagcgt gctgagcaag gaccccaacg agaagcgcga 3420
ccacatggtg ctgctggagt tcgtgaccgc cgccggcatc acccacggca tggacgagct 3480
gtacaagggc ggcacgcgta tggtgagcaa gggcgaggag ctgttcaccg gcgtggtgcc 3540
catcctggtg gagctggacg gcgacgtgaa cggccacaag ttcagcgtgc gcggcgaggg 3600
cgagggcgac gccaccaacg gcaagctgac cctgaagctg atctgcacca ccggcaagct 3660
gcccgtgccc tggcccaccc tggtgaccac cctgggctac ggcctgcagt gcttcgcccg 3720
ctaccccgac cacatgaagc gccacgactt cttcaagagc gccatgcccg agggctacgt 3780
gcaggagcgc accatcagct tcaaggacga cggcacctac aagacccgcg ccgaggtgaa 3840
gttcgagggc gacaccctgg tgaaccgcat cgagctgaag ggcatcgact tcaaggagga 3900
cggcaacatc ctgggccaca agctggagta caacttcaac agccacaacg tgtacatcac 3960
cgccgacaag cagaagaacg gcatcaaggc caacttcaag atccgccaca acgtggagga 4020
cggcggcgtg cagctggccg accactacca gcagaacacc cccatcggcg acggccccgt 4080
gctgctgccc gacaaccact acctgagcta ccagagcgtg ctgagcaagg accccaacga 4140
gaagcgcgac cacatggtgc tgctggagtt cgtgaccgcc gccggcatca cccacggcat 4200
ggacgagctg tacaagtaag gatccctggc agcagctgga ccgcctgtac catggagaag 4260
agctttactt gccgggatgg ccgatttcgc tgattgatac gggatcggag ctcggaggct 4320
ttcgcgctag gggctaggcg aagggcagtg gtgaccaggg tcggtgtggg gtcggcccac 4380
ggtcaattag ccacaggagg atcaggggga ggtaggcacg tcgacttggt ttgcgacccc 4440
gcagttttgg cggacgtgct gttgtagatg ttagcgtgtg cgtgagccag tggccaacgt 4500
gccacaccca ttgagaagac caaccaactt actggcaata tctgccaatg ccatactgca 4560
tgtaatggcc aggccatgtg agagtttgcc gtgcctgcgc gcgccccggg ggcggggggg 4620
ggacgggtgg ggggtagggg gtctcacggg aacagcacgc taggggtcag gggggggggg 4680
gggcgcagtt tagctgacca gccgtgggat gatgcacgca tttgcaagga cagggtaatc 4740
acagcagcaa catggtgggc ttaggacagc tgtgggtcag tggacggacg gcaggggagg 4800
gacggcgcag ctcgggagac agggggagac agcgtgactg gcggccgcca ccgcggtgga 4860
gctccagctt ttgttccctt tagtgagggt taatttcgag cttggcgtaa tcatggtcat 4920
agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc acacaacata cgagccggaa 4980
gcataaagtg taaagcctgg ggtgcctaat gagtgagcta actcacatta attgcgttgc 5040
gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc 5100
aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact 5160
cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac 5220
ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa 5280
aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg 5340
acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa 5400
gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc 5460
ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac 5520
gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac 5580
cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg 5640
taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt 5700
atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga 5760
cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct 5820
cttgatccgg caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga 5880
ttacgcgcag aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg 5940
ctcagtggaa cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct 6000
tcacctagat ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt 6060
aaacttggtc tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc 6120
tatttcgttc atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg 6180
gcttaccatc tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag 6240
atttatcagc aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt 6300
tatccgcctc catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag 6360
ttaatagttt gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt 6420
ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca 6480
tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg 6540
ccgcagtgtt atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat 6600
ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta 6660
