CN110251529A - MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament - Google Patents
MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament Download PDFInfo
- Publication number
- CN110251529A CN110251529A CN201910370130.7A CN201910370130A CN110251529A CN 110251529 A CN110251529 A CN 110251529A CN 201910370130 A CN201910370130 A CN 201910370130A CN 110251529 A CN110251529 A CN 110251529A
- Authority
- CN
- China
- Prior art keywords
- mir
- breast cancer
- expression
- cell
- mgat5
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
- A61P15/14—Drugs for genital or sexual disorders; Contraceptives for lactation disorders, e.g. galactorrhoea
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/645—Specially adapted constructive features of fluorimeters
- G01N21/6456—Spatial resolved fluorescence measurements; Imaging
- G01N21/6458—Fluorescence microscopy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The present invention provides miR-124-3p and its analog to prepare the application in anti-breast cancer disease medicament, the sequence of the miR-124-3p are as follows: 5 '-UAAGGCACGCGGUGAAUGCCAA-3 '.The present invention the experiment proved that, in breast cancer generating process, the expression of miR-124-3p is significantly inhibited；The expression for restoring miR-124-3p can adjust the expression of MGAT5 by targeting, inhibit the proliferation and migration of breast cancer cell, to play antitumor action.The present invention provides new molecule marker for the diagnosis of breast cancer, and new potential molecular target is also provided for clinical treatment.
Description
Technical field
The invention belongs to biomedicine technical fields, and in particular to miR-124-3p and its analog are preparing anti-breast cancer
Application in disease medicament.
Background technique
Breast cancer is that the malignant tumour of women's health is seriously endangered in a world wide.The Cancer in China delivered in 2015
In statistical data the most common malignant tumour of women be breast cancer, the 15% of Zhan Suoyou female cancer, be that 45 years old or less women is most normal
The cancer cause of the death seen.In U.S.'s recent statistics data in 2019, breast cancer ranked first position in women new cancer, monopolize
30%, the death rate is also only second to lung cancer, is 15%.The current clinical treatment of breast cancer take individualized treatment as leading, DNA chip
The development that technology studies breast cancer molecular horizontal properties, so that according to the breast cancer classification system of gene expression profile to treatment side
The directive significance of formula becomes clear day by day, and establishes relapse and metastasis risk assessment on the basis of genetic test and also affects determining for treatment
Plan.Existing chemotherapy, endocrine therapy, for the targeted therapy of Her2 all has apparent side to the prognosis of patient with breast cancer at radiotherapy
It helps, but these treatments are not one master key, the breast cancer of all hypotypes can not be completely covered, still some is insensitive
Refractory type breast cancer and obvious drug resistance the problem of occur.Therefore, recognize breast cancer in many aspects deeper into ground to send out
Exhibition and resistance mechanism, help to open up new treatment channel, developing new drug object, this is controlling for drug resistance and refractory breast cancer
Treat one of strategy.For example after Her2 breast cancer patients with positive drug resistance, using Lapatinib and handkerchief trastuzumab, endocrine therapy is resistance to
Medicine patient uses mTOR inhibitors, is directed to BRCA1 or vascular endothelial growth factor after triple negative breast cancer chemotherapy resistance
(vascular endothelial growth factor, VEGF) is treated, these are expedited the emergence of out by clinic needs
Novel method for the treatment of.Therefore, by the deep understanding to breast cancer occurrence and development and resistance mechanism, new therapeutic target is researched and developed
Point lowers drug resistance, increases the covering range for the treatment of, will to improve the disease-free survival rate and overall survival of breast cancer group
It is the focus on research direction of current breast cancer treatment.
MicroRNA is that one kind for being found in a variety of life entities such as drosophila, nematode, mouse and people in recent years has and turns
Active microRNA is adjusted after record, length is about 22 nucleotide.By the building and sequencing in library, people are grasped
A large amount of sequence informations of microRNA compare analysis by carrying out bioinformatics to these sequences, it has been found that: it is most of
MicroRNA is highly conserved between species, in upper very high homology of evolving, by non-turning over the 3 ' of mRNA (messenger RNA)
Area (3 ' untranslational region, 3 '-UTR) interaction is translated to regulate and control the translation of mRNA, and then wide participation
The various biologicals activity such as development, tumour, inflammation.The study found that miRNA has abnormal expression in many human tumors,
They or the expression by changing oncogene or tumor suppressor gene, directly affect growth, proliferation and the apoptosis of tumour, or with tumour
Phenotype, by stages and survival of patients has correlation, thus to early diagnose and monitor the appearance of the identity of the biomarker of the state of an illness.Example
Such as: miR-200 family, to inhibit Epithelial and stromal, can finally be pressed down by the expression of the transcription factors such as targeted inhibition ZEB1
The invasion of tumour are made.
Mature miR-124-3p be the transcription head product (pri-miRNA) transcription by RNA polymerase II process and
At.Pri-miRNA is cut into the stem circular rna chain of about 70 nucleotide in nucleus by Drosha endonuclease, referred to as
MiRNA precursor (pre-miRNA).Pre-miRNA is transported in endochylema by caryoplasm/cytoplasm albumen 5 (exportin-5),
By double-stranded RNA specificity RNA restriction endonuclease Dicer digestion at the double-stranded RNA of 21~23 nucleotide, wherein one is mature
MiRNA, another is complementary strand.It is compound that mature miR-124 forms RNA induction silencing in conjunction with Argonaute protein family
Object (RNA-induced silencing complex, RISC).The 3' for being incorporated into target gene mRNA by nucleic acid array complementation is non-
Code area plays the effect for inhibiting target gene mRNA translation or degradation target gene mRNA.
