CN105200155A

CN105200155A - Application of EBV (Epstein Barr Virus) encoded microRNA (micro ribonucleic acid) BART6-3p

Info

Publication number: CN105200155A
Application number: CN201510727841.7A
Authority: CN
Inventors: 李桂源; 曾朝阳; 熊炜; 石磊; 李小玲; 李夏雨; 张文玲; 何宝玉; 向波; 彭淑平; 宋亚莉; 李俏
Original assignee: Central South University
Current assignee: Central South University
Priority date: 2015-10-30
Filing date: 2015-10-30
Publication date: 2015-12-30
Anticipated expiration: 2035-10-30
Also published as: CN105200155B

Abstract

The invention discloses an application of EBV (Epstein Barr Virus) encoded microRNA (micro ribonucleic acid) BART6-3p. The microRNA BART6-3p is mainly used for preparing a preparation for monitoring recurrence, metastasis and prognostic prediction of gastric carcinoma. Close correlation between expression of BART6-3p and prognosis of a patient with gastric carcinoma is discovered in an archived paraffin-embedded gastric carcinoma tissue sample through in-situ hybridization, the expression level of BART6-3p detected in gastric carcinoma tissue has a negative correlation with metastasis of the patient with gastric carcinoma, the survival time of the patient with high expression of BART6-3p is longer, and accordingly, BART6-3p can be taken as a prediction molecular marker for gastric carcinoma recurrence and metastasis. According to the application, a powerful tool for molecular biology is provided for auxiliary diagnosis and prognostic prediction of gastric carcinoma, and BART6-3p has profound clinical significance and great popularization and application prospects.

Description

The application of the microRNA BART6-3p of Epstein-Barr virus coding

Technical field

The invention belongs to oncomolecularbiology field, the microRNABART6-3p being specifically related to utilize Epstein-Barr virus to encode prepares the method for the transfer of monitoring recurrence of gastric cancer and prognosis prediction preparation.

Background technology

Epstein-Barr virus (EpsteinBarrvirus, EBV) be a kind of ubiquitous nerpes vinrus hominis, the adult population in the whole world about 95% can be infected, except having sub-fraction people once in a while and causing communicable mononucleosis, major part infected person there will not be any clinical symptom, in most cases EBV can in host long-term latent infection.But the EBV of latent infection can cause the generation of malignant tumour in some cases, comprise Hugh Burkitt and the He Jiejin lymphomas in B cell source, and epithelial cell origin nasopharyngeal carcinoma and cancer of the stomach etc.The mechanism that EBV causes malignant tumour to occur is not yet completely clear at present, may be relevant with the encode expression of series of genes of EBV itself, as the Latent membrane protein1 (LatentMembraneProtein1 of EBV coding, LMP1) as a kind of tumorigenesis albumen, the expression of oncogene in many host cells can be activated, suppress the structure and function of cyclin dependent kinase inhibitors.

EBV is about 170kb as its Genome Size of double-stranded DNA virus, except transcribed a series of protein coding gene, also finds EBV also codified one class Microrna (microRNA, miRNA) molecule recently.MiRNA is a kind of regulation type non-coding RNA being about 20 ~ 25nt, different from mRNA, and miRNA is not " bridge " between DNA and protein, but by being combined with goal gene target, the expression level of regulatory gene.EBV is first virus being found codified miRNA, and after entering host, namely EBV starts to express generation miRNA, plays biological action.Find EBV codified 25 miRNAs precursors at present, be processed into 44 ripe miRNAs, and the miRNAs of EBV coding cluster distribution on EBV genome, BART and BHRF1 two groups can be divided into.The miRNAs of EBV coding by the gene in the gene of regulation and control EBV coding itself or host cell, thus can take part in the malignancy of tumor conversion of EBV mediation, and impact comprises developing of the kinds of tumors of nasopharyngeal carcinoma, cancer of the stomach, lymphoma etc.But be not at present also very thorough for the encode research of miRNAs of EBV, in 44 ripe EBVmiRNAs, major part does not also have the report of functional study, and such as the research of the effects anb Mechanism of the miRNABART6-3p of relevant EBV coding is just seldom.Up to now about BART6-3p, at the solid tumor such as nasopharyngeal carcinoma, cancer of the stomach, the relation of developing effect occurs and all do not have bibliographical information in the early screening, auxiliary diagnosis or outcome prediction etc. of solid tumor patient.

We are shown by research, the expression of BART6-3p in nasopharyngeal carcinoma and stomach organization all significantly raises, but very ironically in nasopharyngeal carcinoma and stomach organization, the expression level of BART6-3p and the relapse and metastasis of nasopharyngeal carcinoma and patients with gastric cancer are negative correlativing relation, patient's generation recurrence easier than the patient of high expression level BART6-3p of low expression BART6-3p and transfer, prognosis is poorer.Although this shows that EBV is clearer and more definite tumorigenicity virus, but not the gene of EBV coding all has the effect promoting tumor development, portion gene, comprise BART6-3p and may have anti-tumor function, this also shows the expression level of EBVmiRNAs and tumor recurrence, shift the relation of the clinical phenotypes such as prognosis can not infer, could can only be determined by concrete and careful experimental study.Therefore, for BART6-3p design specialized in situ hybridization probe and detection kit, or the expression level utilizing BART6-3p Auele Specific Primer to carry out BART6-3p in the technology for detection nasopharyngeal carcinoma such as real-time fluorescence quantitative PCR and stomach organization is expected to provide reference for the prediction of recurring tumour clinically and shift.

The BART6-3p of our transfection synthetic in nasopharyngeal carcinoma and stomach cancer cell, confirming to express BART6-3p in the nasopharyngeal carcinoma and stomach cancer cell of EBV feminine gender can the obviously growing multiplication of inhibition tumor cell and Invasion and Metastasis ability.Therefore, BART6-3p may be used for again preparing the preparation of inhibition tumor cell growth, propagation and the transfer of prophylaxis of tumours cell invasion.

We have also been devised a series of experiment and have detected the molecular mechanism that BART6-3p plays biological function in nasopharyngeal carcinoma and stomach cancer cell, we find a BART6-3p interior long-chain non-coding RNA (longnon-codingRNA capable of inhibiting cell, lncRNA) expression (ReferenceSequence:NR_110997) of gene LOC553103, we devise RNA interference sequence (siRNA) transfection nasopharyngeal carcinoma for LOC553103 and stomach cancer cell, after suppressing the expression of LOC553103, there is the cytobiology phenotype of similar transfection BART6-3p in cell, namely inhibition tumor cell grows and breeds and inhibition tumor cell invasion inhibition ability.Therefore, also may be used for preparing the preparation of inhibition tumor cell growth, propagation and the transfer of prophylaxis of tumours cell invasion for the RNA interference sequence (siRNA) of LOC553103.Before this, about the function of LOC553103 has no any bibliographical information.

Cytoskeleton be built by microtubule, microfilament and median fiber three kinds of thiozells in eukaryotic cell be present in intracytoplasmic network structure, three kinds of composition hight coordinate distributions, karyon, plasma membrane, each organoid are connected together, constitutes the supporting system of cellular form maintenance and motor coordination.Research in recent years shows that the dynamic regulation of Tumor Cell Migration migration and invasion ability and cytoskeleton is closely related, and the medicine of targeting cytoskeleton also can the propagation of inducing apoptosis of tumour cell inhibition tumor cell.We confirm the expression of BART6-3p by LOC553103 in targeted inhibition host cell by serial experiment, affect the assembling of microtubule microfilament in tumour cell, the reconstruct of regulating cell skeleton, finally causes growth of tumour cell, propagation, invasion and attack, the isophenous change of transfer.Therefore, BART6-3p and the RNA interference sequence (siRNA) for LOC553103 can also for the preparation of the assembling of inhibition tumor cell skeleton and the preparations reconstructed.

