CN105267987B - Applications of the long-chain non-coding RNA LOC553103 on stomach cancer cell inhibitor is prepared - Google Patents
Applications of the long-chain non-coding RNA LOC553103 on stomach cancer cell inhibitor is prepared Download PDFInfo
- Publication number
- CN105267987B CN105267987B CN201510728314.8A CN201510728314A CN105267987B CN 105267987 B CN105267987 B CN 105267987B CN 201510728314 A CN201510728314 A CN 201510728314A CN 105267987 B CN105267987 B CN 105267987B
- Authority
- CN
- China
- Prior art keywords
- loc553103
- cell
- bart6
- expression
- stomach cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses applications of the long-chain non-coding RNA LOC553103 on stomach cancer cell inhibitor is prepared.LOC553103 RNA interference sequences are used to prepare the preparation for suppressing Growth of Gastric, propagation and prevention tumor cell invasion transfer；It is further used for preparing the preparation for suppressing the assembling of stomach cancer cell skeleton and reconstruct.The present invention provides strong biology tool for the auxiliary treatment of stomach cancer, has far-reaching clinical meaning and important popularizing application prospect.
Description
Technical field
The invention belongs to oncomolecularbiology field, and in particular to utilize long-chain non-coding RNA LOC553103 systems
The method of standby stomach cancer cell inhibitor.
Background technology
Epstein-Barr virus (Epstein Barr virus, EBV) is a kind of nerpes vinrus hominis of generally existing, can be infected complete
The adult population of ball 95% or so, it is most of in addition to having sub-fraction people once in a while and can cause communicable monocytosis,mononucleosis
Infected person is not in any clinical symptoms, in most cases EBV can in host long-term latent infection.So
And the EBV of latent infection can cause the generation of malignant tumour in some cases, include the Hugh Burkitt and He Jie in B cell source
Golden lymphomas, and epithelial cell origin nasopharyngeal carcinoma and stomach cancer etc..The mechanism that EBV causes malignant tumour to occur is not yet complete at present
It is complete to understand, the Latent membrane protein1 (Latent that the expression of series of genes is relevant, is encoded such as EBV may be encoded in itself with EBV
Membrane Protein1, LMP1) a kind of tumorigenesis albumen is used as, the expression of oncogene in many host cells can be activated, is suppressed
The 26S Proteasome Structure and Function of tumor suppressor gene.
As double-stranded DNA virus, its Genome Size is about 170kb to EBV, except a series of transcribed protein coding genes
Outside, EBV also codified one kind Microrna (microRNA, miRNA) molecules are also found recently.MiRNA be one kind be about 20~
25nt regulation type non-coding RNA, different from mRNA, miRNA is not " bridge " between DNA and protein, but by with
Target gene targeting combines, the expression of controlling gene.EBV is first virus for being found codified miRNA, into place
EBV starts expression generation miRNA after master, plays biological action.25 miRNAs precursors of EBV codifieds are had now been found that,
Be processed into 44 ripe miRNAs, and the miRNAs of EBV codings clusters on EBV genomes are distributed, can be divided into BART and
Two groups of BHRF1.The gene in gene or host cell that the miRNAs of EBV codings may be encoded in itself by regulating and controlling EBV, from
And the malignancy of tumor conversion of EBV mediations is take part in, influence the hair of the kinds of tumors including nasopharyngeal carcinoma, stomach cancer, lymthoma etc.
Hair tonic exhibition.But the research for EBV coding miRNAs s at present is not also very thorough, big portion in 44 ripe EBV miRNAs
There is no the report of functional study point also, the research of effect and mechanism for example relating to the EBV miRNA BART6-3p encoded is just very
It is few.The relation of effect so far about BART6-3p in the solid tumor occurrence and development such as nasopharyngeal carcinoma, stomach cancer and its in entity
Early screening, auxiliary diagnosis or outcome prediction of knurl patient etc. do not have document report.