MiR-124-3p is a kind of miRNA that content is most in central nervous system, in the growth course of mammal brain
In, the expression quantity of miR-124-3p is gradually increased in fetal period, is reached peak in Late Embryogenesis, is constantly in after birth
High expression level.MiR-124-3p can identify hundreds of said target mrna, have decisive significance to the development of nervous system.It is many
Studies have shown that weakening since miR-124-3p content reduces it to the inhibiting effect of downstream target gene, caused by different accesses
The generation of tumour.MiR-124- is detected in medulloblastoma and patient's oncocyte of glioblastoma multiforme
3p expression reduce, cause the exception of CDK-6 to increase, and this index increase be poor prognosis mark.In liver cancer cells, miR-
The expression of 124-3p also substantially reduces, and the expression of phosphatidylinositol3 3 kinase (PI3K) catalytic subunit is caused to increase, eventually by
PI3K/Akt access causes cell to be largely proliferated.Clinical research also indicates that, miR-124-3p in the cancer cell of colorectal cancer patients
Expression quantity be substantially less than normal level.
Summary of the invention
The object of the present invention is to provide miR-124-3p and its analog to prepare the application in anti-breast cancer disease medicament,
The new medical usage, in particular to miR-124-3p of miR-124-3p is developed in diagnosis of malignant tumor and molecular targeted therapy
In application, disclose miR-124-3p breast cancer diagnosis and treatment in potential value.
In order to achieve the above object, technical scheme is as follows:
The first aspect of the present invention, provide miR-124-3p new medical usage, in particular to miR-124-3p and its
Analog is preparing the application in anti-breast cancer disease medicament, and the sequence of the miR-124-3p is as follows: 5 '-
UAAGGCACGCGGUGAAUGCCAA-3’。
MiR-124-3p of the present invention can come from being separated cell, or can be obtained by artificial synthesized mode
?.
Further, the miR-124-3p includes but is not limited to its analog: miR-124-3p sequence；Specificity interference
The small disturbing molecule of miR-124-3p gene expression, processing, such as siRNA molecule, miRNA molecule, GEM 132；Contain
The expression plasmid of miR-124-3p sequence；High expression adenovirus or slow virus containing miR-124-3p sequence.
In the present invention, the anti-breast cancer disease medicament refers to the examination that can be improved or increase miR-124-3p expression quantity
Agent.
In the present invention, the drug can inhibit the proliferation and migration of breast cancer cell by targeted molecular MGAT5.Into
One step, miR-124-3p is played a role by being directly targeted the 3 '-UTR regions of MGAT5.
Also, the anti-breast cancer refers to prevention or treatment breast cancer.
Second aspect of the present invention also provides a kind of pharmaceutical composition, which is unique living with miR-124-3p
Sexual element, or the pharmaceutical composition containing miR-124-3p.
Further, the pharmaceutical composition refers to containing a effective amount of miR-124-3p or its promotor, with
And pharmaceutically acceptable carrier.
Further, described " pharmaceutically acceptable " ingredient is suitable for people and/or animal and without excessively bad secondary anti-
It answers (such as toxicity, stimulation and allergy), that is, has the substance of reasonable benefit/risk ratio." effective quantity " refers to can be right
People and/or animal generate function or amount that is active and being received by people and/or animal." the pharmaceutically acceptable load
Body " refers to the carrier for Therapeutic Administration, including various excipient and diluent.The term refers to medicament carriers some in this way: it
Itself be not necessary active constituent, and there is no excessive toxicity after applying.Pharmaceutically acceptable load in the composition
Body can contain liquid, such as water, salt water, glycerol and ethyl alcohol.In addition, such as being filled out in these carriers there is likely to be complementary substance
Fill agent, lubricant, glidant, wetting agent or emulsifier, pH buffer substance etc..
The effective quantity of miR-145-3p of the invention can with the mode of administration and the severity of disease to be treated etc. and
Variation.Preferred a effective amount of selection can be determined by those of ordinary skill in the art depending on various factors (such as by facing
Bed test).The factor includes but is not limited to: the pharmacokinetic parameter of miR-124-3p for example bioavailability, metabolism,
Half-life period etc.；Patient disease to be treated, the weight of patient, the immune state of patient, the approach of administration etc..
In the present invention, any applicable administration route is all possible, including but not limited to: oral, intravenous injection, skin
Lower injection, muscle are given, administer locally to, being implanted into, being sustained and give；Preferably, the administration mode is that non-bowel is given.
The third aspect of the present invention provides miR-124-3p in preparation breast cancer disease diagnostic reagent or diagnostic kit
Application.
Further, the diagnostic reagent is detection miR-124-3p expression quantity or a effective amount of reagent.
Again, the diagnostic kit includes detection miR-124-3p expression quantity or a effective amount of reagent.
The diagnostic kit includes: (i) detects a effective amount of one or more reagents of miR-124-3p；(ii) it is selected from
One of the following group or many kinds of substance: container, operation instructions, positive control, negative control object, buffer, auxiliary agent or molten
Agent, such as the solution for being suspended or fixing cell, detectable label or tag, the solution for making nucleic acid be easy to hybridize are used for
The solution of lytic cell, or the solution for nucleic acid purification.
In the present invention, the detection miR-124-3p expression quantity or a effective amount of reagent include having to miR-124-3p
The PCR primer of specificity is detected, primer sequence is as follows:
Upstream primer (Forward Primer): CGACGTAAGGCACGCG；
Downstream primer (Reverse Primer): CAGTGCAGGGTCCGAGGTAT.