In addition, we detect again the expression situation of LOC553103 in the clinical sample of nasopharyngeal carcinoma and cancer of the stomach, find its high expression level in the other control tissue of cancer, and low expression in most of tumor tissues, and be negative correlation with the expression of BART6-3p, the expression of LOC553103 can as the index of patient's prognosis, therefore, for the real-time fluorescence quantitative PCR primer of LOC553103 design specialized and detection kit or in situ hybridization probe and detection kit, expression level for detecting nasopharyngeal carcinoma and stomach organization LOC553103 is expected to for carrying out relapse and metastasis to these two kinds of tumours clinically and prognosis prediction provides reference.

In a word, our research discloses BART6-3p and the new function of lncRNA gene LOC553103 in the Incidence such as nasopharyngeal carcinoma and cancer of the stomach process, for the application method of BART6-3p and LOC553103 provides real example.

Summary of the invention

The application of the microRNABART6-3p that the object of the present invention is to provide a kind of Epstein-Barr virus to encode, specifically utilize the sequence of BART6-3p for the preparation of the preparation of monitoring recurrence of gastric cancer transfer and prognosis prediction, comprising: real-time fluorescence quantitative PCR primer and reagent, in situ hybridization probe and hybridization in situ detection kit etc.

The application of the microRNABART6-3p of Epstein-Barr virus coding, the microRNABART6-3p of Epstein-Barr virus coding is for the preparation of the preparation of monitoring recurrence of gastric cancer transfer and prognosis prediction; In stomach organization, the expression level of BART6-3p and the transfer of patients with gastric cancer are negative correlativing relation, and BART6-3p expresses high patient and is not easy recurrence, and survival time is longer; The sequence of BART6-3p: CGGGGAUCGGACUAGCCUUAGA.

Described monitoring recurrence of gastric cancer transfer and the preparation of prognosis prediction are that in situ hybridization detects preparation or real-time fluorescence quantitative PCR reagent.

Described in situ hybridization detects the in situ hybridization probe that preparation comprises the microRNABART6-3p detecting Epstein-Barr virus coding, and sequence is: UCUAAGGCUAGUCCGAUCCCCG.

Described in situ hybridization detection reagent is test kit.

Test kit comprises: the in situ hybridization probe detecting the microRNABART6-3p of Epstein-Barr virus coding, and sequence is: UCUAAGGCUAGUCCGAUCCCCG; Detect the in situ hybridization probe of reference gene GAPDH, sequence is: CAGUAGAGGCAGGGAUGAUGUUCU.

Test kit also comprises:

Digoxin oligonucleotide tailing reagent, anti-digoxin-horseradish peroxidase complex detection reagent, DAB staining reagent;

Other conventional biochemical reagent, comprise 20x sodium citrate buffer (salinesodiumcitrate, SSC), T 500 (Dextransulphate), deionized formamide (DeionizedFormamide), polyadenylic acid (polyadenylicacid, PolyA), poly deoxyadenylic acid (polydeoxyadenylicacid, PolydA), salmon sperm DNA (the denaturedandshearedsalmonspermDNA that sex change is sheared, ssDNA), yeast transfer RNA (yeastt-RNA, tRNA), dithiothreitol (DTT) (DTT), Deng 50x Han Shi damping fluid (Denhardts ' ssolution), phosphoric acid buffer (PBSbuffer), stomach en-K, bovine serum albumin (BSA), trolamine (TEA), acetic anhydride, block reagent (Blockingreagentagent), TNB damping fluid (that is: the 0.1MTris-Cl+0.15MNaCl+0.5% of pH7.5 blocks reagent), TNT damping fluid (that is: the 0.1MTris-Cl+0.15MNaCl+0.05%Tween20 of pH7.5).

By in situ hybridization, we find that in the cancer of the stomach paraffin organization sample filed the prognosis of the expression of the microRNABART6-3p that Epstein-Barr virus is encoded and patients with gastric cancer is closely related, detects that in stomach organization the expression level of the microRNABART6-3p that Epstein-Barr virus is encoded and the transfer of patients with gastric cancer are negative correlativing relation.It is longer that the microRNABART6-3p that Epstein-Barr virus is encoded expresses the high survival of patients time, and the microRNABART6-3p of prompting Epstein-Barr virus coding can be used as the predictive molecule mark of recurrence of gastric cancer and transfer.The present invention is that the auxiliary diagnosis of cancer of the stomach and prognosis prediction provide strong biology tool, has far-reaching clinical meaning and important popularizing application prospect.

Accompanying drawing explanation

Fig. 1 is that Real-Time Fluorescent Quantitative PCR Technique detects the expression of BART6-3p in nasopharyngeal carcinoma and normal nasopharyngeal epithelium,

Significantly improve (P<0.001) in the expression ratio normal nasopharyngeal epithelium (N) of BART6-3p in nasopharyngeal carcinoma (T).

Fig. 2 is that in situ hybridization detects the expression of BART6-3p in nasopharyngeal carcinoma and normal nasopharyngeal epithelium,

The left side is a routine Nasopharyngeal Carcinoma During Biopsy sample, and BART6-3p is high expression level in cancerous tissue, and low expression in other (Adjacency) normal nasopharyngeal epithelium of cancer; The right is another routine cancer other normal nasopharyngeal epithelium sample, and BART6-3p substantially can't detect in cancer beside organism.

Fig. 3 is the statistics of BART6-3p in situ hybridization data in the other epithelium of nasopharyngeal carcinoma and cancer,

In the other normal epithelial (AdjacencyofNPC) of 40 routine nasopharyngeal carcinoma cancer, there is the expression of 34 routine BART6-3p low, even substantially, can't detect (negative), and 57 examples detect the high expression level (high) of BART6-3p in 115 routine nasopharyngeal carcinoma (NPC), all the other 58 examples are low expression (low), P<0.001.

Fig. 4 is the expression of BART6-3p and the dependency of distant metastasis of nasopharyngeal carcinoma,

In 115 routine nasopharyngeal carcinoma samples, 92 examples there occurs relapse and metastasis, wherein 31 examples are original position recurrence (localrelapse), 61 examples are distant metastasis (distanceMetastasis), the ratio of BART6-3p high expression level in the patient of distant metastasis lower (P<0.05) can be found out from statistics, show that the expression of BART6-3p and tumor recurrence shift in negative correlation.

Fig. 5 is the expression of BART6-3p and the relation of Nasopharyngeal Carcinoma Patients prognosis,

In nasopharyngeal carcinoma the expression of BART6-3p and the prognosis of Nasopharyngeal Carcinoma Patients closely related, namely the survival of patients time of BART6-3p high expression level (High) obviously will be longer than the patient (P<0.05) of the low expression of BART6-3p (Low).

Fig. 6 is that in situ hybridization detects the expression of BART6-3p in cancer of the stomach and the other epithelium of cancer,

The left side is a routine biopsy samples from stomach cancer, and BART6-3p is high expression level in cancerous tissue; The right is Carcinoma side normal tissue sample, and BART6-3p substantially can't detect in cancer beside organism.

Fig. 7 is the expression of BART6-3p and the relation of patients with gastric cancer prognosis,

The expression of BART6-3p and the prognosis of patients with gastric cancer closely related, namely the survival of patients time of BART6-3p high expression level (High) obviously will be longer than the patient (P=0.04) of the low expression of BART6-3p (Low).

Fig. 8 imports BART6-3p oligonucleotide sequence in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender, and the expression of BART6-3p in tumour cell significantly raises,

Import BART6-3p oligonucleotide sequence in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender after, real time fluorescence quantifying PCR method have detected the expression of BART6-3p in tumour cell, and the expression of BART6-3p significantly raises.Negative control (NC) is for importing scramble sequence.

Fig. 9 is that the multiplication capacity of cell import BART6-3p oligonucleotide sequence in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender after reduces, and the speed of growth slows down.

Figure 10 is that import BART6-3p oligonucleotide sequence in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender after, cell migration ability reduces,

Cell scratch experiment confirms, BART6-3p oligonucleotide sequence is imported in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender, after the expression of artificial promotion BART6-3p, from cut both sides toward cut, central authorities' travelling speed obviously slows down tumour cell, the time lengthening of cut healing, show that cell movement transfer ability reduces, negative control (NC) is for importing scramble sequence.

