CN105200155B

CN105200155B - The application of the microRNA BART6-3p of Epstein-Barr virus coding

Info

Publication number: CN105200155B
Application number: CN201510727841.7A
Authority: CN
Inventors: 曾朝阳; 熊炜; 李夏雨; 李桂源; 石磊; 李小玲; 张文玲; 何宝玉; 向波; 彭淑平; 宋亚莉; 李俏
Original assignee: Central South University
Current assignee: Central South University
Priority date: 2015-10-30
Filing date: 2015-10-30
Publication date: 2018-11-30
Anticipated expiration: 2035-10-30
Also published as: CN105200155A

Abstract

The invention discloses the applications of the microRNA BART6-3p of Epstein-Barr virus coding, are mainly used for preparation monitoring recurrence of gastric cancer transfer and prognosis prediction preparation.The prognosis of the expression and patients with gastric cancer that find BART6-3p in the gastric cancer paraffin organization sample of archive by situ hybridization is closely related, the expression of BART6-3p and the transfer negative correlation of patients with gastric cancer are detected in stomach organization, BART6-3p expresses that the high survival of patients time is longer, and BART6-3p is prompted to can be used as the predictive molecule mark of recurrence of gastric cancer and transfer.The present invention provides strong biology tool for the auxiliary diagnosis and prognosis prediction of gastric cancer, has far-reaching clinical meaning and important popularization and application foreground.

Description

The application of the microRNA BART6-3p of Epstein-Barr virus coding

Technical field

The invention belongs to oncomolecularbiology fields, and in particular to the microRNA BART6- encoded using Epstein-Barr virus The method of 3p preparation monitoring recurrence of gastric cancer transfer and prognosis prediction preparation.

Background technique

Epstein-Barr virus (Epstein Barr virus, EBV) is a kind of generally existing nerpes vinrus hominis, can be infected complete The adult population of ball 95% or so, it is most of in addition to having sub-fraction people that can cause communicable monocytosis,mononucleosis once in a while Infected person is not in any clinical symptoms, in most cases EBV can in host long-term latent infection.So And the EBV of latent infection will lead to the generation of malignant tumour in some cases, Hugh Burkitt and He Jie including B cell source Golden lymphomas and epithelial cell origin nasopharyngeal carcinoma and gastric cancer etc..The mechanism that EBV causes malignant tumour to occur is not yet complete at present It is complete to be illustrated, may be related with the expression that EBV itself encodes series of genes, the Latent membrane protein1 (Latent encoded such as EBV Membrane Protein1, LMP1) it is used as a kind of tumorigenesis albumen, the expression of oncogene in many host cells can be activated, is inhibited The structure and function of tumor suppressor gene.

EBV is about 170kb as its Genome Size of double-stranded DNA virus, in addition to a series of transcribed protein coding genes Outside, it also found EBV also codified one kind Microrna (microRNA, miRNA) molecule recently.MiRNA be one kind be about 20~ The regulation type non-coding RNA of 25nt, different from mRNA, " bridge " between miRNA not instead of DNA and protein, by with Target gene targeting combines, the expression of controlling gene.EBV is first virus for being found codified miRNA, into place EBV starts expression generation miRNA after master, plays biological action.Have now been found that 25 miRNAs precursors of EBV codified, Be processed into 44 mature miRNAs, and the miRNAs of EBV coding cluster on EBV genome is distributed, can be divided into BART and Two groups of BHRF1.The miRNAs of EBV coding may by regulating and controlling the gene in EBV itself gene or host cell that encode, from And the malignancy of tumor conversion of EBV mediation is taken part in, influence the hair of the kinds of tumors including nasopharyngeal carcinoma, gastric cancer, lymthoma etc. Hair tonic exhibition.It however is not also very thorough, big portion in 44 mature EBV miRNAs for the research of EBV coding miRNA s at present Point not yet report of functional study, the research of effect and mechanism for example relating to the miRNA BART6-3p of EBV coding is just very It is few.The relationship of effect so far in relation to BART6-3p in the solid tumors occurrence and development such as nasopharyngeal carcinoma, gastric cancer and its in entity Early screening, auxiliary diagnosis or outcome prediction of tumor patient etc. are without document report.

We pass through studies have shown that expression of the BART6-3p in nasopharyngeal carcinoma and stomach organization significantly increases, but right and wrong Often ironically the recurrence of the expression of BART6-3p and nasopharyngeal carcinoma and patients with gastric cancer turns in nasopharyngeal carcinoma and stomach organization Negative correlation is moved, the patient of the patient Bi Gao expression BART6-3p of low expression BART6-3p is easier that recurrence occurs and turns It moves, prognosis is worse.Although this shows that EBV is the specific oncogenicity virus of comparison, not the gene of EBV coding is all had Promote the effect of tumor development, portion gene, including BART6-3p that there may be anti-tumor function, this also indicates that EBV The relationship of the clinical phenotypes such as the expression of miRNAs and tumor recurrence, transfer prognosis cannot suppose that, can only be by specific thin The experimental study of cause just can determine that.Therefore, for BART6-3p design specialized in situ hybridization probe and detection kit, Huo Zheli BART6-3p in the technologies such as real-time fluorescence quantitative PCR detection nasopharyngeal carcinoma and stomach organization is carried out with BART6-3p specific primer Expression is expected to provide reference for the prediction clinically recurring tumour and shifting.

We transfect artificial synthesized BART6-3p in nasopharyngeal carcinoma and stomach cancer cell, it was demonstrated that in the nasopharyngeal carcinoma of EBV feminine gender The growing multiplication and invasion transfer ability of tumour cell can obviously be inhibited with BART6-3p is expressed in stomach cancer cell.Therefore, BART6-3p can be used for preparing the preparation for inhibiting growth of tumour cell, proliferation and prevention tumor cell invasion transfer again.

We have also been devised a series of experiment and have detected BART6-3p and play biology in nasopharyngeal carcinoma and stomach cancer cell The molecular mechanism of function, it has been found that a long-chain non-coding RNA (long non-coding in BART6-3p is capable of inhibiting cell RNA, lncRNA) gene LOC553103 expression (Reference Sequence：NR_110997), we, which devise, is directed to RNA interference sequence (siRNA) the transfection nasopharyngeal carcinoma and stomach cancer cell of LOC553103, after the expression for inhibiting LOC553103, cell There is the cell biology phenotype of similar transfection BART6-3p, that is, inhibit growth of tumour cell and is proliferated and inhibits tumour cell Invasion and transfer ability.Therefore, can be used for preparation for the RNA interference sequence (siRNA) of LOC553103 inhibits tumour thin The preparation of intracellular growth, proliferation and prevention tumor cell invasion transfer.Before this, the function in relation to LOC553103 has no any document Report.

Cytoskeleton is to be present in eukaryocyte by what three kinds of micro-pipe, microfilament and median fiber azelons were built Intracytoplasmic network structure, three kinds of ingredient hight coordinate distributions, karyon, plasma membrane, each organelle are connected together, cell is constituted Form maintains and the support system of motor coordination.Recent studies indicate that Tumor Cell Migration migration and invasive ability and cell The dynamic regulation of skeleton is closely related, and the drug of targeting cytoskeleton can also inhibit tumour cell with inducing apoptosis of tumour cell Proliferation.We confirm that BART6-3p can be by the expression of LOC553103 in targeted inhibition host cell, shadow by serial experiment Ring tumour cell in micro-pipe microfilament assembling, the reconstruct of regulating cell skeleton, eventually lead to growth of tumour cell, proliferation, invasion, Shift the variation of isophenous.Therefore, BART6-3p and the RNA interference sequence (siRNA) for LOC553103 can be also used for making The standby preparation for inhibiting tumour cell skeleton assembling and reconstruct.

In addition, we again in the clinical sample of nasopharyngeal carcinoma and gastric cancer detect LOC553103 expression situation, find its High expression in control tissue by cancer, and the low expression in most of tumor tissues, and it is negatively correlated with the expression of BART6-3p, The expression of LOC553103 can be used as the index of patient's prognosis, therefore, fixed for the real-time fluorescence of LOC553103 design specialized PCR primer and detection kit or in situ hybridization probe and detection kit are measured, for detecting nasopharyngeal carcinoma and stomach organization The expression of LOC553103 is expected to clinically provide reference to both tumours progress relapse and metastasis and prognosis prediction.