For the present invention by verification experimental verification, the proliferation and migration of breast cancer cell can be significantly inhibited by being overexpressed miR-124-3p
Ability.The research of the invention finds that 3 '-UTR regions of the miR-124-3p in MGAT5 have conservative target site, and pass through test
Demonstrate: the expression quantity of MGAT5mRNA is significantly higher than normal galactophore tissue, and the effect target of miR-124-3p in breast cancer tissue
Point is MGAT5, and miR-124-3p is played a role by being directly targeted the 3 '-UTR regions of MGAT5.
MGAT5 is overexpressed in the present invention can repair the inhibition work for being overexpressed miR-124-3p to Cells Proliferation of Human Breast Cancer ability
With the decline for raising caused breast cancer cell clonality by miR-124-3p, up-regulation can also be offset by being overexpressed MGAT5
The expression of MGAT5 can be repaired due to being overexpressed miR-124-3p to the inhibiting effect of breast cancer cell transfer ability, interference
The expression of MGAT5 can be offset due to lowering miR-124-3p to the facilitation of breast cancer cell transfer ability.Therefore, table is crossed
It can effectively inhibit the proliferation and transfer ability of breast cancer cell up to miR-124-3p, and the performance of this effect, it is to pass through
The expression of oncogene MGAT5 is inhibited to realize.MiR-124-3p again may be by targeting MGAT5 to mammary gland in vivo simultaneously
Inhibiting effect is played in the growth of tumor
Beneficial effects of the present invention:
The present invention shows miR-124-3p increasing capable of inhibiting cell by being overexpressed miR-145-3p in breast cancer cell
It grows and migrates.In addition, the expression quantity of miR-124 is substantially less than normal galactophore tissue in breast cancer tissue in patient with breast cancer,
And difference has statistical significance (P < 0.05), clinical reference value and confidence level are higher, low expression and patients overall survival
Rate is closely related, prompts miR-124-3p level that may diagnose the important marker with clinical prognosis as patient with breast cancer.For
Treatment breast cancer and clinical prognosis provide diagnosis basis and action target spot.
The present invention the experiment proved that, in breast cancer generating process, the expression of miR-124-3p is significantly inhibited；Restore
The expression of miR-124-3p can inhibit the proliferation and migration of breast cancer cell by targeted molecular MGAT5, to play anti-swollen
Tumor effect.
The present invention provides potential important logo object for breast cancer diagnosis and clinical prognosis, also controls for the clinic of breast cancer
Treatment provides new potential molecular target.
Detailed description of the invention
Fig. 1 is the breast cancer and normal galactophore tissue's mark that (A) qRT-PCR method extracts 20 couples of patients in the embodiment of the present invention 1
The expression quantitative analysis results of miR-124-3p in this, the expression and overall survival rate of (B) 1262 patient with breast cancer miR-124
(OS) the relationship analysis result between.
Fig. 2 is the proliferative capacity result that miR-124-3p inhibits breast cancer cell in the embodiment of the present invention 2, wherein (A)-
(B) proliferation activity of group of cells is detected for CCK-8 cell viability assay as a result, (C) EDU cell proliferation experiment detection each group is thin
The proliferative capacity result of born of the same parents；(D) the clonality result of colony formation detection group of cells.Data are with mean value ± mark
The form expression of quasi- poor (n=3), P < 0.01 * P < 0.05, * *.
Fig. 3 is the transfer ability result that miR-124-3p inhibits breast cancer cell in the embodiment of the present invention 2, wherein (A) is
Transwell experimental result, (B) are scratch experiment experimental result.Data are expressed in the form of means standard deviation (n=3), * P
<0.05,**P<0.01。
Fig. 4 is the schematic diagram that (A) miR-124-3p is combined with the pairing of MGAT5 target site in the embodiment of the present invention 3；(B) double
The testing result of fluorescent reporter gene；(C) expression of the MGAT5mRNA of the breast cancer and normal galactophore tissue's sample of 20 couples of patients
Quantitative analysis results；(D) miR-124-3p and MGAT5mRNA expression quantity correlation analysis result in breast cancer tissue；(E)RT-
PCR experiment result；(F) Western blot experimental result.
Fig. 5 is (A) CCK-8 cell viability experimental result in the embodiment of the present invention 4；(B) EDU experimental result；(C) shape is cloned
At experimental result；(D) Transwell experimental result；(E) scratch experiment result.
Fig. 6 is (A) CCK-8 cell viability experimental result in the embodiment of the present invention 4；(B) EDU experimental result；(C) shape is cloned
At experimental result；(D) Transwell experimental result；(E) scratch experiment result.
Fig. 7 is that (A) and (C) is that the corresponding subcutaneous knurl that mouse and solution are cut after each group is put to death is shone in the embodiment of the present invention 5
Piece；It (B) is overexpression group statistical result；It (D) is interference group statistical result.Data are with the form table of means standard deviation (n=5)
It reaches.*, p < 0.05；*, p < 0.01.
Specific embodiment
Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.
Unless otherwise described, implementation of the invention will be using molecular biology, microbiology, recombinant DNA and immunologic
Routine techniques, these are known to those skilled in the art.These technologies have complete description in the following documents: for example,
Sambrook " Molecular Cloning:A Laboratory guide " second edition (1989)；" DNA clone " I and II volumes (D.N.Glover edits 1985)；
" oligonucleotide synthesis " (M.J.Gait is edited, 1984)；" nucleic acid hybridization " (B.D.Hames and S.J.Higgins are edited
.1984)；And I-IV volumes of " experiment immunization learns to do volume " (D.C.Weir and C.C.Blackwell edit 1986).Alternatively, can press
It is carried out according to specification provided by reagent manufacturer.