Figure 11 is that the invasive ability of cell import BART6-3p oligonucleotide sequence in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender after reduces,

Cell-penetrating (transwell) experiment confirms, BART6-3p oligonucleotide sequence is imported in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender, after the expression of artificial promotion BART6-3p, significantly can reduce through the tumor cell number of matrix glued membrane, show that cell invasion ability reduces, negative control (NC) is for importing scramble sequence.

Figure 12 is the expression that BART6-3p can lower lncRNA gene LOC553103 in cell,

Import BART6-3p oligonucleotide sequence in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender after, real-time fluorescence quantitative PCR detects and finds that the expression of lncRNA gene LOC553103 all significantly lowers (P<0.05).

Figure 13 is specificity can the effectively expression of LOC553103 in T suppression cell for the RNA interference sequence (siRNA) of lncRNA gene LOC553103,

We devise the RNA interference sequence (siRNA1 of 3 specificitys for LOC553103, siRNA2 and siRNA3, be abbreviated as S1, S2 and S3) be transfected into EBV feminine gender nasopharyngeal carcinoma cell 5-8F (left side), HNE2 (in) and stomach cancer cell AGS (right side) in after real-time fluorescence quantitative PCR detect and find that the expression of lncRNA gene LOC553103 is all significantly lowered.

Figure 14 be in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS import for specificity for lncRNA gene LOC553103 RNA interference sequence (siRNA) afterwards cell multiplication capacity reduce, the speed of growth slows down.

Figure 15 imports specificity to reduce for RNA interference sequence (siRNA) the cell migration ability afterwards of lncRNA gene LOC553103 in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS,

Cell scratch experiment confirms, the RNA interference sequence (siRNA) of specificity for lncRNA gene LOC553103 is imported in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS, after the expression of artificial suppression LOC553103, from cut both sides toward cut, central authorities' travelling speed obviously slows down tumour cell, the time lengthening of cut healing, show that cell movement transfer ability reduces, negative control (NC) is for importing scramble sequence.

Figure 16 imports specificity to reduce for the invasive ability of cell after RNA interference sequence (siRNA) sequence of lncRNA gene LOC553103 in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS,

Cell-penetrating (transwell) experiment confirms, RNA interference sequence (siRNA) sequence of specificity for lncRNA gene LOC553103 is imported in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS, after the expression of artificial suppression LOC553103, significantly can reduce through the tumor cell number of matrix glued membrane, show that cell invasion ability reduces, negative control (NC) is for importing scramble sequence.

Figure 17 be nude mice tail vein injection Lung metastases become knurl to test to confirm further to import in the nasopharyngeal carcinoma cell 5-8F of EBV feminine gender BART6-3p or specificity all can the Invasion and Metastasis ability of inhibition tumor cell for the RNA interference sequence (siRNA) of lncRNA gene LOC553103.

BART6-3p or the specificity RNA interference sequence (siLOC) for lncRNA gene LOC553103 is imported in the nasopharyngeal carcinoma cell 5-8F of EBV feminine gender, after the expression of artificial process LAN BART6-3p or suppression LOC553103, by the cell that processed through tail vein injection in nude mouse, continue raising 40 days subsequently, finally put to death nude mice, observe the neoplastic situation of transfer in each group of nude mice lungs, arrow is depicted as metastatic tumor.Transfection BART6-3p or specificity are obviously less than negative control group for the metastatic tumor number in two groups of nude mice lung tissues of the RNA interference sequence of lncRNA gene LOC553103, further demonstrate that the expression of process LAN BART6-3p or suppression LOC553103 all can inhibition tumor cell invasion inhibition.

Figure 18 is that nude mice tail vein injection Lung metastases becomes knurl experimental result to add up.

Figure 19 be nude mice by subcutaneous become knurl to test to confirm further to import in the nasopharyngeal carcinoma cell 5-8F of EBV feminine gender BART6-3p or specificity for lncRNA gene LOC553103 RNA interference sequence (siRNA) all can the growth of inhibition tumor cell, propagation

BART6-3p or the specificity RNA interference sequence (siLOC) for lncRNA gene LOC553103 is imported in the nasopharyngeal carcinoma cell 5-8F of EBV feminine gender, after the expression of artificial process LAN BART6-3p or suppression LOC553103, by the cell infusion that processed to nude mice by subcutaneous, continue raising 30 days subsequently, finally put to death nude mice, observe the size of each group of Xenografts in nude mice.Transfection BART6-3p or specificity obviously little than negative control group for two groups of Xenografts in nude mice of the RNA interference sequence of lncRNA gene LOC553103, further demonstrate that process LAN BART6-3p or suppress the expression of LOC553103 all can the growth of inhibition tumor cell and propagation.

Figure 20 is Xenografts in nude mice experimental result statistics;

BART6-3p or the specificity RNA interference sequence (siLOC) for lncRNA gene LOC553103 is imported in the nasopharyngeal carcinoma cell 5-8F of EBV feminine gender, after the expression of artificial process LAN BART6-3p or suppression LOC553103, by the cell infusion that processed to nude mice by subcutaneous, continue raising 30 days subsequently, within every 5 days, measure the size of subcutaneous transplantation knurl, the expression that statistics shows process LAN BART6-3p or suppresses LOC553103 all can the growth of inhibition tumor cell and propagation.

Figure 21 is that BART6-3p can affect cytoskeletal structure in tumour cell,

BART6-3p people is imported for after process LAN BART6-3p in the nasopharyngeal carcinoma cell 5-8F of EBV feminine gender, specific marker cytoskeleton (F-actin), tested by cellular immunofluorescence, after fluorescence microscopy Microscopic observation finds process LAN BART6-3p, cytoskeletal structure there occurs obvious change, shows that the process LAN of BART6-3p have impact on the assembling of microtubule microfilament in tumour cell.(DAPI is nucleus specific dye)

Figure 22 is that the expression of interference lncRNA gene LOC553103 can affect cytoskeletal structure in tumour cell,

Import the expression of specificity for RNA interference sequence (siRNA) the artificial reduction LOC553103 of lncRNA gene LOC553103 in nasopharyngeal carcinoma cell 5-8F after, specific marker cytoskeleton (F-actin), tested by cellular immunofluorescence, find that interference LOC553103 expresses rear cytoskeletal structure and there occurs obvious change at fluorescence microscopy Microscopic observation, show the assembling of microtubule microfilament in LOC553103 modulate tumor cell.(DAPI is nucleus specific dye)

Figure 23 is that Real-Time Fluorescent Quantitative PCR Technique detects the expression of LOC553103 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium;

Significantly reduce (P<0.001) in the expression ratio normal nasopharyngeal epithelium (N) of LOC553103 in nasopharyngeal carcinoma (NPC), and be negative correlation with the expression of BART6-3p.

Figure 24 is that Real-Time Fluorescent Quantitative PCR Technique detects the expression of LOC553103 in cancer of the stomach and the other normal control tissue of cancer;

Significantly (P<0.001) is reduced in the other control tissue (N) of the expression ratio cancer of LOC553103 in cancer of the stomach (T).

Figure 25 is that in situ hybridization detects the expression of LOC553103 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium;

The left side is the other control tissue sample of a routine nasopharyngeal carcinoma cancer, and LOC553103 is high expression level in the other epithelium of cancer; The right is a routine tissues of nasopharyngeal carcinoma sample, and LOC553103 substantially can't detect in tissues of nasopharyngeal carcinoma, and the expression of LOC553103 in tissues of nasopharyngeal carcinoma and BART6-3p are negative correlation significantly.

Figure 26 is the expression of LOC553103 and the relation of Nasopharyngeal Carcinoma Patients prognosis

The expression of LOC553103 and the prognosis of Nasopharyngeal Carcinoma Patients closely related, just contrary with BART6-3p, namely the survival of patients time of LOC553103 high expression level (High) will be significantly shorter than the patient (P<0.05) of the low expression of LOC553103 (Low).

Figure 27 is that in situ hybridization detects the expression of LOC553103 in cancer of the stomach and the other control tissue of cancer;

The left side is the other control tissue sample of a routine Stomach Carcinomas, and LOC553103 is high expression level in cancer beside organism; The right is a routine stomach organization sample, and LOC553103 expresses lower in tissues of nasopharyngeal carcinoma.