In short, our research disclose BART6-3p and new lncRNA gene LOC553103 in nasopharyngeal carcinoma and Function during the Incidences such as gastric cancer, the application method for BART6-3p and LOC553103 provide real example.

Summary of the invention

It is specifically sharp the purpose of the present invention is to provide the application of the microRNA BART6-3p of Epstein-Barr virus coding a kind of The preparation for monitoring recurrence of gastric cancer transfer and prognosis prediction is prepared with the sequence of BART6-3p, including：Real-time fluorescence quantitative PCR Primer and reagent, in situ hybridization probe and hybridization in situ detection kit etc..

The microRNA BART6-3p of the application of the microRNA BART6-3p of Epstein-Barr virus coding, Epstein-Barr virus coding is used for The preparation of preparation monitoring recurrence of gastric cancer transfer and prognosis prediction；The expression of BART6-3p and patients with gastric cancer in stomach organization Negative correlation is shifted, BART6-3p expresses high patient and do not allow easy to recur, and life span is longer；The sequence of BART6-3p： CGGGGAUCGGACUAGCCUUAGA。

The preparation of the transfer of monitoring recurrence of gastric cancer and prognosis prediction is that in situ hybridization detects preparation or real-time fluorescence is fixed Measure PCR reagent.

The original position of the microRNA BART6-3p including detection Epstein-Barr virus coding is miscellaneous in the in situ hybridization detection preparation Probe is handed over, sequence is：UCUAAGGCUAGUCCGAUCCCCG.

The in situ hybridization detection reagent is kit.

Include in kit：The in situ hybridization probe of the microRNA BART6-3p of Epstein-Barr virus coding is detected, sequence is： UCUAAGGCUAGUCCGAUCCCCG；The in situ hybridization probe of reference gene GAPDH is detected, sequence is： CAGUAGAGGCAGGGAUGAUGUUCU。

Kit further includes：

Digoxin oligonucleotides tailing reagent, anti-digoxin-horseradish peroxidase complex detection reagent, DAB dyeing Reagent；

Other conventional biochemical reagents, including 20x sodium citrate buffer (saline sodium citrate, SSC), dextran sulfate (Dextran sulphate), deionized formamide (Deionized Formamide), polyadenosine Sour (polyadenylic acid, Poly A), poly deoxyadenylic acid (polydeoxyadenylic acid, Poly dA), It is denaturalized the salmon sperm DNA (denatured and sheared salmon sperm DNA, ssDNA) of shearing, yeast transfer RNA (yeast t-RNA, tRNA), dithiothreitol (DTT) (DTT), Deng 50x Han Shi buffer (Denhardts ' s solution), phosphoric acid Buffer (PBS buffer), pepsin K, bovine serum albumin(BSA) (BSA), triethanolamine (TEA), acetic anhydride block reagent (Blocking reagent agent), TNB buffer is (i.e.：The 0.1M Tris-Cl+0.15M NaCl+0.5% of pH7.5 hinders Disconnected reagent), TNT buffer is (i.e.：The 0.1M Tris-Cl+0.15M NaCl+0.05%Tween 20 of pH7.5).

We have found the microRNA of Epstein-Barr virus coding by situ hybridization in the gastric cancer paraffin organization sample of archive The expression of BART6-3p and the prognosis of patients with gastric cancer are closely related, and the microRNA of Epstein-Barr virus coding is detected in stomach organization The expression of BART6-3p and the transfer negative correlation of patients with gastric cancer.The microRNA BART6-3p of Epstein-Barr virus coding It expresses that the high survival of patients time is longer, the microRNA BART6-3p of Epstein-Barr virus coding is prompted to can be used as recurrence of gastric cancer and turn The predictive molecule mark of shifting.The present invention provides strong molecular biology work for the auxiliary diagnosis and prognosis prediction of gastric cancer Tool has far-reaching clinical meaning and important popularization and application foreground.

Detailed description of the invention

Fig. 1 is that Real-Time Fluorescent Quantitative PCR Technique detects expression feelings of the BART6-3p in nasopharyngeal carcinoma and normal nasopharyngeal epithelium Condition,

BART6-3p is in the expression in nasopharyngeal carcinoma (T) than significantly improving (P in normal nasopharyngeal epithelium (N)<0.001).

Fig. 2 is that in situ hybridization detects expression of the BART6-3p in nasopharyngeal carcinoma and normal nasopharyngeal epithelium,

Nasopharyngeal Carcinoma During Biopsy sample as an example of the left side, BART6-3p high expression in cancerous tissue, and by cancer (Adjacency) Low expression in normal nasopharyngeal epithelium；The right is normal nasopharyngeal epithelium sample by another cancer, BART6-3p base in cancer beside organism Originally it can't detect.

Fig. 3 is the statistical result of BART6-3p in situ hybridization data in epithelium by nasopharyngeal carcinoma and cancer,

There is the expression of 34 BART6-3p low in normal epithelial (Adjacency of NPC) by 40 nasopharyngeal carcinoma cancers, very To being substantially not detectable (negative), and in 115 nasopharyngeal carcinoma (NPC) 57 detect the high expression of BART6-3p (high), remaining 58 are low expression (low), P<0.001.

Fig. 4 is the expression and the correlation of distant metastasis of nasopharyngeal carcinoma of BART6-3p,

In 115 nasopharyngeal carcinoma samples, 92 have occurred relapse and metastasis, wherein 31 are recurrence (local in situ Relapse), 61 are DISTANT METASTASES IN (distance Metastasis), it can be seen that the trouble of DISTANT METASTASES IN from statistical result Lower (the P of the highly expressed ratio of BART6-3p in person<0.05) expression and tumor recurrence transfer for, showing BART6-3p are in negative It closes.

Fig. 5 is the relationship of expression Yu the Nasopharyngeal Carcinoma Patients prognosis of BART6-3p,

The expression of BART6-3p and the prognosis of Nasopharyngeal Carcinoma Patients are closely related in nasopharyngeal carcinoma, i.e. BART6-3p high expression (High) the survival of patients time will be considerably longer than the patient (P of BART6-3p low expression (Low)<0.05).

Fig. 6 is that in situ hybridization detects expression of the BART6-3p by the gastric cancer and cancer in epithelium,

Biopsy samples from stomach cancer as an example of the left side, BART6-3p high expression in cancerous tissue；The right is Carcinoma side normal tissue mark This, BART6-3p is substantially not detectable in cancer beside organism.

Fig. 7 is the relationship of expression Yu the patients with gastric cancer prognosis of BART6-3p,

The expression of BART6-3p and the prognosis of patients with gastric cancer are closely related, i.e. the patient that BART6-3p high expresses (High) is raw Deposit the patient (P=0.04) that the time will be considerably longer than BART6-3p low expression (Low).

Fig. 8 is that BART6-3p few nucleosides are imported in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender Acid sequence, expression of the BART6-3p in tumour cell significantly increase,

BART6-3p oligonucleotide sequence is imported in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender Afterwards, real time fluorescence quantifying PCR method has detected the expression of BART6-3p in tumour cell, and the expression of BART6-3p significantly rises It is high.Negative control (NC) is to import scramble sequence.

Fig. 9 is that BART6-3p few nucleosides are imported in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender The proliferative capacity of cell reduces after acid sequence, and the speed of growth slows down.

Figure 10 is that BART6-3p few nucleosides are imported in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender Cell migration ability reduces after acid sequence,

Cell scratch experiment confirms, imports in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender BART6-3p oligonucleotide sequence, after the artificial expression for promoting BART6-3p, tumour cell is moved from scratch both sides toward scratch center It moves speed obviously to slow down, the time of scratch healing extends, and shows the reduction of cell movement transfer ability, and negative control (NC) is to import Scramble sequence.