We show that expression of the BART6-3p in nasopharyngeal carcinoma and stomach organization significantly raises, but right and wrong by research
Often ironically the recurrence of BART6-3p expression and nasopharyngeal carcinoma and patients with gastric cancer turns in nasopharyngeal carcinoma and stomach organization
Negatively correlated relation is moved, low expression BART6-3p patient Bi Gao expression BART6-3p patient is easier that recurrence occurs and turned
Move, prognosis is worse.Although this shows that EBV is the clear and definite oncogenicity virus of comparison, not the gene of EBV codings all has
The effect of tumor development, portion gene, including BART6-3p is promoted to have anti-tumor function, this also indicates that EBV
The relation of the clinical phenotypes such as miRNAs expression and tumor recurrence, transfer prognosis cannot suppose that, can only be by specific and thin
The experimental study of cause just can determine that.Therefore, for BART6-3p design specialized in situ hybridization probes and detection kit, Huo Zheli
BART6-3p in the technology for detection such as real-time fluorescence quantitative PCR nasopharyngeal carcinoma and stomach organization is carried out with BART6-3p specific primers
Expression is expected to provide reference for the prediction clinically recurred tumour and shifted.
We transfect artificial synthesized BART6-3p in nasopharyngeal carcinoma and stomach cancer cell, it was demonstrated that in the negative nasopharyngeal carcinoma of EBV
It can substantially suppress the growing multiplication and invasion and attack transfer ability of tumour cell with BART6-3p is expressed in stomach cancer cell.Therefore,
BART6-3p can be used for preparing the preparation for suppressing growth of tumour cell, propagation and prevention tumor cell invasion transfer again.
We have also been devised a series of experiment and have detected BART6-3p and play biology in nasopharyngeal carcinoma and stomach cancer cell
The molecular mechanism of function, it has been found that a long-chain non-coding RNA (long non-coding in BART6-3p is capable of inhibiting cell
RNA, lncRNA) gene LOC553103 expression (Reference Sequence：NR_110997), we, which devise, is directed to
LOC553103 RNA interference sequences (siRNA) transfection nasopharyngeal carcinoma and stomach cancer cell, after the expression for suppressing LOC553103, cell
There is similar transfection BART6-3p cell biology phenotype, that is, suppress growth of tumour cell and breed and suppress tumour cell
Invasion and attack and transfer ability.Therefore, it is thin to can be used for preparation suppression tumour for the RNA interference sequences (siRNA) for LOC553103
The preparation of intracellular growth, propagation and prevention tumor cell invasion transfer.Before this, the function about LOC553103 has no any document
Report.
Cytoskeleton is to be present in eukaryotic by what three kinds of micro-pipe, microfilament and median fiber azelons were built
Intracytoplasmic network structure, three kinds of composition hight coordinate distributions, karyon, plasma membrane, each organelle are connected together, constitute cell
Form maintains and the support system of motor coordination.Recent studies indicate that Tumor Cell Migration migration and invasive ability and cell
The dynamic regulation of skeleton is closely related, the medicine of targeting cytoskeleton can also inducing apoptosis of tumour cell suppress tumour cell
Propagation.We confirm that BART6-3p can be by the expression of LOC553103 in targeted inhibition host cell, shadow by serial experiment
Ring tumour cell in micro-pipe microfilament assembling, the reconstruct of regulating cell skeleton, ultimately result in growth of tumour cell, propagation, invasion and attack,
Shift the change of isophenous.Therefore, BART6-3p and the RNA interference sequences (siRNA) for LOC553103 can be also used for making
The standby preparation for suppressing the assembling of tumour cell skeleton and reconstruct.
In addition, we again in the clinical sample of nasopharyngeal carcinoma and stomach cancer detect LOC553103 expression situation, find its
High expression in control tissue by cancer, and the low expression in most of tumor tissues, and it is negatively correlated with BART6-3p expression,
Therefore LOC553103 expression, can be determined as the index of patient's prognosis for the real-time fluorescence of LOC553103 design specializeds
PCR primer and detection kit or in situ hybridization probe and detection kit are measured, for detecting nasopharyngeal carcinoma and stomach organization
LOC553103 expression is expected to clinically to provide reference to both tumours progress relapse and metastasis and prognosis prediction.
In a word, our research disclose BART6-3p and new lncRNA genes LOC553103 in nasopharyngeal carcinoma and
Function during the Incidences such as stomach cancer, the application process for BART6-3p and LOC553103 provide real example.
The content of the invention
It is an object of the invention to provide a kind of long-chain non-coding RNA LOC553103 application process, is specifically profit
The preparation for suppressing stomach cancer cell is prepared with LOC553103.