Figure 28 is the expression of LOC553103 and the relation of patients with gastric cancer prognosis

The expression of LOC553103 and the prognosis of patients with gastric cancer closely related, just contrary with BART6-3p, namely the survival of patients time of LOC553103 high expression level (High) will be significantly shorter than the patient (P<0.05) of the low expression of LOC553103 (Low).

Embodiment

The present invention is further illustrated below in conjunction with embodiment, and unrestricted the present invention.

Embodiment 1, quantitative real-time PCR detects and confirms that BART6-3p raises at nasopharyngeal carcinoma

1. materials and methods:

Collect 5 routine normal nasopharyngeal epithelium and 18 routine tissues of nasopharyngeal carcinomas, by Trizol (invitrogen Products) extracted total RNA, after 2 μ gRNA miScript Reverse Transcriptase kit (Qiagen Products) reverse transcriptions become cDNA, carry out with QuantiTectSYBRGreenPCR test kit (Qiagen Products) expression that real-time fluorescence quantitative PCR detects BART6-3p and reference gene RNU6B.The common primers (UniversalPrimer) of microRNA and the Auele Specific Primer of BART6-3p and RNU6B are by Qiagen company designs and synthesize.

Real-time fluorescence quantitative PCR reaction system

Real-time fluorescence quantitative PCR reactions steps

194℃5min

295℃10sec

358℃30sec

472℃20sec

5Plateread

682℃30sec

7Plateread

8Gotostep2formore39times

9Performmeltingcurvefrom55.0℃to95.0℃，readevery0.2℃，holdfor1sec

Reaction terminates amplification curve and the melting curve of rear confirmation real-time fluorescence quantitative PCR, the expression intensity of each gene, according to after CT value (thresholdcyclevalues), reference gene (RNU6B) markization, adopts groupt-test inspection to calculate P value.

2. result

BART6-3p does not express or expresses very low in normal control tissue, and in tissues of nasopharyngeal carcinoma high expression level P<0.001 (Fig. 1)

Embodiment 2, in situ hybridization detects and finds that BART6-3p is relevant to patient's prognosis with the expression in cancer of the stomach in nasopharyngeal carcinoma

1. MATERIALS METHODS

1.1 design and synthesize hybridization probe

In order to the expression adopting in-situ hybridization method to detect BART6-3p, we devise the oligonucleotide probe and the positive control in situ hybridization oligonucleotide probe that detect BART6-3p expression in situ hybridization.

BART6-3p probe: UCUAAGGCUAGUCCGAUCCCCG

Positive control probe (detecting house-keeping gene GAPDH):

GAPDH probe: CAGUAGAGGCAGGGAUGAUGUUCU

Adopt chemical synthesis process to synthesize each gene specific oligonucleotides probe sequence of above-mentioned design, in building-up process middle probe sequence, uridylic has marked vitamin H (bio-U).

1.2 oligonucleotide probe labelling kits and in situ hybridization detection reagent

Digoxin oligonucleotide tailing reagent (DigOligonucleitideTailingKit2 ^ndgeneration, Roche company), anti-digoxin-horseradish peroxidase complex detection kit (Anti-Digoxigenin-POD, Fabfragments, Roche company), strengthen the TSA signal amplifying system (TSA of expressed in situ detection signal ^tMbiotinSystem, NEL700 test kit, PerkinElmer company), DAB staining kit (Beijing Zhong Shan company), 20x sodium citrate buffer (salinesodiumcitrate, SSC), T 500 (Dextransulphate), deionized formamide (DeionizedFormamide), polyadenylic acid (polyadenylicacid, PolyA), poly deoxyadenylic acid (polydeoxyadenylicacid, PolydA), salmon sperm DNA (the denaturedandshearedsalmonspermDNA that sex change is sheared, ssDNA), yeast transfer RNA (yeastt-RNA, tRNA), dithiothreitol (DTT) (DTT), Deng 50x Han Shi damping fluid (Denhardts ' ssolution), phosphoric acid buffer (PBSbuffer), stomach en-K, bovine serum albumin (BSA), trolamine (TEA), TNBBuffer (0.1MTris-HCl, pH7.5, 0.15MNaCL, 0.5%BlockingReagent), TNTBuffer (0.1MTris-HCl, pH7.5, 0.15MNaCL, 0.05%Tween20), acetic anhydride, block reagent (Blockingreagentagent, Roche company).

1.3 other main agents and materials

Dehydrated alcohol, 90% alcohol, 70% alcohol, 50% alcohol, turps, distilled water, PBS damping fluid (pH7.2 ~ 7.4, NaCl137mmol/L, KCl2.7mmol/L, Na ₂hPO ₄4.3mmol/L, KH ₂pO ₄1.4mmol/L); 3% methyl alcohol-hydrogen peroxide solution (80% methyl alcohol and the configuration of 30% hydrogen peroxide); 0.01mol/L citrate buffer (citratebuffer, CB, pH6.0 ± 0.1,9ml0.1M citric acid solution and 41ml0.1M sodium citrate solution to add in 450ml distilled water after provisional configuration again correction work liquid pH value); 0.1% trypsinase; Hematorylin; 1% hydrochloride alcohol (configuration of 1ml concentrated hydrochloric acid+99ml70% alcohol); Mounting glue (PTSCureMount II).Leica low melting point (58 DEG C) paraffin, domestic beeswax, raw spirit, dimethylbenzene, 10% neutral paraformaldehyde (0.01mol/L, pH7.4, DEPC distilled water and PBS buffer), Hematorylin, Yihong, neutral mounting natural gum, cover glass, slide glass.

1.4 label probe

Utilize 3-tailingDIGOlignucleutideKit to carry out oligonucleotide probe mark, reaction system is as follows.

100pmololigonucleotide+ddH ₂O＝9μl(control:controloligonucleutide5μl+ddH ₂O4μl)

Mixing, slightly centrifugal.37 DEG C of water-bath 30min, add 2 μ lEDTA (0.2M, PH8.0) stopped reactions.

Purifying after 1.5 oligonucleotide probe marks

In order to increase the purity of label probe, need carry out purifying to the probe marked, concrete operations are as follows:

1) probe reaction mixture (22 μ l)+2.5 cold ethanol of μ l4MLiCl+75 μ l100% (-20 DEG C).

2)-70 DEG C of precipitations 60min, or-20 DEG C of 2h.

3) 13.000 × g4 DEG C of centrifugal 15min.

4) supernatant is abandoned, by 70% (V/V) washing with alcohol that 50 μ l are ice-cold.

5) 13.000xg4 DEG C, centrifugal 5min.

6) supernatant is abandoned, vacuum 4 DEG C of dryings.

7) with the heavy molten probe of aseptic double-distilled water.

1.6 in situ hybridizations detect the expression of BART6-3p in file paraffin section

Paraffin section hybridization pre-treatment

1) 4 DEG C of paraffin sections preserved are placed in 58 DEG C of roasting sheet 30min, melted surface paraffin.

2) dimethylbenzene dewaxes 3 × 5min successively.

3) step ethanol wash, 100% alcohol 2 × 2min → 95% alcohol 1 × 5min → 70% alcohol 1 × 5min → 50% alcohol 1 × 5min → DEPC water washing 2 × 3min → DEPC-PBS washs 2 × 5min.

4) 300 μ l stomach en-K (10 μ g/ml) are dripped in section, 37 DEG C of digestion 20min.

5) cut into slices and wash 1min, stopped reaction into PBS (0.1MPBS+2mg/ml L-glutamic acid).

6) cut into slices into 0.2NHCL, in 37 DEG C of reaction 20-30min, increase the permeability of tissue.

7) section fixes 10min, room temperature afterwards with 4% paraformaldehyde (0.1MPBS dissolving).

8) organize positive intensity for hybridization to increase, acetyl process is carried out to section.Cut into slices into 0.25% diacetyl oxide Buffer I (0.1M trolamine), room temperature 10min.

9) 1MPBS washs 2 × 5min.