Unless otherwise stated, otherwise percentage and number are calculated by weight.Unless otherwise defined, as used herein all
Professional and scientific terms have the same meanings as commonly understood by one of ordinary skill in the art.In addition, any similar or equal to described content
Deng method and material all can be applied in the present invention.The preferred methods and materials described herein are for illustrative purposes only.
The expression analysis of miR-124-3p and verifying in 1 patient with breast cancer of embodiment
The cancer and normal galactophore tissue's sample of 20 patients of Shanghai Changhai Hospital first cream surgery mammary cancer surgery are collected, is owned
Patient signs informed consent form in the preoperative, and passes through the approval of Shanghai Changhai Hospital Ethics Committee.Breast cancer has been taken in art
Normal galactophore tissue's sample is organized and corresponded to, is put into liquid nitrogen container rapidly after number, -80 DEG C of refrigerators is transferred to and saves.
Real-time fluorescence quantitative PCR: conventional method extracts the breast cancer of 20 patients and the RNA of normal galactophore tissue's sample,
Pass through the specific primer (sequence are as follows: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC of neck ring structure
GGCATTCAC) reverse transcription miR-124-3p, the nucleotide sequence for the miR-124-3p that sequencing reversal displaying is recorded out are as follows: 5 '-
UAAGGCACGCGGUGAAUGCCAA-3 ' then carries out real-time fluorescence quantitative PCR detection, upstream primer:
CGACGTAAGGCACGCG；Downstream primer: CAGTGCAGGGTCCGAGGTAT, it is quantitative in double standard curve methods, with the table of U6
Up to as internal reference, analyzing the miR-124-3p concentration of each sample, analysis result is found, miR-124-3p after statistics referring to Figure 1A
Expression quantity in breast cancer is substantially less than normal galactophore tissue (P=0.0006).
By the expression of 1262 patient with breast cancer miR-124 in METABRIC database and overall survival rate (OS) between
Relationship analyzed with online bioinformatics tools Kaplan-Meier plotter, analyze result referring to Figure 1B, found by Figure 1B
The high patient of miR-124 expression has preferably existence benefit, P < compared with the patient of low miR-124 expression
0.05。
The above results show that the expression of miR-124-3p can lower, and miR-124- in breast cancer generating process
It is negatively correlated to lead prognosis with patients overall survival for the expression quantity of 3p.These prompts miR-124-3p has certain diagnosis and prognosis
Value.
2 miR-124-3p of embodiment inhibits the proliferation and and migration of breast cancer
Breast cancer cell culture: human breast cancer cell line MDA-MB-231, MCF-7 used in the present invention and 293T cell
Purchase in the American Type Culture Collection committee, Chinese Academy of Sciences cell bank, with containing 10% inactivated fetal bovine serum (FBS,
GIBCO, CA, USA) and dual anti-DMEM culture medium (Dulbecco ' s modified Eagle ' s medium,
Invitrogen), it is placed in the incubator of 37 DEG C of thermostatic humidifyings of the carbon dioxide containing 5% and cultivates.Wherein culture MCF-7 is thin
20IU insulin is added in every 100ml for culture medium needed for born of the same parents.
Generated biological effect is lowered in order to study the miR-124-3p in breast cancer, applicant entrusts Shanghai Ji Ma
Biopharmaceutical company has synthesized the simulant (mimics) of miR-124-3p for external high expression miR-124-3p, inhibitor
(inhibitor) miR-124-3p is expressed for interfering in vitro.
Sequence are as follows: miR-124mimic:UAAGGCACGCGGUGAAUGCC；
MiR-124inhibitor:GGCAUUCACCGCGUGCCUUA.
Inhibitor NC:CAGUACUUUUGUGUAGUACAA；
Mimic NC:UUGUACUACACAAAAGUACUG.
MiR-124-3p simulant (mimics) or miR-124-3p are pressed down using Lipofectamine3000 transfection reagent
After preparation (inhibitor) transfects breast cancer cell line MDA-MB-231, MCF-7 72h, skill is detected using CCK-8 cell Proliferation
Art, as a result A-B referring to fig. 2.Wherein, CCK-8 cell viability assay detects the proliferation activity of group of cells as the result is shown: with
The cell of mimic NC group is compared, and the significant vigor for reducing MDA-MB-231 and MCF-7 breast cancer cell of miR-124 is overexpressed
(Fig. 2A), it is seen then that compared with the control group, the expression for restoring miR-124-3p can significantly inhibit the proliferation of breast cancer cell；With
The cell of Inhibitor NC group is compared, inhibit the expression of miR-124 it is significant increase breast cancer cell line MDA-MB-231 and
The cell viability (Fig. 2 B) of MCF-7, it is seen then that interfere the expression of miR-124-3p, the proliferative capacity of breast cancer cell significantly increases.
In turn, the present invention is coped with by transfection miR-124-3p mimics or miR-124-3p inhibitor and mutually respectively
According to the breast cancer cell after group small molecule 72 hours, EDU dyeing is carried out, fluorescence microscope shoots and counts nuclear targeting knot
Fruit, discovery can substantially reduce Cells Proliferation of Human Breast Cancer ability after transfecting miR-124-3p mimics, transfect miR-124-3p
After inhibitor, the proliferative capacity of breast cancer cell significantly increases (Fig. 2 C), as the result is shown: the cell phase with negative control group
Than being overexpressed the significant proliferative capacity for reducing MDA-MB-231 and MCF-7 breast cancer cell of miR-124-3p；On the contrary, inhibiting
MiR-124's expresses the then significant proliferative capacity for increasing breast cancer cell line MDA-MB-231 and MCF-7 cell.In order to verify
Breast cancer cell after transfection is carried out colony formation by above-mentioned experimental result, the present invention, to thin in most of single clones
After born of the same parents' number > 50, the fixed cell of 4% paraformaldehyde, crystal violet dye liquor dyes 30min, dries rear digital camera and takes pictures whole, clone
It counts, as a result D referring to fig. 2.As the result is shown: compared with the control group, being overexpressed the quantity of miR-124-3p group cell clonal formation
It significantly reduces, and after inhibiting the expression of miR-124-3p, breast cancer cell Clone formation quantity is significantly more than control group (Fig. 2 D).