Applications of the long-chain non-coding RNA LOC553103 on stomach cancer cell inhibitor is prepared, by gene
LOC553103 is used to prepare the preparation for suppressing Growth of Gastric, propagation and prevention tumor cell invasion transfer, and the gene exists
Sequence number in NCBI：NR_110997.It is thin that gene LOC553103 RNA interference sequences are specifically used for preparation suppression stomach cancer
The preparation of intracellular growth, propagation and prevention tumor cell invasion transfer.
Long-chain non-coding RNA LOC553103 RNA interference sequences are the one or more in following three kinds：
siRNA-1：5’-AUAACAUGACAGCUUGCUUGUCUCC-3’
siRNA-2：5’-CUUCCAAGCUCACUCAAGGUUGUUG-3’
siRNA-3：5’-CUAAUAUUCCCUCAGAGCUGGGCUG-3’.
Described lncRNA genes LOC553103 RNA interference sequences, which are further used for preparing, suppresses stomach cancer cell skeleton
Assembling and the preparation of reconstruct.
The RNA interference sequences that the present invention has inquired into LOC553103 suppress growth of tumour cell, propagation, invasion and attack and transfer energy
The specific mechanism of power, the integrality of cytoskeleton in tumour cell can be changed by finding LOC553103 RNA interference sequences, and
The changeable assembling of cytoskeleton is the basis of tumor cell invasion transfer, and the destruction of cytoskeletal integrity can be thin with induced tumor
Born of the same parents' Apoptosis inhibitor tumor cell proliferation, this can explain why gene LOC553103 RNA interference sequences have and suppress swollen
The ability of knurl malignant phenotype (growth, propagation, invasion and attack, transfer).The present invention provides strong point for the auxiliary treatment of stomach cancer
Sub- biology instrument, there is far-reaching clinical meaning and important popularizing application prospect.
Brief description of the drawings
Fig. 1 is that Real-Time Fluorescent Quantitative PCR Technique detects expression feelings of the BART6-3p in nasopharyngeal carcinoma and normal nasopharyngeal epithelium
Condition,
Expression of the BART6-3p in nasopharyngeal carcinoma (T) in normal nasopharyngeal epithelium (N) than significantly improving (P<0.001).
Fig. 2 is that in situ hybridization detects expressions of the BART6-3p in nasopharyngeal carcinoma and normal nasopharyngeal epithelium,
The left side is a Nasopharyngeal Carcinoma During Biopsy sample, and BART6-3p is high in cancerous tissue to express, and by cancer (Adjacency)
Low expression in normal nasopharyngeal epithelium；The right is normal nasopharyngeal epithelium sample by another cancer, BART6-3p bases in cancer beside organism
Originally can't detect.
Fig. 3 is the statistical result of BART6-3p in situ hybridization data in epithelium by nasopharyngeal carcinoma and cancer,
Have that 34 BART6-3p expression is low in normal epithelial (Adjacency of NPC) by 40 nasopharyngeal carcinoma cancers, very
To being substantially not detectable (negative), and 57 high expression for detecting BART6-3p in 115 nasopharyngeal carcinoma (NPC)
(high), remaining 58 are low expression (low), P<0.001.
Expression and the correlation of distant metastasis of nasopharyngeal carcinoma that Fig. 4 is BART6-3p,
In 115 nasopharyngeal carcinoma samples, 92 there occurs relapse and metastasis, wherein 31 are recurrence (local in situ
Relapse), 61 are DISTANT METASTASES IN (distance Metastasis), it can be seen that the trouble of DISTANT METASTASES IN from statistical result
Lower (the P of ratio of the high expression of BART6-3p in person<0.05) expression and tumor recurrence transfer for, showing BART6-3p are in negative
Close.
Fig. 5 is the relation of BART6-3p expression Yu Nasopharyngeal Carcinoma Patients prognosis,
BART6-3p expression and the prognosis of Nasopharyngeal Carcinoma Patients are closely related in nasopharyngeal carcinoma, i.e. the high expression of BART6-3p
(High) the survival of patients time will be considerably longer than the patient (P of BART6-3p low expressions (Low)<0.05).
Fig. 6 is that in situ hybridization detects expressions of the BART6-3p in epithelium by stomach cancer and cancer,
The left side is a biopsy samples from stomach cancer, and BART6-3p is high in cancerous tissue to express；The right is Carcinoma side normal tissue mark
This, BART6-3p is substantially not detectable in cancer beside organism.