Figure 11 is that BART6-3p few nucleosides are imported in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender The invasive ability of cell reduces after acid sequence,

Cell-penetrating (transwell) it is experimentally confirmed that EBV feminine gender nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell BART6-3p oligonucleotide sequence is imported in AGS, after the artificial expression for promoting BART6-3p, the tumour that can pass through matrix glue film is thin Born of the same parents' number substantially reduces, and shows the reduction of cell invasion ability, and negative control (NC) is to import scramble sequence.

Figure 12 is the expression that BART6-3p can lower lncRNA gene LOC553103 in cell,

BART6-3p oligonucleotide sequence is imported in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS of EBV feminine gender (P is significantly lowered in the expression of real-time fluorescence quantitative PCR detection discovery lncRNA gene LOC553103 afterwards<0.05).

Figure 13 is that cell can be effectively suppressed in the specific RNA interference sequence (siRNA) for lncRNA gene LOC553103 The expression of middle LOC553103,

We devise 3 specificity for LOC553103 RNA interference sequence (siRNA1, siRNA2 and siRNA3, Be abbreviated as S1, S2 and S3) be transfected into the nasopharyngeal carcinoma cell 5-8F (left side) of EBV feminine gender, HNE2 (in) and stomach cancer cell AGS (right side) in The expression of real-time fluorescence quantitative PCR detection discovery lncRNA gene LOC553103 is significantly lowered afterwards.

Figure 14 is that importing is specificity for lncRNA gene in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS The proliferative capacity of the RNA interference sequence (siRNA) of LOC553103 cell afterwards reduces, and the speed of growth slows down.

Figure 15 is to import specificity in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS to be directed to lncRNA gene Cell migration ability reduces the RNA interference sequence (siRNA) of LOC553103 afterwards,

Cell scratch experiment confirms, specificity is imported in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS and is directed to The RNA interference sequence (siRNA) of lncRNA gene LOC553103, after the artificial expression for inhibiting LOC553103, tumour cell from Scratch both sides obviously slow down toward scratch center migration velocity, and the time of scratch healing extends, and show that cell movement transfer ability drops Low, negative control (NC) is to import scramble sequence.

Figure 16 is to import specificity in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS to be directed to lncRNA gene The invasive ability of cell reduces after RNA interference sequence (siRNA) sequence of LOC553103,

Cell-penetrating (transwell) in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS it is experimentally confirmed that import Specificity is directed to RNA interference sequence (siRNA) sequence of lncRNA gene LOC553103, the artificial expression for inhibiting LOC553103 Afterwards, the tumor cell number that can pass through matrix glue film substantially reduces, and shows the reduction of cell invasion ability, and negative control (NC) is to lead Enter scramble sequence.

Figure 17 is nude mice tail vein injection Lung metastases tumor formation experiment further nasopharyngeal carcinoma cell 5-8F of the confirmation in EBV feminine gender The middle BART6-3p or the specific RNA interference sequence (siRNA) for lncRNA gene LOC553103 of importing can inhibit swollen The invasion transfer ability of oncocyte.

BART6-3p is imported in the nasopharyngeal carcinoma cell 5-8F of EBV feminine gender or specificity is directed to lncRNA gene The RNA interference sequence (siLOC) of LOC553103 will be located after the artificial expression for being overexpressed BART6-3p or inhibiting LOC553103 The cell managed in tail vein injection to nude mouse, is continued thereafter with raising 40 days, finally puts to death nude mice, observes each group nude mice lung The case where metastatic tumor in dirty is formed, arrow show metastatic tumor.It transfects BART6-3p or specificity is directed to lncRNA gene Metastatic tumor number in two groups of nude mice lung tissues of the RNA interference sequence of LOC553103 is considerably less than negative control group, further It confirms and is overexpressed BART6-3p or inhibits the expression of LOC553103 that can inhibit tumor cell invasion and transfer.

Figure 18 is nude mice tail vein injection Lung metastases tumor formation experimental result statistics.

Figure 19 is that nude mice by subcutaneous tumor formation experiment further confirms to import BART6- in the nasopharyngeal carcinoma cell 5-8F of EBV feminine gender 3p or specificity can inhibit the life of tumour cell for the RNA interference sequence (siRNA) of lncRNA gene LOC553103 Long, proliferation,

BART6-3p is imported in the nasopharyngeal carcinoma cell 5-8F of EBV feminine gender or specificity is directed to lncRNA gene The RNA interference sequence (siLOC) of LOC553103 will be located after the artificial expression for being overexpressed BART6-3p or inhibiting LOC553103 The cell infusion managed continues thereafter with raising 30 days to nude mice by subcutaneous, finally puts to death nude mice, observes each group Xenografts in nude mice Size.BART6-3p or specificity are transfected for two groups of nude mice by subcutaneous of the RNA interference sequence of lncRNA gene LOC553103 Transplantable tumor is obviously smaller than negative control group, further demonstrates the expression for being overexpressed BART6-3p or inhibiting LOC553103 To inhibit the growth and proliferation of tumour cell.

Figure 20 is Xenografts in nude mice experimental result statistics；

BART6-3p is imported in the nasopharyngeal carcinoma cell 5-8F of EBV feminine gender or specificity is directed to lncRNA gene The RNA interference sequence (siLOC) of LOC553103 will be located after the artificial expression for being overexpressed BART6-3p or inhibiting LOC553103 The cell infusion managed continues thereafter with raising 30 days, the size of every 5 days measurement subcutaneous transplantation tumors, statistical result to nude mice by subcutaneous Show the growth and proliferation for being overexpressed BART6-3p or inhibiting the expression of LOC553103 that can inhibit tumour cell.

Figure 21 is that BART6-3p can influence cytoskeletal structure in tumour cell,

It is specificity mark after being overexpressed BART6-3p that BART6-3p people is imported in the nasopharyngeal carcinoma cell 5-8F of EBV feminine gender Remember cytoskeleton (F-actin), tested by cellular immunofluorescence, discovery is overexpressed BART6-3p under the microscope in fluorescence microscopy Apparent change has occurred in cytoskeletal structure afterwards, shows that the overexpression of BART6-3p affects micro-pipe microfilament in tumour cell Assembling.(DAPI is nucleus specific dye)

Figure 22 is to interfere the expression of lncRNA gene LOC553103 that can influence cytoskeletal structure in tumour cell,

The RNA interference sequence that specificity is directed to lncRNA gene LOC553103 is imported in nasopharyngeal carcinoma cell 5-8F (siRNA) after the expression for artificially reducing LOC553103, specific marker cytoskeleton (F-actin) passes through cellular immunofluorescence Experiment, apparent change, table has occurred in cytoskeletal structure after fluorescence microscopy under the microscope discovery interference LOC553103 expression The assembling of micro-pipe microfilament in bright LOC553103 modulate tumor cell.(DAPI is nucleus specific dye)

Figure 23 is that Real-Time Fluorescent Quantitative PCR Technique detects expression of the LOC553103 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium Situation；

Expression of the LOC553103 in nasopharyngeal carcinoma (NPC) is than significantly reducing (P in normal nasopharyngeal epithelium (N)<0.001), and It is negatively correlated with the expression of BART6-3p.

Figure 24 is that Real-Time Fluorescent Quantitative PCR Technique detects table of the LOC553103 by the gastric cancer and cancer in normal control tissue Up to situation；

Expression of the LOC553103 in gastric cancer (T) is than significantly reducing (P in control tissue (N) by cancer<0.001).

Figure 25 is that in situ hybridization detects expression of the LOC553103 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium；

Control tissue sample by nasopharyngeal carcinoma cancer as an example of the left side, LOC553103 high expression in epithelial tissue by the cancer；The right As an example of tissues of nasopharyngeal carcinoma sample, LOC553103 is substantially not detectable in tissues of nasopharyngeal carcinoma, and LOC553103 is in nasopharyngeal carcinoma group Expression and BART6-3p in knitting is significantly negatively correlated.