The prompt of the studies above result, miR-124-3p can inhibit the proliferation of breast cancer cell.
Next, the present invention has inquired into influence of the miR-124-3p to breast cancer cell transfer ability.It will transfect 48 hours
It is 1 × 10 that cell afterwards, which is prepared into density,5The cell suspension of/ml takes 100-200 μ l cell suspension that the cell Transwell is added；
Culture medium of the 500 μ l containing FBS or chemotactic factor (CF) is added outside cell.Routine culture 12-48h.Matrigel and upper chamber are wiped with cotton swab
Interior cell is observed and is taken pictures in just setting microscope after violet staining, and statistical result showed: Transwell is tested
Demonstrate,prove the piercing capability of group of cells, experimental result is shown: the cell for being overexpressed miR-124-3p group compared with negative control group, is worn
The cell number of small holes is decreased obviously, and the cell number for interfering the cell of miR-124-3p group to pass through aperture obviously increases compared with control group
Add (Fig. 3 A).Meanwhile the breast cancer cell after transfection is laid in 6 orifice plates by the present invention, after cell is paved with ware bottom, with small pipette tips
Perpendicular to the horizontal line scratch of behind, wound model is manufactured.It is washed 3 times with PBS, serum free medium is added.Stroke of record at this time
Trace size is 0h, is put into 37 DEG C of 5%CO2Incubator culture.By for 24 hours, 48h sampling, take pictures, observe and statistically analyze scribing line healing
Degree, as the result is shown: compared with negative control group, the cell scratch healing ability for being overexpressed miR-124-3p group is remarkably decreased,
Opposite, inhibit the expression of miR-124-3p, cell scratch healing ability significantly increases (Fig. 3 B).These results indicate that miR-
124-3p can inhibit the transfer ability of breast cancer cell.
Embodiment 3, miR-124-3p are directly targeted the expression of regulatory molecule MGAT5
The present invention has inquired into the target molecule of miR-124-3p effect.
Its effect is analyzed by TargetScan (www.targetscan.Org) online software first in present invention research
Target spot, in conjunction with aforementioned experimental results, thus it is speculated that MGAT5 may be miR-124-3p play antitumor action target spot, miR-
124-3p matches the schematic diagram such as Fig. 4 A combined with MGAT5 target site.By the double fluorescent reporter gene tables for constructing above-mentioned molecule
Up to carrier, it has been found that 3 '-UTR regions of the miR-124-3p in MGAT5 have conservative target site.
By 293T cell (5 × 103) 96 orifice plates are inoculated into, reach logarithmic growth phase to cell, 80ng is built
MGAT5 3'-UTR-WT, MGAT5 3'-UTR-MUT, GP-miRGLO respectively with 8ng miR-124-3p mimics,
MimicsNC, and 1ul Lipofectamine3000 cotransfection, according to the Dual of Promega company after 48 hours
Luciferase Assay kit kit specification operating procedure, the activity of measurement each group reporter gene luciferase, and with
GP-miRGLO obtains the data of each group reporter gene expression situation as internal reference, as a result such as Fig. 4 B, with miR-124-3p
Mimics cotransfection group fluorescent value is remarkably decreased compared with control group and mutation group, therefore, we demonstrate that the effect target of miR-124-3p
Point is MGAT5.
It is quantitative with the expression quantity of MGAT5mRNA in corresponding normal galactophore tissue that qPCR detects 20 pairs of breast cancer in embodiment 1
Analysis, using the expression of β-actin as internal reference, as the result is shown: the expression quantity of MGAT5mRNA is significantly higher than just in breast cancer tissue
Normal breast tissue (P=0.0047) (Fig. 4 C).By miR-124 in 20 pairs of breast cancer in embodiment 1 and normal galactophore tissue with
The expression of MGAT5mRNA carries out correlation analysis, as the result is shown: miR-124-3p and MGAT5mRNA in breast cancer tissue
Expression quantity correlation analysis both as the result is shown negatively correlated property, r=-0.5815, P < 0.01 (Fig. 4 D).
Further by qPCR and Western Blot it is experimentally confirmed that transfection miR-124-3mimics can reduce mammary gland
The expression (Fig. 4 E, F) of MGAT5mRNA and protein level in cancerous cell line, the above results are shown, miR-124-3p passes through direct target
It plays a role to the 3 '-UTR regions of MGAT5.
Further, the present invention uses miR-124-3p mimics, miR-124-3p inhibitor and corresponding feminine gender respectively
Control transiently transfects breast cancer cell line MDA-MB-231, MCF-7, respectively extract RNA and albumen, carry out RT-PCR and
Western Blot experiment.RT-PCR experimental result shows (Fig. 4 E): in two cell lines, after being overexpressed miR-124-3p,
The mRNA expression of MGAT5 is substantially reduced (P < 0.001)；After the expression for interfering miR-124-3p, the mRNA of MGAT5 is expressed
Amount is obvious to be risen.After Western blot experimental verification is overexpressed or interferes the expression of miR-124-3p, MGAT5 expressing quantity
Variation, as a result F referring to fig. 4.The results showed that being overexpressed after miR-124-3p, MGAT5 expressing quantity is compared with control group
It is decreased obviously, after the expression for inhibiting miR-124-3p, MGAT5 expressing quantity obviously rises.Data are with means standard deviation (n
=3) form expression, P < 0.01 * P < 0.05, * *.By qPCR and Western Blot it is experimentally confirmed that transfection miR-124-3p
Mimics can reduce the expression of MGAT5mRNA and protein level in breast cancer cell line, the above results suggest that miR-124-3p
The 3 '-UTR regions by being directly targeted MGAT5 play a role.