tgcggcgacc gagttgctcttgcccggcgt caatacggga taataccgcg ccacatagca 6720
gaactttaaa agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct 6780
taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat 6840
cttttacttt caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa 6900
agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt 6960
gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa 7020
ataaacaaat aggggttccg cgcacatttc cccgaaaagt gc 7062
<210>15
<211>42
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
ggaattccat atgggcgggc ccatggtgag caagggcgag ga 42
<210>16
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
cgacgcgtgc cgcccttgta cagctcgtcc a 31
<210>17
<211>7791
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>17
cacctaaatt gtaagcgtta atattttgtt aaaattcgcg ttaaattttt gttaaatcag 60
ctcatttttt aaccaatagg ccgaaatcgg caaaatccct tataaatcaa aagaatagac 120
cgagataggg ttgagtgttg ttccagtttg gaacaagagt ccactattaa agaacgtgga 180
ctccaacgtc aaagggcgaa aaaccgtcta tcagggcgat ggcccactac gtgaaccatc 240
accctaatca agttttttgg ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg 300
gagcccccga tttagagctt gacggggaaa gccggcgaac gtggcgagaa aggaagggaa 360
gaaagcgaaa ggagcgggcg ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac 420
caccacaccc gccgcgctta atgcgccgct acagggcgcg tcccattcgc cattcaggct 480
gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa 540
agggggatgt gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg 600
ttgtaaaacg acggccagtg aattgtaata cgactcacta tagggcgaat tgggtaccct 660
tgacatgatt ggtgcgtatg tttgtatgaa gctacaggac tgatttggcg ggctatgagg 720
gcgcgggaag ctctggaagg gccgcgatgg ggcgcgcggc gtccagaagg cgccatacgg 780
cccgctggcg gcacccatcc ggtataaaag cccgcgaccc cgaacggtga cctccacttt 840
cagcgacaaa cgagcactta tacatacgcg actattctgc cgctatacat aaccactcag 900
ctagcttaag atcccatcaa gcttgcatgc cgggcgcgcc agaaggagcg cagccaaacc 960
aggatgatgt ttgatggggt atttgagcac ttgcaaccct tatccggaag ccccctggcc 1020
cacaaaggct aggcgccaat gcaagcagtt cgcatgcagc ccctggagcg gtgccctcct 1080
gataaaccgg ccagggggcc tatgttcttt acttttttac aagagaagtc actcaacatc 1140
ttaaaatggc caggtgagtc gacgagcaag cccggcggat caggcagcgt gcttgcagat 1200
ttgacttgca acgcccgcat tgtgtcgacg aaggcttttg gctcctctgt cgctgtctca 1260
agcagcatct aaccctgcgt cgccgtttcc atttgcagga actagtatgg ccaggatggc 1320
caagctgacc agcgccgtgc ccgtgctgac cgcccgcgac gtggccggcg ccgtggagtt 1380
ctggaccgac cgcctgggct tcagccgcga cttcgtggag gacgacttcg ccggcgtggt 1440
gcgcgacgac gtgaccctgt tcatcagcgc cgtgcaggac caggtggtgc ccgacaacac 1500
cctggcctgg gtgtgggtgc gcggcctgga cgagctgtac gccgagtgga gcgaggtggt 1560
gagcaccaac ttccgcgacg ccagcggccc cgccatgacc gagatcggcg agcagccctg 1620
gggccgcgag ttcgccctgc gcgaccccgc cggcaactgc gtgcacttcg tggccgagga 1680
gcaggactag ctcgagcgct ccgtgtaaat ggaggcgctc gttgatctga gccttgcccc 1740
ctgacgaacg gcggtggatg gaagatactg ctctcaagtg ctgaagcggt agcttagctc 1800
cccgtttcgt gctgatcagt ctttttcaac acgtaaaaag cggaggagtt ttgcaatttt 1860
gttggttgta acgatcctcc gttgattttg gcctctttct ccatgggcgg gctgggcgta 1920
tttgaagcga attcgatccc acacacctgc ccgtctgcct gacaggaagt gaacgcatgt 1980
cgagggaggc ctcaccaatc gtcacacgag ccctcgtcag aaacacgtct ccgccacgct 2040
ctccctctca cggccgaccc cgcagccctt ttgccctttc ctaggccacc gacaggaccc 2100
aggcgctctc agcatgcctc aacaacccgt actcgtgcca gcggtgccct tgtgctggtg 2160
atcgcttgga agcgcatgcg aagacgaagg ggcggagcag gcggcctggc tgttcgaagg 2220
gctcgccgcc agttcgggtg cctttctcca cgcgcgcctc cacacctacc gatgcgtgaa 2280
ggcaggcaaa tgctcatgtt tgcccgaact cggagtcctt aaaaagccgc ttcttgtcgt 2340
cgttccgaga catgttagca gatcgcagtg ccacctttcc tgacgcgctc ggccccatat 2400
tcggacgcaa ttgtcatttg tagcacaatt ggagcaaatc tggcgaggca gtaggctttt 2460
aagttgcaag gcgagagagc aaagtgggac gcggcgtgat tattggtatt tacgcgacgg 2520
cccggcgcgt tagcggccct tcccccaggc cagggacgat tatgtatcaa tattgttgcg 2580