Figure 26 is the relationship of expression Yu the Nasopharyngeal Carcinoma Patients prognosis of LOC553103

The expression of LOC553103 and the prognosis of Nasopharyngeal Carcinoma Patients are closely related, with BART6-3p just on the contrary, i.e. The survival of patients time of LOC553103 high expression (High) will be significantly shorter than the patient (P of LOC553103 low expression (Low)< 0.05)。

Figure 27 is that in situ hybridization detects expression of the LOC553103 by the gastric cancer and cancer in control tissue；

Control tissue sample by Stomach Carcinomas as an example of the left side, LOC553103 high expression in cancer beside organism；As an example of the right Stomach organization sample, LOC553103 express lower in tissues of nasopharyngeal carcinoma.

Figure 28 is the relationship of expression Yu the patients with gastric cancer prognosis of LOC553103

The expression of LOC553103 and the prognosis of patients with gastric cancer are closely related, with BART6-3p just on the contrary, i.e. The survival of patients time of LOC553103 high expression (High) will be significantly shorter than the patient (P of LOC553103 low expression (Low)< 0.05)。

Specific embodiment

The present invention is further illustrated below in conjunction with specific embodiment, is not intended to limit the present invention.

Embodiment 1, quantitative real-time PCR detection confirm that BART6-3p is raised in nasopharyngeal carcinoma

1. materials and methods：

5 normal nasopharyngeal epithelial tissues and 18 tissues of nasopharyngeal carcinoma are collected, with Trizol (invitrogen Products) Extracted total RNA, 2 μ g RNA with miScript Reverse Transcriptase kit (Qiagen Products) reverse transcription at cDNA after, use QuantiTect SYBR Green PCR kit (Qiagen Products) carries out real-time fluorescence quantitative PCR and detects BART6- The expression of 3p and reference gene RNU6B.The common primers (Universal Primer) and BART6-3p and RNU6B of microRNA Specific primer designed and synthesized by Qiagen company.

Real-time fluorescence quantitative PCR reaction system

Real-time fluorescence quantitative PCR reaction step

1 94℃ 5min

2 95℃ 10sec

3 58℃ 30sec

4 72℃ 20sec

5 Plate read

6 82℃ 30sec

7 Plate read

8 Go to step 2 for more 39times

9 55.0 DEG C of from of Perform melting curve 95.0 DEG C of to, 0.2 DEG C of read every, hold for 1 sec

The amplification curve and melting curve of real-time fluorescence quantitative PCR, the expression intensity root of each gene are confirmed after reaction After CT value (threshold cycle values), reference gene (RNU6B) markization, using group t-test checking computation P value.

2. result

BART6-3p does not express or expresses very low, and the high expression P in tissues of nasopharyngeal carcinoma in normal control tissue< 0.001 (Fig. 1)

Embodiment 2, expression of the in situ hybridization detection discovery BART6-3p in nasopharyngeal carcinoma and gastric cancer are related to patient's prognosis

1. MATERIALS METHODS

1.1 design and synthesize hybridization probe

In order to which using the expression of in-situ hybridization method detection BART6-3p, we devise detects in situ hybridization The oligonucleotide probe and positive control in situ hybridization oligonucleotide probe of BART6-3p expression.

BART6-3p probe：UCUAAGGCUAGUCCGAUCCCCG

Positive control probe (detection house-keeping gene GAPDH)：

GAPDH probe：CAGUAGAGGCAGGGAUGAUGUUCU

Each gene specific oligonucleotides probe sequence of above-mentioned design is synthesized using chemical synthesis process, in synthesis process The marked biotin of uracil (bio-U) in probe sequence.

1.2 oligonucleotide probe labelling kits and in situ hybridization detection reagent

Digoxin oligonucleotides tailing reagent (Dig Oligonucleitide Tailing Kit 2^ndGeneration, Roche company), anti-digoxin-horseradish peroxidase complex detection kit (Anti-Digoxigenin-POD, Fab Fragments, Roche company), enhance the TSA signal amplifying system (TSA of detection of expression signal in situ^TM Biotin System, NEL700 kit, PerkinElmer company), DAB staining kit (Beijing Zhong Shan company), 20x sodium citrate Buffer solution (saline sodium citrate, SSC), dextran sulfate (Dextran sulphate), deionized formamide (Deionized Formamide), polyadenylic acid (polyadenylic acid, Poly A), poly deoxyadenylic acid (polydeoxyadenylic acid, Poly dA) is denaturalized salmon sperm DNA (the denatured and sheared of shearing Salmon sperm DNA, ssDNA), yeast transfer RNA (yeast t-RNA, tRNA), dithiothreitol (DTT) (DTT), 50x Deng Han Family name's buffer (Denhardts ' s solution), phosphate buffer (PBS buffer), pepsin K, bovine serum albumin(BSA) (BSA), triethanolamine (TEA), TNB Buffer (0.1M Tris-HCl, pH7.5,0.15M NaCL, 0.5%Blocking Reagent), TNT Buffer (0.1M Tris-HCl, pH7.5,0.15M NaCL, 0.05%Tween 20), acetic anhydride, resistance Disconnected reagent (Blocking reagent agent, Roche company).

1.3 other main agents and material

Dehydrated alcohol, 90% alcohol, 70% alcohol, 50% alcohol, turpentine oil, distilled water, PBS buffer solution (pH7.2~ 7.4, NaCl 137mmol/L, KCl 2.7mmol/L, Na₂HPO₄4.3mmol/L, KH₂PO₄1.4mmol/L)；3% methanol- Hydrogen peroxide solution (80% methanol and the configuration of 30% hydrogen peroxide)；0.01mol/L citrate buffer (citrate buffer, CB, pH6.0 ± 0.1,9ml 0.1M citric acid solution and 41ml 0.1M sodium citrate solution are added interim in 450ml distilled water With postponing correction work liquid pH value again)；0.1% trypsase；Haematoxylin；1% hydrochloride alcohol (1ml concentrated hydrochloric acid+99ml 70% Alcohol configuration)；Mounting glue (PTS Cure Mount II).Leica low melting point (58 DEG C) paraffin, domestic beeswax, absolute alcohol, two Toluene, 10% neutral paraformaldehyde (0.01mol/L, pH7.4, DEPC distilled water and PBS buffer solution are prepared), haematoxylin, Yihong, Neutral mounting natural gum, coverslip, glass slide.

1.4 label probe

Oligonucleotide probe label is carried out using 3-tailing DIG Olignucleutide Kit, reaction system is such as Under.

100pmol oligonucleotide+ddH₂O=9 μ l (control:control oligonucleutide 5μ l+ddH₂O 4μl)

It mixes, is slightly centrifuged.37 DEG C of water-bath 30min add 2 μ l EDTA (0.2M, PH 8.0) stopped reactions.

It is purified after 1.5 oligonucleotide probes label

In order to increase the purity of label probe, marked probe need to be purified, concrete operations are as follows：

1) cold ethyl alcohol (- 20 DEG C) of+2.5 μ l 4M LiCl+75 μ l of probe reaction mixture (22 μ l) 100%

2) -70 DEG C of precipitatings 60min, or-20 DEG C of 2h.

3) 13.000 × g, 4 DEG C of centrifugation 15min.

4) supernatant is abandoned, with 70% (V/V) ethanol washing that 50 μ l are ice-cold.

5) 4 DEG C of 13.000xg are centrifuged 5min.

6) supernatant, 4 DEG C of dryings of vacuum are abandoned.

7) with the molten probe of aseptic double-distilled water weight.

1.6 in situ hybridizations detection achieves the expression of BART6-3p in paraffin section

Paraffin section hybridizes pre-treatment

1) paraffin section of 4 DEG C of preservations is placed in 58 DEG C of roasting piece 30min, melted surface paraffin.

2) dimethylbenzene successively dewaxes 3 × 5min.

3) step ethanol wash, 100% 1 × 5min of the alcohol of 2 × 2min of alcohol → 95% alcohol of 1 × 5min → 70% → 50% 1 × 5min of alcohol → 2 × 3min of DEPC water washing → DEPC-PBS washs 2 × 5min.

4) 300 μ l pepsin K (10 μ g/ml) are added dropwise on slice, 37 DEG C of digestion 20min.

5) it is sliced and washs 1min, stopped reaction into PBS (0.1M PBS+2mg/ml glutamic acid).

6) it is sliced into 0.2N HCL, in 37 DEG C of reaction 20-30min, increases the permeability of tissue.