Embodiment 4: experiment in vitro verify miR-124-3p by targeting adjust MGAT5 inhibit breast cancer cell proliferation and
Migration
The interference and overexpression sequence for designing miR-124-3p and MGAT5, are built into PGLMV-6395 carrier, utilize virus
Carrier transfects cell, collects virus liquid and is overexpressed and is lowered miR-124 and MGAT5 slow virus.It is multiple using different infection
Number (20-200) transfects MDA-MB-231, MCF-7, discards virus liquid afterwards for 24 hours, continues fluorescence microscope after culture 48h
Lower observation transfection efficiency, determines best MOI.The slow virus solution of best MOI value is transfected in MDA-MB-231, MCF-7 cell
(it is divided into 8 groups: miR-124-3p, MGAT5, NC and miR-124-3p+MGAT5；MiR-124-3p inhibitor, sh-
MGAT5, sh-NC and miR-124-3p inhibitor+sh-MGAT5), cell incubation is carried out, discards virus liquid after 36h, is continued
Cultivate 36h.Ammonia benzyl is added in group of cells culture dish, continues to cultivate 72h, cell is surely turned by ammonia benzyl resistance screening culture
Strain.Detect the proliferation of group of cells and the variation of transfer ability.
The present embodiment building has synthesized the slow virus carrier comprising being overexpressed miR-124-3p, MGAT5 plasmid and corresponding yin
Property control virus, be divided into miR-124-3p, 4 groups such as MGAT5, NC and miR-124-3p+MGAT5, transfect MDA-MB-
231, MCF-7 cell line detects the proliferation of group of cells and the variation of transfer ability after screening stable cell strain, as a result as follows:
CCK-8 cell viability experimental result is as shown in Figure 5A, and experimental result is shown: being overexpressed the cell viability of MGAT5 group
It is obviously increased compared with NC group, and is overexpressed miR-124-3p group cell viability and is decreased obviously compared with NC group.But it ought be overexpressed simultaneously
When MGAT5 and miR-124-3p, it has been found that cell viability is more individually overexpressed miR-124-3p group and significantly restores, that is, thus
It can prove that overexpression miR-124-3p can be repaired to the inhibiting effect of Cells Proliferation of Human Breast Cancer ability by being overexpressed MGAT5.
EDU cell proliferation experiment shows same as a result, referring to Fig. 5 B: being individually overexpressed MGAT5 or miR-124-3p
Ability of cell proliferation is in opposite change afterwards, and MGAT5 group ability of cell proliferation is significantly higher than the cell of miR-124-3p group.But
MiR-124-3p+MGAT5 group can significantly reduce the inhibiting effect for being individually overexpressed miR-124-3p cell proliferation ability.Together
When, we also have detected the ability of group of cells Clone formation, as a result referring to Fig. 5 C, as the result is shown: being overexpressed MGAT5 can also support
Disappear and raises the decline of caused breast cancer cell clonality by miR-124-3p.
Transwell experimental result is referring to Fig. 5 D, as the result is shown: be overexpressed miR-124-3p group passes through pore cell number
Amount is substantially less than NC group, and the quantity that the cell for raising MGAT5 group passes through aperture is significantly higher than NC group, while being overexpressed MGAT5
With the cell of miR-12-3p 4, miR-124-3p group is more individually overexpressed across the ability of aperture and is significantly improved.Likewise, drawing
Trace experimental result (referring to Fig. 5 E) also turns out that MGAT group cell scratch healing ability is significantly higher than NC group, and is overexpressed miR-124-
3p group is just the opposite, but miR-124-3p+MGAT5 group is obvious compared with cell scratch healing ability when being individually overexpressed mir-124-3p
It improves.It can be seen that the expression of up-regulation MGAT5 can be repaired due to being overexpressed miR-124-3p to breast cancer cell transfer ability
Inhibiting effect.
The present embodiment building has synthesized slow virus carrier and correspondence comprising silencing miR-124-3p, MGAT5 expression plasmid
Negative control virus is divided into miR-124-3p inhibitor, sh-MGAT5, sh-NC and miR-124-3p inhibitor+
4 groups such as sh-MGAT5 transfect MDA-MB-231, MCF-7 cell line, after screening stable cell strain, detect group of cells
The variation of proliferation and transfer ability, as a result as follows:
CCK-8 experimental result as the result is shown compared with negative control group sh-NC, inhibits miR-124-3p's referring to Fig. 6 A
Expression, is remarkably improved breast cancer cell vigor, but the cell viability of miR-124-3p inhibitor+sh-MGAT5 group is then shown
Reduction, with control group no significant difference.EDU test result is referring to Fig. 6 B, the results show that with miR-124-3p inhibitor
Group is compared, and miR-124-3p inhibitor+sh-MGAT5 group ability of cell proliferation is substantially reduced.Colony formation result is such as
Fig. 6 C, the cell clone quantity in miR-124-3p inhibitor+sh-MGAT5 group is significantly lower than miR-124- as the result is shown
3p inhibitor group.Transwell experimental result such as Fig. 6 D, as the result is shown: interfering the thin across aperture of miR-124-3p group
Born of the same parents' quantity is apparently higher than sh-NC group, and lowers MGAT5 group and be substantially less than sh-NC group across the quantity of aperture, is overexpressed simultaneously
The cell of MGAT5 and miR-124-3p is more individually overexpressed miR-124 group across the ability of aperture and significantly improves, with sh-NC group
No significant difference, it is seen then that compared with miR-124-3p inhibitor group, miR-124-3p inhibitor+sh-MGAT5 group
The transfer ability of middle cell is significantly lowered.Scratch experiment has also obtained same as a result, as illustrated in fig. 6e: sh-MGAT5 group cell
Scratch healing ability is substantially less than sh-NC group, and miR-124-3p inhibitor group cell scratch healing ability significantly improves,
But miR-124-3p inhibitor+sh-MGAT5 group is obvious compared with mir-124-3p inhibitor group cell scratch healing ability
Decline.It can be seen that the expression of interference MGAT5 can be offset due to lowering miR-124-3p to breast cancer cell transfer ability
Facilitation.