Prehybridization and hybridization

Prehybridization :-20 DEG C of prehybridization solutions preserved, be first placed in 37 DEG C and hatch 60min, the consumption of prehybridization solution is 50 μ l, and Parafilm carries out lid section, prehybridization 2 hours in 37 DEG C of wet boxes.(prehybridization solution composition comprises: 2XSSC, 10%Dextransulphate, 1XDenhardt ' ssolution, 50mMPhosphateBuffer (PH7.0), 50mMDTT, 250 μ l, 100 μ g/mlpolyA, 5 μ g/mlpolydA, 250 μ g/mlyeastt-RNA, 500 μ g/mlssDNA, 47%Deionizedformamide).

1) remove Parafilm, get rid of prehybridization solution, section is placed in 2 × SSC 5min.

2) hybridization: 37 DEG C of hybridized overnight (18-20h).Each section adds 250 μ l hybridization solutions and carries out lid with Parafilm.Add corresponding probe in prehybridization solution and just become hybridization solution.Hybridization solution is prepared when prehybridization, places 37 DEG C and hatches, probe is fully dissolved in hybridization solution, and this final concentration of testing hybridization solution middle probe used is 500ng/ml.

3) post-hybridization washing, section immersion 2 × SSC, 10min, throws off Parafilm.Shake washing on shaking table successively, 2 × SSC (0.5%SDS), 2 × 15min → 0.25 × SSC (0.5%SDS), 2 × 15min.

Color developing detection reaction after hybridization

1) Anti-Digoxigenin-POD is adopted to detect digoxigenin-probe with mRNA in conjunction with mixture; TSA amplification system strengthens the positive signal of in situ hybridization reaction solution reaction, and DAB develops the color.

2) section goes in TNT damping fluid, 3 × 5min.

3) drip TNB and block damping fluid, 300 μ l/TMAs, room temperature, 30min.

4) unnecessary blocker is sucked, the Anti-Digoxigenin-POD (TBS+0.1%TritonX-100+1% blocker) of 1:100 dilution, room temperature 4 hours.

5) TNTBuffer (0.1MTris-CL, pH7.5,0.15MNaCL, 0.05%Tween20) washing, 3x5min.

6) section drips signal and amplify reagent BiotinylTyamid, 300 μ l/TMAs, (BiotinylTyramid stock solution: BiotinylTyramid is dissolved in 0.2mlDMSO, BiotinylTyramid working fluid: 1 × diluent, 1:50 dilutes BiotinylTyramid stock solution), room temperature 10 minutes.

7) TNT washes, 3 × 5min.

8) section drips SA-HRP (strepto-avidin-horseradish peroxidase), 300 μ l/TMAs, room temperature 30min.

9) TNT washes, 3 × 5min.

10) aquae destillata washing, 1 × 1min.

11) DAB colour developing, controls color reaction under microscope.

12) Hematorylin is redyed,

13) alcohol step dehydration, chip drying.

14) mounting glue is dripped, the cover glass cover plate of dimension, crosslinked section 1min under ultraviolet lamp.

1.7 results judge and standard

Applied optics microscope is observed respectively under low power and high power lens, and first the positive expression signal of object observing RNA is in the intracellular location of object observing: be positioned at nucleus, cytoplasm or cytolemma.

Carry out comprehensive grading with cell count two kinds of standards of the intensity of this detection rna expression position positive signal and positive expression respectively again, judging criterion is: (1) judges according to positive cell dyeing intensity: a. cell dye-free, remembers 0 point; B. cell dyes light brown is the weak positive, remembers 1 point; C. cell is dyed brown and without background coloration, or cell is dyed dark-brown and has light brown background to be moderate positive, remembers 2 points; D. cell is dyed dark-brown and is strong positive without background coloration, remembers 3 points.(2) express number score according to positive cell: the no positive cell expressing of a., remember 0 point; B. positive expression cell count≤25%, remembers 1 point; C.25% < positive cell number < 50%, remembers 2 points; D. positive expression cell count >=50%, remembers 3 points.

In order to reduce the subjective factor of appraisal result as far as possible, carried out separately judging and marking by one of above-mentioned standard respectively by two pathology experts, then both scorings be multiplied, result is: 1. 0 point of person finally counts 0 point, thinks negative and expresses; 2. 1 point and 2 points of persons finally count 1 point, think weak positive expression; 3. 3 points and 4 points of persons finally count 2 points, think that moderate positive is expressed; 4. 6 assign to 9 points of persons and finally count 3 points, think that strong positive is expressed.

1.8 analyze and statistical software

Application SPSS13.0 statistical software carries out statistical analysis to experimental result, compares between two and uses χ ²test or Fisherexacttest, correlation analysis adopts Spearmencorrelation method; P < 0.05 i.e. difference has statistical significance.Survival curve analysis adopts Kaplan-Meiermethod and log-ranktest; Multivariate analysis adopts Cox ' sproportionalhazardsmodel; P < 0.05 i.e. difference has statistical significance.

2 results

Expression in the other control tissue of the expression ratio cancer of 2.1BART6-3p in nasopharyngeal carcinoma significantly raises

In the other nasopharyngeal epithelium (AdjacentEpithelialofNPC) of 40 routine cancer, there is the expression of 34 routine BART6-3p low (Low) or substantially can't detect (negative), and 57 examples detect the low expression (Low) of BART6-3p in 115 routine nasopharyngeal carcinoma (NPC), all the other 58 examples are high expression level (high), P<0.001 (Fig. 2 and Fig. 3).

2.2BART6-3p expression level and nasopharyngeal carcinoma shift Close relation

We queried the clinical data of 115 routine Nasopharyngeal Carcinoma Patients, such as age of onset, sex, TNM are by stages etc., and Effect of follow-up visit by telephone has been carried out to them, detailed inquired them start time, treatment situation, with or without recurrence, with or without suffering from other diseases, recurrence and death time etc. again, and register survival time and state.We find in tissues of nasopharyngeal carcinoma, detect that the distant metastasis (Distancemetastasis) of the expression level of BART6-3p and Nasopharyngeal Carcinoma Patients is in negative correlativing relation, namely the expression level of distant metastasis group BART6-3p is more relatively low than original position recurrence group (Localrelapse), (Fig. 4, P<0.05).

2.3BART6-3p the Nasopharyngeal Carcinoma Patients prognosis of low expression is poor

The survival analysis that we carry out the expression of BART6-3p in tissues of nasopharyngeal carcinoma and the survival time of patient and state, find that the expression of BART6-3p and the prognosis of Nasopharyngeal Carcinoma Patients are closely related in nasopharyngeal carcinoma, the survival of patients time of BART6-3p high expression level (High) obviously will be longer than the patient (Fig. 5) of the low expression of BART6-3p (Low).

Expression in the other control tissue of the expression ratio cancer of 2.4BART6-3p in cancer of the stomach significantly raises

In 37 routine stomach organizations, 29 examples detect the low expression (Low) of BART6-3p, other 8 examples are high expression level (high), and in the cancer beside organism that these cancer of the stomach samples are corresponding, have the expression of 35 routine BART6-3p low (Low) or substantially can't detect (negative), only 2 examples are that BART6-3p is positive, P<0.05 (Fig. 6).

2.5BART6-3p the patients with gastric cancer prognosis of low expression is poor

The survival analysis that we carry out the expression of BART6-3p in stomach organization and the survival time of patient and state, find that the expression of BART6-3p and the prognosis of patients with gastric cancer are closely related in cancer of the stomach, the survival of patients time of BART6-3p high expression level (High) obviously will be longer than the patient (Fig. 7) of the low expression of BART6-3p (Low).

Embodiment 3, the growing multiplication of process LAN BART6-3p inhibition tumor cell and Invasion and Metastasis

1. MATERIALS METHODS

1.1 cell cultures and transfection

Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 of EBV feminine gender, stomach cancer cell AGS is all purchased from Central South University's cell centre, and cell cultures RPMI1640 used trains base and foetal calf serum, and peptic cell trypsinase used is U.S. Gibco Products.