7) slice fixes 10min, room temperature with 4% paraformaldehyde (0.1M PBS dissolution) afterwards.

8) in order to increase tissue positive intensity for hybridization, acetyl processing is carried out to slice.It is sliced into 0.25% acetic anhydride Buffer I (0.1M triethanolamine), room temperature 10min.

9) 1M PBS washs 2 × 5min.

Prehybridization and hybridization

Prehybridization：The prehybridization solution of -20 DEG C of preservations is first placed in 37 DEG C of incubation 60min, and the dosage of prehybridization solution is 50 μ l, Parafilm is carried out lid and is sliced, prehybridization 2 hours in 37 DEG C of wet box.(prehybridization solution composition includes：2XSSC, 10%Dextran Sulphate, 1X Denhardt ' s solution, 50mM Phosphate Buffer (PH 7.0), 50mM DTT, 250 μ l, 100 μ g/ml poly A, 5 μ g/ml poly dA, 250 μ g/ml yeast t-RNA, 500 μ g/ml ssDNA, 47% Deionized formamide)。

1) parafilm is removed, prehybridization solution is got rid of, slice is placed in 5min in 2 × SSC.

2) hybridization reaction：37 DEG C of hybridized overnights (18-20h).Each slice is added 250 μ l hybridization solutions and is carried out with parafilm Lid.Corresponding probe is added in prehybridization solution just becomes hybridization solution.Hybridization solution is prepared in prehybridization, is placed 37 DEG C of incubations, is made Probe is completely dissolved in hybridization solution, the final concentration of 500ng/ml of hybridization solution middle probe used in this experiment.

3) post-hybridization washing, slice immerse 2 × SSC, 10min, throw off parafilm.Successively washed in shake on shaking table, 2 × SSC (0.5%SDS), 2 × 15min → 0.25 × SSC (0.5%SDS), 2 × 15min.

Color developing detection is reacted after hybridization

1) digoxigenin-probe compound in conjunction with mRNA is detected using Anti-Digoxigenin-POD；TSA amplification system Enhance the positive signal of in situ hybridization reaction solution reaction, DAB colour developing.

2) slice is gone in TNT buffer, 3 × 5min.

3) TNB is added dropwise and blocks buffer, 300 μ l/TMAs, room temperature, 30min.

4) extra blocking agent is sucked, 1:100 diluted Anti-Digoxigenin-POD (TBS+0.1%Triton X- 100+1% blocking agent), room temperature 4 hours.

5) TNT Buffer (0.1M Tris-CL, pH7.5,0.15M NaCL, 0.05%Tween 20) is washed, 3x5min。

6) signal is added dropwise on slice and amplifies reagent Biotinyl Tyamid, 300 μ l/TMAs, (Biotinyl Tyramid Store liquid：Biotinyl Tyramid is dissolved in 0.2ml DMSO, Biotinyl Tyramid working solution：1 × dilution, 1:50 Dilute Biotinyl Tyramid and store liquid), room temperature 10 minutes.

7) TNT is washed, 3 × 5min.

8) SA-HRP (strepto- avidin-horseradish peroxidase) is added dropwise in slice, 300 μ l/TMAs, room temperature 30min.

9) TNT is washed, 3 × 5min.

10) distilled water washing, 1 × 1min.

11) DAB develops the color, and controls chromogenic reaction under microscope.

12) haematoxylin is redyed,

13) alcohol step is dehydrated, chip drying.

14) mounting glue, the coverslip cover plate of dimension, crosslinking slice 1min under ultraviolet lamp is added dropwise.

The judgement of 1.7 results and standard

Application Optics microscope is observed under low power and high power lens respectively, looks first at the positive expression of target RNA The signal positioning intracellular in object observing：Positioned at nucleus, cytoplasm or cell membrane.

It is carried out respectively with two kinds of standards of the intensity of the detection rna expression position positive signal and the cell number of positive expression again Comprehensive score, judgment criteria are：(1) judge according to positive cell dyeing intensity：A. cell dye-free remembers 0 point；B. cell is dyed Light brown is weakly positive, remembers 1 point；C. cell dyes brown and dyes dark-brown without background coloration or cell and have light brown back Scape is moderate positive, remembers 2 points；D. cell dyes dark-brown and is strong positive without background coloration, remembers 3 points.(2) according to positive cell Express number score：A. no positive cell expression, remembers 0 point；B. positive expression cell number≤25% remembers 1 point；C.25% < is positive thin Born of the same parents' number < 50% remembers 2 points；D. positive expression cell number >=50% remembers 3 points.

In order to reduce the subjective factor of appraisal result as far as possible, it is respective that one of above-mentioned standard is pressed respectively by two pathology experts Judged and scored, then the two is scored and is multiplied, result is：1. 0 point of person is finally calculated as 0 point, it is believed that feminine gender expression；2. 1 point 1 point is finally calculated as with 2 points of persons, it is believed that weakly positive expression；3. 3 points and 4 points of persons are finally calculated as 2 points, it is believed that moderate positive expression；④ 6, which assign to 9 points of persons, is finally calculated as 3 points, it is believed that strong positive expression.

1.8 analyses and statistical software

Statistical analysis is carried out to experimental result using SPSS13.0 statistical software, compares use χ two-by-two²Test or Fisher Exact test, correlation analysis use Spearmen correlation method；P < 0.05 is that difference is statistically significant. Survivorship curve analysis uses Kaplan-Meier method and log-rank test；Multi-variables analysis uses Cox ' s proportional hazards model；P < 0.05 is that difference is statistically significant.

2 results

Expression of 2.1 BART6-3p in nasopharyngeal carcinoma is significantly increased than the expression in control tissue by cancer

There is the expression of 34 BART6-3p by 40 cancers in nasopharyngeal epithelium (Adjacent Epithelial of NPC) Low (Low) or be substantially not detectable (negative), and in 115 nasopharyngeal carcinoma (NPC) 57 detected BART6-3p Low expression (Low), remaining 58 are high expression (high), P<0.001 (Fig. 2 and Fig. 3).

The expression and nasopharynx metastasis of cancer Close relation of 2.2 BART6-3p

We queried clinical data of 115 Nasopharyngeal Carcinoma Patients, such as age of onset, gender, TNM stage etc., and right They have carried out Effect of follow-up visit by telephone, inquired in detail they start time, treatment condition, whether there is or not recurrence, whether there is or not suffer from other diseases again Disease, recurrence and death time etc., and register life span and state.We have found that detecting BART6- in tissues of nasopharyngeal carcinoma The expression of 3p and DISTANT METASTASES IN (Distance metastasis) negative correlation of Nasopharyngeal Carcinoma Patients turn at a distance The expression of shifting group BART6-3p is than recurrence group in situ (Local relapse) relatively low, (Fig. 4, P<0.05).

The Nasopharyngeal Carcinoma Patients prognosis of 2.3 BART6-3p low expressions is poor

The survival analysis that we carry out the expression of BART6-3p in tissues of nasopharyngeal carcinoma and the life span of patient and state, It was found that the expression of BART6-3p and the prognosis of Nasopharyngeal Carcinoma Patients are closely related in nasopharyngeal carcinoma, BART6-3p high expresses the trouble of (High) Person's life span will be considerably longer than the patient (Fig. 5) of BART6-3p low expression (Low).

Expression of 2.4 BART6-3p in gastric cancer is significantly increased than the expression in control tissue by cancer

29 detect the low expression (Low) of BART6-3p in 37 stomach organizations, and in addition 8 are high expression (high), there are the expression of 35 BART6-3p low (Low) or basic inspection and in the corresponding cancer beside organism of these gastric cancer samples (negative) is not detected, only 2, Ps positive for BART6-3p<0.05 (Fig. 6).

The patients with gastric cancer prognosis of 2.5 BART6-3p low expressions is poor

The survival analysis that we carry out the expression of BART6-3p in stomach organization and the life span of patient and state, hair The expression of BART6-3p and the prognosis of patients with gastric cancer are closely related in existing gastric cancer, and BART6-3p high expresses the survival of patients of (High) Time will be considerably longer than the patient (Fig. 7) of BART6-3p low expression (Low).