ttcgggcact cgtgcgaggg ctcctgcggg ctggggaggg ggatctggga attggaggta 2640
cgaccgagat ggcttgctcg gggggaggtt tcctcgccga gcaagccagg gttaggtgtt 2700
gcgctcttga ctcgttgtgc attctaggac cccactgcta ctcacaacaa gcccccatat 2760
gggcatcgat atggtgagca agggcgagga gctgttcacc ggcgtggtgc ccatcctggt 2820
ggagctggac ggcgacgtga acggccacaa gttcagcgtg cgcggcgagg gcgagggcga 2880
cgccaccaac ggcaagctga ccctgaagct gatctgcacc accggcaagc tgcccgtgcc 2940
ctggcccacc ctggtgacca ccctgggcta cggcctgcag tgcttcgccc gctaccccga 3000
ccacatgaag cgccacgact tcttcaagag cgccatgccc gagggctacg tgcaggagcg 3060
caccatcagc ttcaaggacg acggcaccta caagacccgc gccgaggtga agttcgaggg 3120
cgacaccctg gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat 3180
cctgggccac aagctggagt acaacttcaa cagccacaac gtgtacatca ccgccgacaa 3240
gcagaagaac ggcatcaagg ccaacttcaa gatccgccac aacgtggagg acggcggcgt 3300
gcagctggcc gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc 3360
cgacaaccac tacctgagct accagagcgt gctgagcaag gaccccaacg agaagcgcga 3420
ccacatggtg ctgctggagt tcgtgaccgc cgccggcatc acccacggca tggacgagct 3480
gtacaagggc ggcgggccca tggtgagcaa gggcgaggag ctgttcaccg gcgtggtgcc 3540
catcctggtg gagctggacg gcgacgtgaa cggccacaag ttcagcgtgc gcggcgaggg 3600
cgagggcgac gccaccaacg gcaagctgac cctgaagctg atctgcacca ccggcaagct 3660
gcccgtgccc tggcccaccc tggtgaccac cctgggctac ggcctgcagt gcttcgcccg 3720
ctaccccgac cacatgaagc gccacgactt cttcaagagc gccatgcccg agggctacgt 3780
gcaggagcgc accatcagct tcaaggacga cggcacctac aagacccgcg ccgaggtgaa 3840
gttcgagggc gacaccctgg tgaaccgcat cgagctgaag ggcatcgact tcaaggagga 3900
cggcaacatc ctgggccaca agctggagta caacttcaac agccacaacg tgtacatcac 3960
cgccgacaag cagaagaacg gcatcaaggc caacttcaag atccgccaca acgtggagga 4020
cggcggcgtg cagctggccg accactacca gcagaacacc cccatcggcg acggccccgt 4080
gctgctgccc gacaaccact acctgagcta ccagagcgtg ctgagcaagg accccaacga 4140
gaagcgcgac cacatggtgc tgctggagtt cgtgaccgcc gccggcatca cccacggcat 4200
ggacgagctg tacaagggcg gcacgcgtat ggtgagcaag ggcgaggagc tgttcaccgg 4260
cgtggtgccc atcctggtgg agctggacgg cgacgtgaac ggccacaagt tcagcgtgcg 4320
cggcgagggc gagggcgacg ccaccaacgg caagctgacc ctgaagctga tctgcaccac 4380
cggcaagctg cccgtgccct ggcccaccct ggtgaccacc ctgggctacg gcctgcagtg 4440
cttcgcccgc taccccgacc acatgaagcg ccacgacttc ttcaagagcg ccatgcccga 4500
gggctacgtg caggagcgca ccatcagctt caaggacgac ggcacctaca agacccgcgc 4560
cgaggtgaag ttcgagggcg acaccctggt gaaccgcatc gagctgaagg gcatcgactt 4620
caaggaggac ggcaacatcc tgggccacaa gctggagtac aacttcaaca gccacaacgt 4680
gtacatcacc gccgacaagc agaagaacgg catcaaggcc aacttcaaga tccgccacaa 4740
cgtggaggac ggcggcgtgc agctggccga ccactaccag cagaacaccc ccatcggcga 4800
cggccccgtg ctgctgcccg acaaccacta cctgagctac cagagcgtgc tgagcaagga 4860
ccccaacgag aagcgcgacc acatggtgct gctggagttc gtgaccgccg ccggcatcac 4920
ccacggcatg gacgagctgt acaagtaagg atccctggca gcagctggac cgcctgtacc 4980
atggagaaga gctttacttg ccgggatggc cgatttcgct gattgatacg ggatcggagc 5040
tcggaggctt tcgcgctagg ggctaggcga agggcagtgg tgaccagggt cggtgtgggg 5100
tcggcccacg gtcaattagc cacaggagga tcagggggag gtaggcacgt cgacttggtt 5160
tgcgaccccg cagttttggc ggacgtgctg ttgtagatgt tagcgtgtgc gtgagccagt 5220
ggccaacgtg ccacacccat tgagaagacc aaccaactta ctggcaatat ctgccaatgc 5280
catactgcat gtaatggcca ggccatgtga gagtttgccg tgcctgcgcg cgccccgggg 5340
gcgggggggg gacgggtggg gggtaggggg tctcacggga acagcacgct aggggtcagg 5400
gggggggggg ggcgcagttt agctgaccag ccgtgggatg atgcacgcat ttgcaaggac 5460
agggtaatca cagcagcaac atggtgggct taggacagct gtgggtcagt ggacggacgg 5520
caggggaggg acggcgcagc tcgggagaca gggggagaca gcgtgactgg cggccgccac 5580
cgcggtggag ctccagcttt tgttcccttt agtgagggtt aatttcgagc ttggcgtaat 5640
catggtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac 5700
gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa 5760
ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag ctgcattaat 5820
gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc 5880
tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg 5940
cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag 6000
gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc 6060
gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag 6120
gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga 6180
ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc 6240
atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg 6300
tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt 6360
ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca 6420
gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca 6480
ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag 6540
ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca 6600
agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg 6660
ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa 6720
aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta 6780
tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag 6840
cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga 6900
tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac 6960
cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc 7020
ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta 7080
gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac 7140
gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat 7200
gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa 7260
gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg 7320
tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag 7380
aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc 7440
cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct 7500
caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat 7560
cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg 7620
ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc 7680
aatattattg aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta 7740
tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg c 7791
<210>18
<211>42
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>18
ggaattccat atgggcatcg atatggtgag caagggcgag ga 42
<210>19
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>19
gggggcccgc cgcccttgta cagctcgtcc a 31
Claims (9)
1. The super-folding Venus yellow fluorescent protein SfvYFP is characterized in that the amino acid sequence is shown as a sequence table SEQ NO. 1.
2. The refolded wiener yellow fluorescent protein sfvYFP as claimed in claim 1, characterized in that the nucleotide sequence is shown in SEQ NO.2 of the sequence listing.
3. Recombinant plasmids containing a single sfyfp, two tandem sfyfps, or three tandem sfyfps.
4. The recombinant plasmid of claim 3 wherein said tandem is two SfvYFP linked by two glycine GGCGGC.
5. The recombinant plasmid of claim 3, wherein the recombinant plasmid containing a single SfvYFP is pCYX003 whose nucleotide sequence is shown in SEQ ID NO.11 of the sequence Listing; the recombinant plasmid containing two SfvYFP in series connection is pCYX004 with the nucleotide sequence shown in a sequence table SEQ NO. 14; the recombinant plasmid containing three SfvYFP in series is pCYX006 with the nucleotide sequence shown in a sequence table SEQ NO. 17.
6. Expression of single sfyfp, two tandem sfyfp or three tandem sfyfp in chlamydomonas reinhardtii.
7. The expression of claim 6, wherein the specific method is: the recombinant plasmid containing single SfvYFP, two serial SfvYFP or three serial SfvYFP recombinant plasmids is transferred into Chlamydomonas reinhardtii and integrated into a nuclear genome through single enzyme digestion linearization reaction, and a positive transformant with stable expression is obtained by screening.