In summary it is overexpressed and interferes and remedy test, it is concluded that: overexpression miR-124-3p can be with
The effective proliferation and transfer ability for inhibiting breast cancer cell, and the performance of this effect, are by inhibiting oncogene MGAT5
It expresses to realize.
Embodiment 5: high expression miR-124-3p can inhibit growth of breast cancers in experiment in vivo.
The present embodiment chooses lotus knurl carrier of the 4-6 week old BALB/C Female nude mice as breast cancer cell.It will be in embodiment 4
After 8 groups of slow virus surely turn MDA-MB-231 cell recovery, pass 6-7 generation takes pair after cell state is stablized when cell is covered with bottom of bottle
Number growth period cell is made into cell suspension, and 1 × 10 is injected in fat pad of the mouse second to mammary gland6A MDA-MB-231 surely turns
Cell.The tumor size of measurement in every 3 days, cervical dislocation puts to death mouse after 4-6 weeks, dissects tumour, and Fig. 7 A and 7C are each group
The corresponding subcutaneous knurl that mouse and solution are cut after execution.After measuring the tumour line of apsides, tumor growth curve is calculated.Overexpression group knot
Fruit such as Fig. 7 B, as the result is shown: compared with NC group, after being overexpressed MGAT5, tumor growth rate is most fast, miR-124-3p group tumour
The speed of growth is most slow, and volume is minimum.And the tumor growth rate of miR-124-3p+MGAT5 group is obviously fast compared with miR-124-3p group,
With NC group no significant difference.Interference group statistical result such as Fig. 7 D, as the result is shown: sh-MGAT5 group gross tumor volume is minimum, growth speed
Spend most slow, and miR-124-3p inhibitor group is then completely on the contrary, tumor growth rate is most fast, volume maximum.miR-124-
The speed of growth of 3p inhibitor+sh-MGAT5 group tumour is then considerably slower than miR-124-3p inhibitor group, with sh-NC
Group no significant difference.These are the result shows that miR-124-3p again may be by targeting MGAT5 to breast cancer tumour in vivo
Inhibiting effect is played in growth.
The preferred embodiment of the present invention has been described in detail above, but the invention be not limited to it is described
Embodiment, those skilled in the art can also make various equivalent on the premise of not violating the inventive spirit of the present invention
Variation or replacement, these equivalent variation or replacement are all included in the scope defined by the claims of the present application.
Claims (9)
1.miR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament, the sequence of the miR-124-3p
Are as follows: 5 '-UAAGGCACGCGGUGAAUGCCAA-3 '.
2. miR-124-3p according to claim 1 and its analog are preparing the application in anti-breast cancer disease medicament,
It is characterized in that, the miR-124-3p and its analog include: miR-124-3p sequence, specificity interference miR-124-3p base
Because of the small disturbing molecule expressed, processed, high expression adenovirus or slow virus containing miR-124-3p sequence, or contain miR-
One of the expression plasmid of 124-3p sequence.
3. miR-124-3p according to claim 1 and its analog are preparing the application in anti-breast cancer disease medicament,
It is characterized in that, the drug refers to the reagent that can be improved or increase miR-124-3p expression quantity.
4. miR-124-3p according to claim 1 and its analog are preparing the application in anti-breast cancer disease medicament,
It is characterized in that, the drug inhibits the proliferation and migration of breast cancer cell by targeted molecular MGAT5.
5. a kind of pharmaceutical composition, which is characterized in that described pharmaceutical composition using miR-124-3p as sole active composition, or
It is the pharmaceutical composition containing miR-124-3p, the sequence of the miR-124-3p are as follows: 5 '-
UAAGGCACGCGGUGAAUGCCAA-3’。
6. pharmaceutical composition according to claim 4, which is characterized in that described pharmaceutical composition refers to containing a effective amount of
The miR-124-3p or its promotor and pharmaceutically acceptable carrier.
7.miR-124-3p the application in preparation breast cancer disease diagnostic reagent or diagnostic kit.
8. miR-124-3p according to claim 7 answering in preparation breast cancer disease diagnostic reagent or diagnostic kit
With, which is characterized in that the diagnostic reagent is detection miR-124-3p expression quantity or a effective amount of reagent；The kit
Include detection miR-124-3p expression quantity or a effective amount of reagent.