Embodiment 3 is overexpressed growing multiplication and invasion transfer that BART6-3p inhibits tumour cell

1. MATERIALS METHODS

1.1 cell culture and transfection

Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 of EBV feminine gender, stomach cancer cell AGS are purchased from Central South University's cell centre, cell Cultivating RPMI 1640 used and training trypsase used in base and fetal calf serum and vitellophag is that Gibco company of the U.S. produces Product.

BART6-3p is synthesized by Invitrogen company by chemical synthesis, and sequence is:

CGGGGAUCGGACUAGCCUUAGA

The good tumor cell line of growth conditions is pressed 2 × 10⁵A cells/well is inoculated in 6 orifice plates, and 6 orifice plates are placed in 37 DEG C, 5%CO₂In incubator, cell to be cultivated, which grows to 50-70% density, can start the transfection of BART6-3p；It transfected Journey is as follows：

The Hiperfect transfection reagent (Qiagen Products) that 8 μ l are added in sterile EP tube is trained in 100 μ l serum-frees It supports to mix in base and stands 5min；

BART6-3p is added in 100 μ l serum free mediums；Then with above-mentioned comprising 100 μ of Hiperfect transfection reagent L serum free medium mildly mixes, and is stored at room temperature 30 minutes, them is made to form complex；

It is washed cell 3 times with D-Hank's liquid；

800 μ l serum free mediums (antibiotic-free) will be added in said mixture, be added in 6 orifice plates after mild mixing 1 hole；

6 orifice plates are placed in CO₂In incubator, 37 DEG C are cultivated 6 hours, and supernatant is then abandoned, and complete medium is added and continues to train It supports 48 hours.

1.2 real-time quantitative PCRs detect the effect of BART6-3p expression：

After cell transfecting success, extracted total RNA, reverse transcription, the expression of quantitative real-time PCR detection BART6-3p, Method and steps is the same as embodiment 1.

1.3 cell proliferation experiment

MTT experiment [3- (4,5-dimethylthiazole-2-yl) -2.5-dipheny-tetrazolium bromide Assay] it is the conventional means for detecting tumor cell proliferation, steps are as follows for specific experiment：

1) it by cell dissociation, counts, every hole is inoculated with 500 cells in 96 orifice plates, and it is last to need to be arranged 5 multiple holes daily It averages, is arranged 5 days altogether；

2) it places incubator culture at least 5 hours, after cell is adherent, adds 20 μ l of MTT liquid (5mg/ml).Continue culture 4 Hour, discard culture solution.200 μ l DMSO are added in every hole, place 10 minutes on shaking table；

3) 490nm wavelength is selected, on enzyme-linked immunosorbent assay instrument, each hole absorbance value is measured and records as a result, hereafter every Every 24 hours repetition steps 2, a numerical value is recorded, amounts to detection 5 days；

4) it tests in triplicate.Using each time point as abscissa, absorbance value is ordinate, draws MTT curve.

1.4 cell scratch experiments

Cell scratch experiment is the experimental method for verifying tumor cell migration ability.BART6-3p or control are transfected (scramble) nasopharyngeal carcinoma of sequence or stomach cancer cell are inoculated in 6 orifice plates, when cell density reaches 90%, use 200ul Pipet draws a straight line (scratch) in each 6 orifice plates, then in the various time points such as 0,8,12,16,24,32,48 hour (depending on different cell migration abilities) observe scratch healing state under the microscope, take pictures, and calculate group of cells migration speed Degree.

The experiment of 1.5 cell-penetratings

((transwell) experiment is to verify the experimental method of tumor cell invasion ability to cell-penetrating.Transwell is small Room (8 μm of aperture) and matrigel (Matrigel) are purchased from U.S. company BD, 4% paraformaldehyde fixer, crystal violet dye liquor (0.1%g/ml) is purchased from Sigma company.Matrigel is pressed 1:8 dilutions, are coated on the upper chamber of the cell Transwell bottom film Face, setting 37 DEG C makes Matrigel aggregate into gel in 30 minutes.Matrigel film water is carried out by BD company specification using preceding.

Serum free medium and 1 × 10 is added on each cell Transwell upper layer⁵It is a to have transfected BART6-3p or control (scramble) culture for containing 20% fetal calf serum is added in the cell Transwell lower layer for the nasopharyngeal carcinoma or stomach cancer cell of sequence Base.After cell continues culture 36 hours, fixed with 4% paraformaldehyde fixer, violet staining dabs off upper layer with cotton swab Non- migrating cell is washed 3 times with PBS.The tumour cell across matrix glue film is observed under the microscope.

2. result

After 2.1 transfection BART6-3p, the expression of BART6-3p is significantly increased in tumour cell

After transfecting BART6-3p in nasopharyngeal carcinoma cell 5-8F, HNE2 of EBV feminine gender, stomach cancer cell AGS, BART6-3p exists Expression in nasopharyngeal carcinoma and stomach cancer cell significantly increases (Fig. 8), shows that BART6-3p is transfected successfully.

Tumor cell proliferation speed slows down after 2.2 transfection BART6-3p

MTT cell proliferation experiment confirms, is transferred to BART6- in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2, gastric carcinoma cell lines AGS After 3p, the growing multiplication speed of 3 plants of tumour cells obviously slows down (Fig. 9).

Cell migration reduced capability after 2.3 transfection BART6-3p

Cell scratch experiment confirms, after being transferred to BART6-3p in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and stomach cancer cell AGS 3 plants of tumour cells slow down from scratch both sides toward the speed that scratch center migrates, and the time of scratch healing extends, and show cell movement Transfer ability reduces (Figure 10).

Cell invasion ability reduces after 2.4 transfection BART6-3p

Cell-penetrating (transwell) is it is experimentally confirmed that in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and stomach cancer cell AGS transfer After entering BART6-3p, the tumor cell number that can pass through matrix glue film is substantially reduced, and shows cell invasion reduced capability (Figure 11).

Embodiment 4 is overexpressed the expression that BART6-3p inhibits lncRNA gene LOC553103 in tumour cell

1. MATERIALS METHODS

1.1 cell culture and transfection

CGGGGAUCGGACUAGCCUUAGA

The method and steps of BART6-3p is transfected in tumour cell with embodiment 3.

The expression of lncRNA gene LOC553103 after 1.2 real-time quantitative PCRs detection transfection BART6-3p：

After cell transfecting success, extracted total RNA, reverse transcription, quantitative real-time PCR detection lncRNA gene The expression of LOC553103, for method and steps with embodiment 1, the primer sequence is as follows：

Primer sequence for real time fluorescent quantitative detection LOC553103 expression：

LOC553103 forward primer：5'-acagtagtgcgatcaaggct-3'

LOC553103 reverse primer：5'-tcaccacctccctgttcttc-3'

Reference gene GAPDH Specific PCR primers：

Forward primer 5 '-ACCACAGTCCATGCCATCAC-3 '

Reverse primer 5 '-TCCACCACCCTGTTGCTGTA-3 '.

2. result

After transfecting BART6-3p, the expression of LOC553013 is significantly reduced in tumour cell

After transfecting BART6-3p in nasopharyngeal carcinoma cell 5-8F, HNE2 of EBV feminine gender, stomach cancer cell AGS, lncRNA gene The expression of LOC553103 significantly reduces (Figure 12), shows that BART6-3p can inhibit the expression of LOC553010, in other words LncRNA gene LOC553103 is the target gene of BART6-3p.

Embodiment 5, RNA interference method inhibit the expression of LOC553103 in tumour cell that can inhibit the growth of tumour cell Proliferation and invasion transfer

1. MATERIALS METHODS

1.1 cell culture and transfection

Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2, stomach cancer cell AGS are purchased from Central South University's cell centre, used in cell culture It is U.S.'s Gibco Products that RPMI1640, which trains trypsase used in base and fetal calf serum and vitellophag,.

Specificity is as follows for the RNA interference sequence (siRNA) of LOC553103：

siRNA-1：5'-AUAACAUGACAGCUUGCUUGUCUCC-3'

siRNA-2：5'-CUUCCAAGCUCACUCAAGGUUGUUG-3'

siRNA-3：5'-CUAAUAUUCCCUCAGAGCUGGGCUG-3'

Above-mentioned specificity is synthesized for the RNA interference sequence of LOC553103 by Invitrogen company, negative control (NC, Scramble) sequence is also synthesized and is provided by Invitrogen company.