8. The expression of claim 7, wherein the recombinant plasmid comprises the selectable marker ble or APHVIII.
9. The expression of claim 6, wherein the specific method is: the recombinant plasmid containing single SfvYFP, two serial SfvYFP or three serial SfvYFP is put into the recombinant plasmid containing antibiotic resistance gene ble or APHVIII and a promoter and a terminator thereof, and is transformed and integrated into the Chlamydomonas reinhardtii strain.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910347575.3A CN111848766A (en) | 2019-04-28 | 2019-04-28 | Hyper-folding Venus yellow fluorescent protein and expression thereof in Chlamydomonas reinhardtii |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910347575.3A CN111848766A (en) | 2019-04-28 | 2019-04-28 | Hyper-folding Venus yellow fluorescent protein and expression thereof in Chlamydomonas reinhardtii |
Publications (1)
Publication Number | Publication Date |
---|---|
CN111848766A true CN111848766A (en) | 2020-10-30 |
Family
ID=72964867
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910347575.3A Withdrawn CN111848766A (en) | 2019-04-28 | 2019-04-28 | Hyper-folding Venus yellow fluorescent protein and expression thereof in Chlamydomonas reinhardtii |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111848766A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114107348A (en) * | 2021-11-24 | 2022-03-01 | 南京理工大学 | Chlamydomonas reinhardtii-based protein interaction analysis method |
-
2019
- 2019-04-28 CN CN201910347575.3A patent/CN111848766A/en not_active Withdrawn
Non-Patent Citations (3)
Title |
---|
JEAN-DENIS PEDELACQ ET AL.: "Engineering and characterization of a superfolder green fluorescent protein", 《NATURE BIOTECHNOLOGY》 * |
JULIANE NEUPERT ET AL.: "Generation of Chlamydomonas strains that efficiently express nuclear transgenes", 《THE PLANT JOURNAL 》 * |
ROUHOLLAH BARAHIMIPOUR ET AL.: "Dissecting the contributions of GC content and codon usage to gene expression in the model alga Chlamydomonas reinhardtii", 《PLANT J.》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114107348A (en) * | 2021-11-24 | 2022-03-01 | 南京理工大学 | Chlamydomonas reinhardtii-based protein interaction analysis method |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2019203955B2 (en) | Multipartite signaling proteins and uses thereof | |
KR102181258B1 (en) | Virus like particle composition | |
CA2473187C (en) | Mismatch endonucleases and methods of use | |
KR102494564B1 (en) | Malaria vaccine | |
CN101935663B (en) | New wheat gene TaMYB3 for regulating synthetization and metabolization of anthocyanin | |
KR20090102876A (en) | Transgene expression in avians | |
CN115927299A (en) | Methods and compositions for increasing double-stranded RNA production | |
US20040142433A1 (en) | Polynucleotide sequence variants | |
CN108026538B (en) | Preparation method of sheath protein of porcine circovirus type 2 and pharmaceutical composition containing sheath protein | |
CN112011574B (en) | Lentiviral vector, construction method and application thereof | |
CN113652451B (en) | Lentiviral vector, construction method and application thereof | |
CN111848766A (en) | Hyper-folding Venus yellow fluorescent protein and expression thereof in Chlamydomonas reinhardtii | |
US11814412B2 (en) | Artificial proteins and compositions and methods thereof | |
KR101566371B1 (en) | Recombinant foot and mouth disease virus expressing protective antigen of Asia1 type standard vaccine strain and producing method thereof | |
CN112300952B (en) | Yarrowia lipolytica genetically engineered bacterium for producing alpha-pinene and application thereof | |
CN112852884B (en) | Rapid construction kit for circular RNA knock-down vector and application thereof | |
KR102341583B1 (en) | Preparation and purification method of recombinant human fibrost growth factor receptor by using solubility-enhancing bifunctional fusion tag combined with split intein and use thereof | |
CN116200368A (en) | Novel genome editing system based on C2C9 nuclease and application thereof | |
DK2921048T3 (en) | SUS SCROFA V2G: SAFE HARBOR PLACE FOR LONG-TERM EXPRESSION AND HIGH INTEGRATION OF TRANSGENERS IN A PIG | |
CN111484979A (en) | Liver tumor cell strain capable of tracing in vivo and construction method thereof | |
CN114058607B (en) | Fusion protein for editing C to U base, and preparation method and application thereof | |
CN116555335A (en) | Adjustable pilot editor and application thereof | |
US20040180352A1 (en) | Method of increasing complementarity in a heteroduplex | |
CN114644581A (en) | Amino acid containing aryl thiophenol or aryl selenol modified, recombinant protein, and biosynthesis method and application thereof | |
CN111041039B (en) | Thermophilic anaerobic ethanol bacillus genome editing vector and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WW01 | Invention patent application withdrawn after publication | ||
WW01 | Invention patent application withdrawn after publication |
Application publication date: 20201030 |