9. miR-124-3p according to claim 7 answering in preparation breast cancer disease diagnostic reagent or diagnostic kit
It include that there is inspection to miR-124-3p with, which is characterized in that the detection miR-124-3p expression quantity or a effective amount of reagent
The PCR primer of specificity is surveyed, primer sequence is as follows: upstream primer: CGACGTAAGGCACGCG；Downstream primer:
CAGTGCAGGGTCCGAGGTAT。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910370130.7A CN110251529A (en) | 2019-05-06 | 2019-05-06 | MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910370130.7A CN110251529A (en) | 2019-05-06 | 2019-05-06 | MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110251529A true CN110251529A (en) | 2019-09-20 |
Family
ID=67914199
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910370130.7A Pending CN110251529A (en) | 2019-05-06 | 2019-05-06 | MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110251529A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110946872A (en) * | 2019-12-30 | 2020-04-03 | 北京大学深圳医院 | Application of miR-4491 in preparation of medicine for treating breast cancer |
| CN113577287A (en) * | 2021-08-31 | 2021-11-02 | 中南大学湘雅三医院 | Application of miR-124-3p agonist in preparation of medicine for treating rhinitis |
| CN113713104A (en) * | 2021-09-02 | 2021-11-30 | 重庆医科大学国际体外诊断研究院 | Application of miR-345-3p in preparation of breast cancer treatment drug |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090192111A1 (en) * | 2007-12-01 | 2009-07-30 | Asuragen, Inc. | miR-124 Regulated Genes and Pathways as Targets for Therapeutic Intervention |
-
2019
- 2019-05-06 CN CN201910370130.7A patent/CN110251529A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090192111A1 (en) * | 2007-12-01 | 2009-07-30 | Asuragen, Inc. | miR-124 Regulated Genes and Pathways as Targets for Therapeutic Intervention |
Non-Patent Citations (2)
| Title |
|---|
| FENG LIU等: "miR-124-3p acts as a potential marker and suppresses tumor growth in gastric cancer", 《BIOMED REP》 * |
| GUILING YAN等: "Decreased miR-124-3p promoted breast cancer proliferation and metastasis by targeting MGAT5", 《AM J CANCER RES》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110946872A (en) * | 2019-12-30 | 2020-04-03 | 北京大学深圳医院 | Application of miR-4491 in preparation of medicine for treating breast cancer |
| CN110946872B (en) * | 2019-12-30 | 2022-11-04 | 北京大学深圳医院 | Application of miR-4491 in preparation of medicine for treating breast cancer |
| CN113577287A (en) * | 2021-08-31 | 2021-11-02 | 中南大学湘雅三医院 | Application of miR-124-3p agonist in preparation of medicine for treating rhinitis |
| CN113713104A (en) * | 2021-09-02 | 2021-11-30 | 重庆医科大学国际体外诊断研究院 | Application of miR-345-3p in preparation of breast cancer treatment drug |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yang et al. | RETRACTED: Exosome-derived miR-130a activates angiogenesis in gastric cancer by targeting C-MYB in vascular endothelial cells | |
| CN110251529A (en) | MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament | |
| Yang et al. | MiR-126 overexpression inhibits high glucose-induced migration and tube formation of rhesus macaque choroid-retinal endothelial cells by obstructing VEGFA and PIK3R2 | |
| CN107586850A (en) | Application of the Noncoding gene in liver cancer diagnosis and treatment | |
| CN103173529B (en) | Associated use of human NLK (Neuroleukin) gene and associated medicines | |
| CN104774929A (en) | Applications of miR-455-3p in diagnosis, treatment and prognosis of esophageal squamous cancer | |
| CN110229901A (en) | Gene hsa_circ_0027089 relevant to triple negative breast cancer diagnosis and treatment and its application | |
| CN112430665B (en) | Molecular biomarker for diagnosing and treating triple negative breast cancer and application thereof | |
| CN109321656A (en) | Purposes of the protein D EPDC1 as the marker of the negative breast cancer of diagnosis three | |
| CN105412944A (en) | Effect of miR-451a cells in non-small cell lung cancer | |
| CN105886507B (en) | Application of the long-chain non-coding RNA FAM83H-AS1 in preparation treatment non-small cell lung cancer drug | |
| CN104878098A (en) | Application and related drugs of human STIM1 gene | |
| CN101705227B (en) | SiRNA for inhibiting human AP-2alpha gene expression and anti-cervical cancer application thereof | |
| CN110157708B (en) | Inhibitor of targeted linc01023 gene for inhibiting human brain glioma and application thereof | |
| Lin et al. | The expression profile of miRNA in glioma and the role of miR-339-5p in glioma | |
| CN110229900A (en) | Gene hsa_circ_0103520 relevant to breast cancer diagnosis and treatment and its application | |
| CN105420194B (en) | The alpha mediated progesterone of mPR adjusts lung adenocarcinoma cell to the method for EGFR-TKIs sensibility | |
| CN106282385B (en) | Identification and purposes of the long-chain non-coding RNA XLOC_000090 in lung cancer | |
| CN104531709A (en) | siRNA dual-interference composition for inhibiting growth and metastasis of tumors and application thereof | |
| CN106729756A (en) | Application of the biomarker as target in adenocarcinoma of lung diagnosis and treatment | |
| CN110305962A (en) | DKC1 and application of the HIF-1 α in synergistic treatment colorectal cancer | |
| CN110257522A (en) | Gene hsa_circ_0045881 relevant to breast cancer diagnosis and treatment and its application | |
| CN105288656B (en) | Applications of the microRNA BART6-3p of Epstein-Barr virus coding on preparing nasopharyngeal carcinoma cell inhibitor | |
| CN107893119A (en) | Applications of the ZCCHC12 in osteosarcoma | |
| CN115192601B (en) | Application of PPFIA1 gene in preparation of drug-resistant CML drug for treating independent BCR-ABL1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190920 |