BART6-3p is synthesized by chemical synthesis by Invitrogen company, and sequence is:

CGGGGAUCGGACUAGCCUUAGA

By tumor cell line good for growth conditions by 2 × 10 ⁵individual cells/well is inoculated in 6 orifice plates, 6 orifice plates is placed in 37 DEG C, 5%CO ₂in incubator, treat that culturing cell grows to the transfection that 50-70% density can start BART6-3p; Transfection process is as follows:

The Hiperfect transfection reagent (Qiagen Products) adding 8 μ l in aseptic EP pipe mixes and leaves standstill 5min in 100 μ l serum free mediums;

BART6-3p is added in 100 μ l serum free mediums; Then mix with the above-mentioned Hiperfect transfection reagent 100 μ l serum free medium gentleness that comprises, room temperature leaves standstill 30 minutes, makes them form complex body;

With D-Hank's liquid washed cell 3 times;

800 μ l serum free mediums (antibiotic-free) will be added in said mixture, after gentle mixing, add 1 hole in 6 orifice plates;

6 orifice plates are placed in CO ₂in incubator, cultivate 6 hours, then abandon supernatant for 37 DEG C, add perfect medium and continue cultivation 48 hours.

1.2 real-time quantitative PCRs detect the effect that BART6-3p expresses:

After cell transfecting success, extracted total RNA, reverse transcription, quantitative real-time PCR detects the expression of BART6-3p, and method and step are with embodiment 1.

1.3 cell proliferation experiment

MTT experiment [3-(4,5-dimethylthiazole-2-yl)-2.5-dipheny-tetrazoliumbromideassay] detects the conventional means of tumor cell proliferation, and specific experiment step is as follows:

1) by cell dissociation, counting, 500 cells are inoculated in 96 orifice plates in every hole, average, arrange altogether 5 days after needing to arrange 5 multiple Kongzuis every day;

2) place incubator to cultivate at least 5 hours, after cell attachment, add MTT liquid (5mg/ml) 20 μ l.Continue cultivation 4 hours, discard nutrient solution.Every hole adds 200 μ lDMSO, and shaking table is placed 10 minutes;

3) select 490nm wavelength, on enzyme-linked immunosorbent assay instrument, measure each hole absorbance and record result, after this every 24 hours repeating steps 2, recording a numerical value, amount to detection 5 days;

4) experiment in triplicate.With each time point for X-coordinate, absorbance is ordinate zou, draws MTT curve.

1.4 cell scratch experiments

Cell scratch experiment is the experimental technique of checking tumor cell migration ability.Nasopharyngeal carcinoma or the stomach cancer cell of transfection BART6-3p or contrast (scramble) sequence are inoculated in 6 orifice plates, when cell density reaches 90%, in each 6 orifice plates, (cut) is drawn a straight line with 200ulpipet, cut healing state is examined under a microscope subsequently at each time point (depending on different cell migration ability) such as 0,8,12,16,24,32,48 hour, take pictures, and calculate each group of cell migration rates.

1.5 cell-penetrating experiments

((transwell) experiment is the experimental technique of checking tumor cell invasion ability to cell-penetrating.Transwell cell (8 μm, aperture) and matrigel (Matrigel) purchased from American BD company, 4% paraformaldehyde stationary liquid, Viola crystallina dye liquor (0.1%g/ml) available from Sigma.Matrigel is pressed 1:8 dilution, be coated on the face, upper room of Transwell cell bottom film, put 37 DEG C and make Matrigel aggregate into gel in 30 minutes.Matrigel film water is carried out by BD company specification sheets before using.

Serum free medium and 1 × 10 is added on each Transwell cell upper strata ⁵the nasopharyngeal carcinoma of individual transfection BART6-3p or contrast (scramble) sequence or stomach cancer cell, add the substratum containing 20% foetal calf serum in Transwell cell lower floor.Cell continued cultivation after 36 hours, fixes, violet staining, dab off the non-migrating cell in upper strata, wash 3 times with PBS with cotton swab with 4% paraformaldehyde stationary liquid.Examine under a microscope the tumour cell through matrix glued membrane.

2. result

After 2.1 transfection BART6-3p, in tumour cell, the expression level of BART6-3p significantly raises

At nasopharyngeal carcinoma cell 5-8F, HNE2 of EBV feminine gender, in stomach cancer cell AGS after transfection BART6-3p, the expression of BART6-3p in nasopharyngeal carcinoma and stomach cancer cell all significantly raises (Fig. 8), shows BART6-3p transfection success.

After 2.2 transfection BART6-3p, tumor cell proliferation speed slows down

MTT cell proliferation experiment confirms, at Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2, after proceeding to BART6-3p in gastric carcinoma cell lines AGS, the growing multiplication speed of 3 strain tumour cells all obviously slows down (Fig. 9).

Cell migration reduced capability after 2.3 transfection BART6-3p

Cell scratch experiment confirms, proceed to BART6-3p in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and stomach cancer cell AGS after, the speed of 3 strain tumour cells central authorities' migration from cut both sides toward cut slows down, the time lengthening of cut healing, shows that cell movement transfer ability reduces (Figure 10).

After 2.4 transfection BART6-3p, cell invasion ability reduces

Cell-penetrating (transwell) experiment confirms, proceed to BART6-3p in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and stomach cancer cell AGS after, significantly can reduce through the tumor cell number of matrix glued membrane, show cell invasion reduced capability (Figure 11).

Embodiment 4, the expression of lncRNA gene LOC553103 in process LAN BART6-3p inhibition tumor cell

1. MATERIALS METHODS

1.1 cell cultures and transfection

CGGGGAUCGGACUAGCCUUAGA

In tumour cell, the method for transfection BART6-3p and step are with embodiment 3.

The expression of lncRNA gene LOC553103 after 1.2 real-time quantitative PCRs detection transfection BART6-3p:

After cell transfecting success, extracted total RNA, reverse transcription, quantitative real-time PCR detects the expression of lncRNA gene LOC553103, and method and step are with embodiment 1, and the primer sequence is as follows:

The primer sequence of LOC553103 expression is detected for real time fluorescent quantitative:

LOC553103 forward primer: 5 '-acagtagtgcgatcaaggct-3 '

LOC553103 reverse primer: 5 '-tcaccacctccctgttcttc-3 '

Reference gene GAPDH Specific PCR primers:

Forward primer 5 '-ACCACAGTCCATGCCATCAC-3 '

Reverse primer 5 '-TCCACCACCCTGTTGCTGTA-3 '.

2. result

After transfection BART6-3p, in tumour cell, the expression level of LOC553013 significantly reduces

At nasopharyngeal carcinoma cell 5-8F, HNE2 of EBV feminine gender, in stomach cancer cell AGS after transfection BART6-3p, the expression of lncRNA gene LOC553103 all significantly reduces (Figure 12), show that BART6-3p can suppress the expression of LOC553010, lncRNA gene LOC553103 is the target gene of BART6-3p in other words.

In embodiment 5, RNA interference method inhibition tumor cell, the expression of LOC553103 can the growing multiplication of inhibition tumor cell and Invasion and Metastasis

1. MATERIALS METHODS

1.1 cell cultures and transfection

Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2, stomach cancer cell AGS is all purchased from Central South University's cell centre, and cell cultures RPMI1640 used trains base and foetal calf serum, and peptic cell trypsinase used is U.S. Gibco Products.

Specificity is as follows for the RNA interference sequence (siRNA) of LOC553103:

siRNA-1：5’-AUAACAUGACAGCUUGCUUGUCUCC-3’

siRNA-2：5’-CUUCCAAGCUCACUCAAGGUUGUUG-3’

siRNA-3：5’-CUAAUAUUCCCUCAGAGCUGGGCUG-3’

Above-mentioned specificity is synthesized by Invitrogen company for the RNA interference sequence of LOC553103, and negative control (NC, scramble) sequence is also synthesized by Invitrogen company and provided.

The method of cell transfecting and step are with embodiment 3.

After 1.2RNA disturbs the expression of LOC553103, by cell proliferation experiment, cell-penetrating experiment and cell scratch experiment have detected the artificial LOC553103 of downward express after the growth of cell, propagation, Infiltration and metastasis ability change.Concrete grammar and step are with embodiment 3.