The method and steps of cell transfecting is the same as embodiment 3.

After 1.2 RNA interfere the expression of LOC553103, pass through cell proliferation experiment, cell-penetrating experiment and cell scratch Experiment has detected the artificial variation for lowering the growth of cell, proliferation, invasion and transfer ability after LOC553103 is expressed.Specific side Method and step are the same as embodiment 3.

2. result

After 2.1 transfection specificity are for the RNA interference sequence of LOC553103, the expression water of LOC553103 in tumour cell It is flat to significantly reduce

The RNA that specificity is transfected in nasopharyngeal carcinoma cell 5-8F, HNE2, stomach cancer cell AGS for LOC553103 interferes sequence After column, expression of the LOC553103 in above-mentioned cell significantly reduces (Figure 13), shows the RNA interference sequence for LOC553103 Column, which transfect, successfully inhibits the effect of LOC553103 expression obvious.

Tumor cell proliferation speed slows down after 2.2 interference LOC553103 expression

MTT cell proliferation experiment confirms, is transferred to specificity in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2, gastric carcinoma cell lines AGS After the RNA interference sequence of LOC553103, the growing multiplication speed of 3 plants of tumour cells obviously slows down (Figure 14).

Cell migration reduced capability after 2.3 interference LOC553103 expression

Cell scratch experiment confirms, is transferred to specificity in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and stomach cancer cell AGS and is directed to The RNA interference sequence posterior nasopharynx cancer and stomach cancer cell of LOC553103 slows down from scratch both sides toward the speed that scratch center migrates, and draws The time of trace healing extends, and shows that cell movement transfer ability reduces (Figure 15).

Cell invasion ability reduces after 2.4 interference LOC553103 expression

Cell-penetrating (transwell) is it is experimentally confirmed that in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and stomach cancer cell AGS transfer After entering specificity for the RNA interference sequence of LOC553103, the tumor cell number that can pass through matrix glue film is substantially reduced, table Clear-cells invasive ability weakens (Figure 16).

Embodiment 6 further confirms to be overexpressed BART6-3p or inhibits tumour cell with RNA interference method in animal model The expression of middle LOC553103 can inhibit growing multiplication and the invasion transfer of tumour cell

1. MATERIALS METHODS

1.1 cell culture and transfection

Nasopharyngeal Carcinoma Cell Line 5-8F is purchased from Central South University's cell centre, and RPMI 1640 used in cell culture trains base and tire ox Trypsase used in serum and vitellophag is U.S.'s Gibco Products.

The method of BART6-3p is overexpressed in 5-8F cell with embodiment 3；

Specificity is transfected in 5-8F cell for the RNA interference sequence of LOC553103 to inhibit intracellular LOC553103 The method of expression is the same as embodiment 5.

The RNA interference sequence pair of 1.2 nude mices " tail vein injection-Lung metastases " model inspection BART6-3p and LOC553103 The inhibiting effect of metastatic ability of nasopharyngeal carcinoma cells

4 week old male nude mouses are purchased from Central South University's Experimental Animal Center, divide 3 groups, every group 10, logarithmic growth phase turns 5-8F cell (such as back of BART6-3p or RNA interference sequence and Scramble sequence (as negative control, NC) is contaminated It is described), after pancreatin digests, under room temperature (15~25 DEG C), 1000rpm is centrifuged minute, discards supernatant, 1 × PBS washing 2 It is secondary, cell is then resuspended and counts.Take 3.5 × 10⁶Cell/only, through in tail vein injection to nude mouse.Continue conventinal breeding 40 It, puts to death nude mice, observes the size and distribution situation of metastatic tumor in nude mice lungs.

The RNA interference sequence of 1.3 Xenografts in nude mice model inspection BART6-3p and LOC553103 is to nasopharyngeal carcinoma cell The inhibiting effect of proliferative capacity

4 week old male nude mouses are purchased from Central South University's Experimental Animal Center, divide 3 groups, every group 4, logarithmic growth phase turns 5-8F cell (such as back of BART6-3p or RNA interference sequence and Scramble sequence (as negative control, NC) is contaminated It is described), after pancreatin digests, under room temperature (15~25 DEG C), 1000rpm is centrifuged minute, discards supernatant, 1 × PBS washing 2 It is secondary, cell is then resuspended and counts.Take 3.5 × 10⁶Cell/only, it is subcutaneous to be inoculated in armpit on the right side of nude mice.Observation connects on time daily The ordinary circumstance and the state of mind of nude mice, weigh after kind tumour cell, the time and size that record transplantable tumor is formed.Use vernier Slide calliper rule survey transplantable tumor long (length, L), wide (width, W) and high (height, H), calculating gross tumor volume (V), V=4 π/3* (L/2*W/2*H/2).Growth of transplanted human curve is drawn according to tumor size.Nude mice is put to death after 35 days, is taken out transplanting tumor tissue and is used 10% formaldehyde is fixed.

2. result

2.1 nude mices " tail vein injection-Lung metastases " model further confirms that transfection BART6-3p or specificity are directed to After the RNA interference sequence of LOC553103, Nasopharyngeal neoplasms ability is reduced

After BART6-3p or specificity are transfected in nasopharyngeal carcinoma cell 5-8F for the RNA interference sequence of LOC553103, with Transfection negative control (Scramble sequence, NC) compare, in nude mice " tail vein injection-Lung metastases " model BART6-3p and The number of metastatic tumor significantly reduces (Figure 17 and Figure 18) in two groups of nude mice lungs of LOC553103, show be overexpressed BART6-3p or Inhibiting the expression of LOC553103 can inhibit the invasion of tumour cell to shift really.

2.2 Xenografts in nude mice models further confirm that transfection BART6-3p or specificity are directed to the RNA of LOC553103 Tumor cell proliferation speed slows down after interference sequence

After BART6-3p or specificity are transfected in nasopharyngeal carcinoma cell 5-8F for the RNA interference sequence of LOC553103, with Transfection negative control (Scramble sequence, NC) is compared, the life of two groups of Xenografts in nude mice of BART6-3p and LOC553103 Long growth rate obviously slows down (Figure 19, Figure 20).

Embodiment 7 expresses BART6-3p or inhibits the expression of LOC553103 in tumour cell that can change with RNA interference method Become the integrality of cytoskeleton in tumour cell

1. MATERIALS METHODS

1.1 cell culture and transfection

The method of BART6-3p is overexpressed in 5-8F cell with embodiment 3；

1.2 immunofluorescence experiment

1) cell inoculation：By the coverslip disinfected (75% ethanol for disinfection impregnated 2 hours, and in ultraviolet irradiation 1 hour) It is placed in the hole of six orifice plates, BART6-3p or transfection specificity will be overexpressed for the 5-8F of the RNA interference sequence of LOC553103 Cell and negative control cell (transfection Scramble sequence) are added separately on the coverslip in six orifice plates, are placed on cell training It supports case culture 24 hours；Tissue culture plate is taken out, the PBS of 37 DEG C of preheatings, which leniently shakes, to be washed 3 times；Natural air drying；

2) 4% paraformaldehyde of 37 DEG C of preheatings is in 37 DEG C of fixed 15min, and the PBS of preheating, which mildly shakes, to be washed 3 times, each 5min；

3) by FITC-phalloidin (being purchased from Sigma company, be used for flag F-actin) 1:500 dilutions, 37 DEG C of incubations The PBS of 50min, preheating are washed three times；

4) DAPI dyes 5min, and the PBS of preheating is cleaned 3 times；

5) clear water washes 3 times and removes PBS, dries mounting, observes and take pictures under laser confocal microscope.

2. result

Immunofluorescence results show that the F-actin (cytoskeleton) of FITC label in green, is distributed in endochylema, DAPI mark The nucleic acid of note is blue, is distributed in nucleus.Cellular control unit regular shape, cytoskeleton clearly become clear, and rich content is in Fiber radial air is arranged along cell long axis, and stress fiber clear layer, karyon is dyed to navy blue；BART6-3p group (Figure 21) and LOC553103 interference group (Figure 22) cytoskeleton depolymerization, Microfilaments In Cells shorten, and arrangement is sparse, and stress fiber number significantly reduces Attenuate, nucleus is intensely dark, and cell shrinkage is rounded, and nucleus is intensely dark, and intercellular bridge shape skeleton connection fiber subtracts It less or disappears, cytoskeleton assembling after the expression for being overexpressed BART6-3p or interference LOC553103 is prompted to receive obvious inhibition, And affect growth, proliferation and the invasion transfer ability of tumour cell.

Embodiment 8, quantitative real-time PCR detection confirm that LOC553103 expresses downward in nasopharyngeal carcinoma and gastric cancer

1. materials and methods：

It is right by 5 normal nasopharyngeal epithelial tissues and 18 tissues of nasopharyngeal carcinoma and 18 pairs of stomach organizations and corresponding cancer to collect According to tissue Trizol (invitrogen Products) extracted total RNA, 2 μ g RNA Reverse Transcriptase kit (Qiagen company Product) reverse transcription at cDNA after, carried out in real time with QuantiTect SYBR Green PCR kit (Qiagen Products) The expression of fluorescence quantitative PCR detection LOC553103 and reference gene GAPDH.PCR primer and amplification method are the same as embodiment 4.

The amplification curve and melting curve of real-time fluorescence quantitative PCR, the expression intensity root of each gene are confirmed after reaction After CT value (threshold cycle values), reference gene (GAPDH) markization, using group t-test checking computation P value.

2. result

LOC553103 is expressed higher (Figure 24) in normal nasopharyngeal epithelium (Figure 23) or Stomach Carcinomas side control tissue, and Expression is lower in tissues of nasopharyngeal carcinoma (Figure 23) or stomach organization (Figure 24).

Embodiment 9, expression of the in situ hybridization detection discovery LOC553103 in nasopharyngeal carcinoma and gastric cancer are related to patient's prognosis

1. MATERIALS METHODS

1.1 design and synthesize hybridization probe

In order to which using the expression of in-situ hybridization method detection LOC553103, we devise examines in situ hybridization Survey the oligonucleotide probe and positive control (GAPDH) in situ hybridization oligonucleotide probe of LOC553103 expression.

LOC553103 probe sequence -1：5'-CAGAAAAUAAAGUCACAGAGCUCCUGGAAC-3'

LOC553103 probe sequence -2：5'-ACUGUUUCCUCUCUGCCUUGAUUGAAAUUC-3'

LOC553103 probe sequence -3：5'-ACACUUUGAAAUUUUUGUCACCUCCCUUGA-3'

Positive control probe (detection house-keeping gene GAPDH)：

GAPDH probe sequence -1：5'-CCACUUUACCAGAGUUAAAAGCAGCCCUGG-3'

GAPDH probe sequence -2：5'-CAGUAGAGGCAGGGAUGAUGUUCUGGAGAG-3'

GAPDH probe sequence -3：5'-GUCAGAGGAGACCACCUGGUGCUCAGUGUA-3'

1.2 oligonucleotide probe labelling kits and in situ hybridization detection method, result judgement and statistical method are equivalent real Apply example 2

2 results

Expression of 2.1 LOC553103 in nasopharyngeal carcinoma is significantly reduced than the expression in control tissue by cancer

There is the expression of 36 LOC553103 by 40 cancers in nasopharyngeal epithelium (Adjacent Epithelial of NPC) Higher (Figure 25 is left), and lower (Figure 25 the is right) P of the expression of 57 LOC553103 in 115 nasopharyngeal carcinoma (NPC)<0.001. The expression of LOC553103 and BART6-3p are in significant negatively correlated.

It is poor that 2.2 LOC553103 express high Nasopharyngeal Carcinoma Patients prognosis

The existence point that we carry out the expression of LOC553103 in tissues of nasopharyngeal carcinoma and the life span of patient and state Analysis finds that the expression of LOC553103 and the prognosis of Nasopharyngeal Carcinoma Patients are closely related in nasopharyngeal carcinoma, LOC553103 low expression (Low) The survival of patients time to be considerably longer than LOC553103 high expression (high) patient (Figure 26, P=0.03).

Expression of 2.3 LOC553103 in gastric cancer is significantly reduced than the expression in control tissue by cancer

29 detect the low expression (Figure 27 is right) of LOC553103 in 37 stomach organizations, remaining 8 are high table It reaches, and has that the expression of 35 LOC553103 is higher (Figure 27 left) in the corresponding cancer beside organism of these gastric cancer samples, P<0.05. The highly expressed patients with gastric cancer prognosis of 2.4LOC553103 is poor

The survival analysis that we carry out the expression of LOC553103 in stomach organization and the life span of patient and state, It was found that the expression of LOC553103 and the prognosis of patients with gastric cancer are closely related in gastric cancer, LOC553103 high expresses the patient of (High) Life span will be significantly shorter than patient (Figure 28, the P of LOC553103 low expression (Low)<0.05).

Claims

1. the reagent of the microRNA BART6-3p of detection Epstein-Barr virus coding is preparing patients with gastric cancer relapse and metastasis and prognosis is pre- Purposes in the preparation of survey；The transfer negative correlation of the expression of BART6-3p and patients with gastric cancer in stomach organization, BART6-3p expresses high patient and does not allow easy to recur, and life span is longer；The sequence of BART6-3p： CGGGGAUCGGACUAGCCUUAGA。

2. the reagent of the microRNA BART6-3p of detection Epstein-Barr virus coding according to claim 1 is suffered from preparation gastric cancer Purposes in the preparation of person's relapse and metastasis and prognosis prediction, which is characterized in that the patients with gastric cancer relapse and metastasis and pre- The preparation predicted afterwards is that in situ hybridization detects preparation or real-time fluorescence quantitative PCR reagent.

3. the reagent of the microRNA BART6-3p of detection Epstein-Barr virus coding according to claim 2 is suffered from preparation gastric cancer Purposes in the preparation of person's relapse and metastasis and prognosis prediction, which is characterized in that include in the in situ hybridization detection preparation The in situ hybridization probe of the microRNA BART6-3p of Epstein-Barr virus coding is detected, sequence is： UCUAAGGCUAGUCCGAUCCCCG。

4. the reagent of the microRNA BART6-3p of detection Epstein-Barr virus coding according to claim 2 or 3 is in preparation gastric cancer Purposes in the preparation of Patients on Recurrence transfer and prognosis prediction, which is characterized in that the in situ hybridization detection preparation is examination Agent box.

5. the reagent of the microRNA BART6-3p of detection Epstein-Barr virus coding according to claim 4 is suffered from preparation gastric cancer Purposes in the preparation of person's relapse and metastasis and prognosis prediction, which is characterized in that include in kit：Detect Epstein-Barr virus coding The in situ hybridization probe of microRNA BART6-3p, sequence are：UCUAAGGCUAGUCCGAUCCCCG；Detect reference gene The in situ hybridization probe of GAPDH, sequence are：CAGUAGAGGCAGGGAUGAUGUUCU.

6. the reagent of the microRNA BART6-3p of detection Epstein-Barr virus coding according to claim 5 is suffered from preparation gastric cancer Purposes in the preparation of person's relapse and metastasis and prognosis prediction, which is characterized in that kit further includes：Digoxin oligonucleotides adds Tail reagent, anti-digoxin-horseradish peroxidase complex detection reagent, DAB staining reagent；

Other conventional biochemical reagents, including 20x SSC, dextran sulfate, deionized formamide, polyadenylic acid, poly Deoxyadenylic acid, is denaturalized the salmon sperm DNA of shearing, yeast transfer RNA, dithiothreitol (DTT), 50xDenhardts ' s solution,

PBS buffer, pepsin K, bovine serum albumin(BSA), triethanolamine, acetic anhydride,

TNB buffer：The 0.1M Tris-Cl+0.15M NaCl+0.5% of pH7.5 blocks reagent；

TNT buffer：The 0.1M Tris-Cl+0.15M NaCl+0.05%Tween 20 of pH7.5.