2. result

2.1 transfection specificitys are for after the RNA interference sequence of LOC553103, and in tumour cell, the expression level of LOC553103 significantly reduces

At nasopharyngeal carcinoma cell 5-8F, HNE2, in stomach cancer cell AGS, transfection specificity is for after the RNA interference sequence of LOC553103, the expression of LOC553103 in above-mentioned cell all significantly reduces (Figure 13), show the RNA interference sequence transfection success for LOC553103, suppress the successful that LOC553103 expresses.

2.2 tumor cell proliferation speed slows down after interference LOC553103 expresses

MTT cell proliferation experiment confirms, at Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2, proceed to specificity in gastric carcinoma cell lines AGS for after the RNA interference sequence of LOC553103, the growing multiplication speed of 3 strain tumour cells all obviously slows down (Figure 14).

Cell migration reduced capability after 2.3 interference LOC553103 expresses

Cell scratch experiment confirms, in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and stomach cancer cell AGS, proceed to specificity slow down for the RNA interference sequence posterior nasopharynx cancer of LOC553103 and the speed of stomach cancer cell central authorities' migration from cut both sides toward cut, the time lengthening of cut healing, shows that cell movement transfer ability reduces (Figure 15).

2.4 cell invasion ability reduces after interference LOC553103 expresses

Cell-penetrating (transwell) experiment confirms, specificity is proceeded to for after the RNA interference sequence of LOC553103 in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and stomach cancer cell AGS, significantly can reduce through the tumor cell number of matrix glued membrane, show cell invasion reduced capability (Figure 16).

Embodiment 6, confirms further process LAN BART6-3p or can the growing multiplication of inhibition tumor cell and Invasion and Metastasis with the expression of LOC553103 in RNA interference method inhibition tumor cell in animal model

1. MATERIALS METHODS

1.1 cell cultures and transfection

Nasopharyngeal Carcinoma Cell Line 5-8F is purchased from Central South University's cell centre, and cell cultures RPMI1640 used trains base and foetal calf serum, and peptic cell trypsinase used is U.S. Gibco Products.

In 5-8F cell, the method for process LAN BART6-3p is with embodiment 3;

The RNA interference sequence of specificity for LOC553103 is contaminated with the method for LOC553103 expression in T suppression cell with embodiment 5 at 5-8F transit cell.

The RNA interference sequence of 1.2 nude mices " tail vein injection-Lung metastases " model inspection BART6-3p and LOC553103 is to the restraining effect of metastatic ability of nasopharyngeal carcinoma cells

4 week age, male nude mouse was purchased from Central South University's Experimental Animal Center, points 3 groups, often organize 10, the transfection in vegetative period of taking the logarithm BART6-3p or RNA interference sequence and Scramble sequence are (as negative control, NC) 5-8F cell (as described in back), after trysinization, under room temperature (15 ~ 25 DEG C), 1000rpm, centrifugal minute, supernatant discarded, 1 × PBS washs 2 times, then re-suspended cell counting.Get 3.5 × 10 ⁶cell/only, through tail vein injection in nude mouse.Continue conventional raising 40 days, put to death nude mice, observe size and the distribution situation of metastatic tumor in nude mice lungs.

The RNA interference sequence of 1.3 Xenografts in nude mice model inspection BART6-3p and LOC553103 is to the restraining effect of nasopharyngeal carcinoma cell multiplication capacity

4 week age, male nude mouse was purchased from Central South University's Experimental Animal Center, points 3 groups, often organize 4, the transfection in vegetative period of taking the logarithm BART6-3p or RNA interference sequence and Scramble sequence are (as negative control, NC) 5-8F cell (as described in back), after trysinization, under room temperature (15 ~ 25 DEG C), 1000rpm, centrifugal minute, supernatant discarded, 1 × PBS washs 2 times, then re-suspended cell counting.Get 3.5 × 10 ⁶cell/only, be inoculated in armpit on the right side of nude mice subcutaneous.Observe generalized case and the mental status of nude mice after inoculated tumour cell every day on time, weigh, neoplastic time and size transplanted in record.Survey transplanted tumor long (length, L), wide (width, W) and high (height, H) with vernier callipers, calculate gross tumor volume (V), V=4 π/3* (L/2*W/2*H/2).Growth of xenografted curve is drawn according to tumor size.Put to death nude mice after 35 days, the taking-up transplanted tumor tissue formaldehyde of 10% is fixed.

2. result

2.1 nude mices " tail vein injection-Lung metastases " model confirms that transfection BART6-3p or specificity are for after the RNA interference sequence of LOC553103 further, and Nasopharyngeal neoplasms ability reduces

In nasopharyngeal carcinoma cell 5-8F, transfection BART6-3p or specificity are for after the RNA interference sequence of LOC553103, with transfection negative control (Scramble sequence, NC) compare, in nude mice " tail vein injection-Lung metastases " model, in BART6-3p and LOC553103 two groups of nude mice lungs, the number of metastatic tumor obviously reduces (Figure 17 and Figure 18), shows process LAN BART6-3p or suppresses the expression of LOC553103 really can the Invasion and Metastasis of inhibition tumor cell.

2.2 Xenografts in nude mice models confirm that transfection BART6-3p or specificity slow down for tumor cell proliferation speed after the RNA interference sequence of LOC553103 further

In nasopharyngeal carcinoma cell 5-8F, transfection BART6-3p or specificity are for after the RNA interference sequence of LOC553103, with transfection negative control (Scramble sequence, NC) compare, the growing multiplication speed of BART6-3p and LOC553103 two groups of Xenografts in nude mice obviously slows down (Figure 19, Figure 20).

Embodiment 7, expresses BART6-3p or can change the integrity of cytoskeleton in tumour cell with the expression of LOC553103 in RNA interference method inhibition tumor cell

1. MATERIALS METHODS

1.1 cell cultures and transfection

In 5-8F cell, the method for process LAN BART6-3p is with embodiment 3;

1.2 immunofluorescence experiment

1) cell inoculation: (75% ethanol for disinfection soaks 2 hours by the cover glass disinfected, and uv irradiating 1 hour) be placed in the hole of six orifice plates, process LAN BART6-3p or transfection specificity are added on the cover glass in six orifice plates respectively for the 5-8F cell of the RNA interference sequence of LOC553103 and negative control cell (transfection Scramble sequence), are placed on cell culture incubator and cultivate 24 hours; Take out Tissue Culture Plate, the PBS of 37 DEG C of preheatings leniently shakes and washes 3 times; Natural air drying;

2) 4% paraformaldehyde of 37 DEG C of preheatings is at 37 DEG C of fixing 15min, and the PBS gentleness of preheating is shaken and washed 3 times, each 5min;

3) diluted by FITC-phalloidin (available from Sigma, for flag F-actin) 1:500, hatch 50min for 37 DEG C, the PBS of preheating washes three times;

4) DAPI dyeing 5min, the PBS of preheating cleans 3 times;

5) clear water is washed 3 times and is removed PBS, dries mounting, observes and take pictures under laser confocal microscope.

2. result

The F-actin (cytoskeleton) of immunofluorescence results display FITC mark is in green, and be distributed in endochylema, the nucleic acid of DAPI mark, in blue, is distributed in nucleus.Cellular control unit regular shape, cytoskeleton is clear bright, rich content, in fiber radial air along the arrangement of cell major axis, stress fiber clear layer, karyon is dyed to mazarine; BART6-3p group (Figure 21) and the depolymerization of LOC553103 interference group (Figure 22) cytoskeleton, Microfilaments In Cells shortens, arrange sparse, stress fiber number obviously reduces and attenuates, nucleus is intensely dark, cell shrinkage becomes circle, nucleus is intensely dark, intercellular bridge shape skeleton connects fiber to be reduced or disappears, after the expression of prompting process LAN BART6-3p or interference LOC553103, cytoskeleton assembling receives obvious suppression, and have impact on the growth of tumour cell, propagation and Invasion and Metastasis ability.

Embodiment 8, quantitative real-time PCR detects and confirms LOC553103 down-regulated expression in nasopharyngeal carcinoma and cancer of the stomach

1. materials and methods:

Collect 5 routine normal nasopharyngeal epithelium and 18 routine tissues of nasopharyngeal carcinomas and 18 pairs of stomach organizations and other control tissue Trizol (invitrogen Products) extracted total RNA of corresponding cancer, after 2 μ gRNA Reverse Transcriptase kit (Qiagen Products) reverse transcriptions become cDNA, carry out with QuantiTectSYBRGreenPCR test kit (Qiagen Products) expression that real-time fluorescence quantitative PCR detects LOC553103 and reference gene GAPDH.PCR primer and amplification method are with embodiment 4.

Reaction terminates amplification curve and the melting curve of rear confirmation real-time fluorescence quantitative PCR, the expression intensity of each gene, according to after CT value (thresholdcyclevalues), reference gene (GAPDH) markization, adopts groupt-test inspection to calculate P value.

2. result

LOC553103 expresses higher (Figure 24) in normal nasopharyngeal epithelium (Figure 23) or the other control tissue of Stomach Carcinomas, and expresses lower in tissues of nasopharyngeal carcinoma (Figure 23) or stomach organization (Figure 24).

Embodiment 9, in situ hybridization detects and finds that LOC553103 is relevant to patient's prognosis with the expression in cancer of the stomach in nasopharyngeal carcinoma

1. MATERIALS METHODS

1.1 design and synthesize hybridization probe

In order to the expression adopting in-situ hybridization method to detect LOC553103, we devise the oligonucleotide probe and positive control (GAPDH) the in situ hybridization oligonucleotide probe that detect LOC553103 expression in situ hybridization.

LOC553103 probe sequence-1:5'-CAGAAAAUAAAGUCACAGAGCUCCUGGAAC-3'

LOC553103 probe sequence-2:5'-ACUGUUUCCUCUCUGCCUUGAUUGAAAUUC-3'

LOC553103 probe sequence-3:5'-ACACUUUGAAAUUUUUGUCACCUCCCUUGA-3'

Positive control probe (detecting house-keeping gene GAPDH):

GAPDH probe sequence-1:5'-CCACUUUACCAGAGUUAAAAGCAGCCCUGG-3'

GAPDH probe sequence-2:5'-CAGUAGAGGCAGGGAUGAUGUUCUGGAGAG-3'

GAPDH probe sequence-3:5'-GUCAGAGGAGACCACCUGGUGCUCAGUGUA-3'

1.2 oligonucleotide probe labelling kits and in situ hybridization detection method, result judge and statistical method equivalent integers 2

2 results

Expression in the other control tissue of the expression ratio cancer of 2.1LOC553103 in nasopharyngeal carcinoma significantly reduces

In the other nasopharyngeal epithelium (AdjacentEpithelialofNPC) of 40 routine cancers, have the expression of 36 routine LOC553103 higher (Figure 25 is left), and in 115 routine nasopharyngeal carcinoma (NPC) expression of 57 routine LOC553103 lower (Figure 25 is right) P<0.001.The expression of LOC553103 and BART6-3p are remarkable negative correlation.

2.2LOC553103 it is poor to express high Nasopharyngeal Carcinoma Patients prognosis

The survival analysis that we carry out the expression of LOC553103 in tissues of nasopharyngeal carcinoma and the survival time of patient and state, find that the expression of LOC553103 and the prognosis of Nasopharyngeal Carcinoma Patients are closely related in nasopharyngeal carcinoma, the survival of patients time of the low expression of LOC553103 (Low) obviously will be longer than the patient (Figure 26, P=0.03) of LOC553103 high expression level (high).

Expression in the other control tissue of the expression ratio cancer of 2.3LOC553103 in cancer of the stomach significantly reduces

In 37 routine stomach organizations, 29 examples detect the low expression (Figure 27 is right) of LOC553103, all the other 8 examples are high expression level, and in the cancer beside organism that these cancer of the stomach samples are corresponding, have the expression of 35 routine LOC553103 higher (Figure 27 is left), P<0.05.2.4LOC553103 the patients with gastric cancer prognosis of high expression level is poor

The survival analysis that we carry out the expression of LOC553103 in stomach organization and the survival time of patient and state, find that the expression of LOC553103 and the prognosis of patients with gastric cancer are closely related in cancer of the stomach, the survival of patients time of LOC553103 high expression level (High) will be significantly shorter than the patient (Figure 28, P<0.05) of the low expression of LOC553103 (Low).

Claims

The application of the microRNABART6-3p of 1.EB encoding viral, is characterized in that, the microRNABART6-3p of Epstein-Barr virus coding is for the preparation of the preparation of monitoring recurrence of gastric cancer transfer and prognosis prediction; In stomach organization, the expression level of BART6-3p and the transfer of patients with gastric cancer are negative correlativing relation, and BART6-3p expresses high patient and is not easy recurrence, and survival time is longer; The sequence of BART6-3p: CGGGGAUCGGACUAGCCUUAGA.
2. application according to claim 1, is characterized in that, described monitoring recurrence of gastric cancer transfer and the preparation of prognosis prediction are that in situ hybridization detects preparation or real-time fluorescence quantitative PCR reagent.
3. application according to claim 2, is characterized in that, described in situ hybridization detects the in situ hybridization probe that preparation comprises the microRNABART6-3p detecting Epstein-Barr virus coding, and sequence is: UCUAAGGCUAGUCCGAUCCCCG.
4. the application according to Claims 2 or 3, is characterized in that, described in situ hybridization detection reagent is test kit.
5. application according to claim 4, is characterized in that, test kit comprises: the in situ hybridization probe detecting the microRNABART6-3p of Epstein-Barr virus coding, and sequence is: UCUAAGGCUAGUCCGAUCCCCG; Detect the in situ hybridization probe of reference gene GAPDH, sequence is: CAGUAGAGGCAGGGAUGAUGUUCU.
6. application according to claim 5, is characterized in that, test kit also comprises:

Digoxin oligonucleotide tailing reagent, anti-digoxin-horseradish peroxidase complex detection reagent, DAB staining reagent;

Other conventional biochemical reagent, comprises 20xSSC, T 500, deionized formamide, polyadenylic acid, poly deoxyadenylic acid, the salmon sperm DNA that sex change is sheared, yeast transfer RNA, dithiothreitol (DTT), 50xDenhardts ' ssolution, PBSbuffer, stomach en-K, bovine serum albumin, trolamine, acetic anhydride

The 0.1MTris-Cl+0.15MNaCl+0.5% of TNB damping fluid: pH7.5 blocks reagent;

The 0.1MTris-Cl+0.15MNaCl+0.05%Tween20 of TNT damping fluid: pH7.5.
7., for the preparation of the in situ hybridization probe of in situ hybridization detection reagent of the preparation of the transfer of monitoring recurrence of gastric cancer and prognosis prediction, sequence is as follows: UCUAAGGCUAGUCCGAUCCCCG.
8., for monitoring the in situ hybridization detection reagent of recurrence of gastric cancer transfer and prognosis prediction, be the test kit including in situ hybridization probe according to claim 7.
9. in situ hybridization detection reagent according to claim 8, is characterized in that, also containing the in situ hybridization probe detecting reference gene GAPDH in test kit, sequence is: CAGUAGAGGCAGGGAUGAUGUUCU.
10. in situ hybridization detection reagent according to claim 8 or claim 9, is characterized in that,

Also contain in test kit: digoxin oligonucleotide tailing reagent, anti-digoxin-horseradish peroxidase complex detection reagent, DAB staining reagent;

Other conventional biochemical reagent, comprises 20xSSC, T 500, deionized formamide, polyadenylic acid, poly deoxyadenylic acid, the salmon sperm DNA that sex change is sheared, yeast transfer RNA, dithiothreitol (DTT), 50xDenhardts ' ssolution, PBSbuffer, stomach en-K, bovine serum albumin, trolamine, acetic anhydride

The 0.1MTris-Cl+0.15MNaCl+0.5% of TNB damping fluid: pH7.5 blocks reagent;

The 0.1MTris-Cl+0.15MNaCl+0.05%Tween20 of TNT damping fluid: pH7.5.