Fig. 7 is the relation of BART6-3p expression Yu patients with gastric cancer prognosis,
BART6-3p expression and the prognosis of patients with gastric cancer are closely related, i.e. patient's life of the high expression (High) of BART6-3p
BART6-3p low expressions (Low) patient (P=0.04) will be considerably longer than by depositing the time.
Fig. 8 is to import BART6-3p few nucleosides in EBV negative nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS
Acid sequence, expression of the BART6-3p in tumour cell significantly raise,
BART6-3p oligonucleotide sequences are imported in EBV negative nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS
Afterwards, real time fluorescence quantifying PCR method have detected the expression of BART6-3p in tumour cell, and BART6-3p expression significantly rises
It is high.Negative control (NC) is importing scramble sequences.
Fig. 9 is to import BART6-3p few nucleosides in EBV negative nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS
The multiplication capacity of cell reduces after acid sequence, and the speed of growth slows down.
Figure 10 is to import BART6-3p few nucleosides in EBV negative nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS
Cell migration ability reduces after acid sequence,
Cell scratch experiment confirms, is imported in EBV negative nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS
BART6-3p oligonucleotide sequences, after artificial promotion BART6-3p expression, tumour cell moves from cut both sides toward cut center
Move speed substantially to slow down, the time lengthening of cut healing, show the reduction of cell movement transfer ability, negative control (NC) is importing
Scramble sequences.
Figure 11 is to import BART6-3p few nucleosides in EBV negative nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS
The invasive ability of cell reduces after acid sequence,
Cell-penetrating (transwell) is it is experimentally confirmed that in negative EBV nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell
BART6-3p oligonucleotide sequences are imported in AGS, after artificial promotion BART6-3p expression, the tumour of matrix glued membrane can be passed through thin
Born of the same parents' number substantially reduces, and shows the reduction of cell invasion ability, and negative control (NC) is importing scramble sequences.
Figure 12 is the expression that BART6-3p can lower lncRNA genes LOC553103 in cell,
BART6-3p oligonucleotide sequences are imported in EBV negative nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS
Real-time fluorescence quantitative PCR detection finds that (P is significantly lowered in lncRNA genes LOC553103 expression afterwards<0.05).
Figure 13 is that specificity can effectively suppress cell for lncRNA genes LOC553103 RNA interference sequences (siRNA)
Middle LOC553103 expression,
We devise 3 specificity for LOC553103 RNA interference sequences (siRNA1, siRNA2 and siRNA3,
Be abbreviated as S1, S2 and S3) be transfected into the negative nasopharyngeal carcinoma cell 5-8F (left side) of EBV, HNE2 (in) and stomach cancer cell AGS (right side) in
Real-time fluorescence quantitative PCR detection finds that lncRNA genes LOC553103 expression is significantly lowered afterwards.
Figure 14 is that importing is that specificity is directed to lncRNA genes in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS
The multiplication capacity of LOC553103 RNA interference sequences (siRNA) cell afterwards reduces, and the speed of growth slows down.
Figure 15 is to import specificity in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS to be directed to lncRNA genes
Cell migration ability reduces LOC553103 RNA interference sequences (siRNA) afterwards,
Cell scratch experiment is confirmed, specificity is imported in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS and is directed to
LncRNA genes LOC553103 RNA interference sequences (siRNA), after the artificial expression for suppressing LOC553103, tumour cell from
Cut both sides substantially slow down toward cut center migration velocity, the time lengthening of cut healing, show that cell movement transfer ability drops
Low, negative control (NC) is importing scramble sequences.
Figure 16 is to import specificity in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS to be directed to lncRNA genes
The invasive ability of cell reduces after LOC553103 RNA interference sequences (siRNA) sequence,
Cell-penetrating (transwell) in nasopharyngeal carcinoma cell 5-8F, HNE2 and stomach cancer cell AGS it is experimentally confirmed that import
Specificity is directed to lncRNA genes LOC553103 RNA interference sequences (siRNA) sequence, the artificial expression for suppressing LOC553103
Afterwards, the tumor cell number of matrix glued membrane can be passed through to substantially reduce, shows the reduction of cell invasion ability, negative control (NC) is to lead
Enter scramble sequences.
Figure 17 is that nude mice tail vein injection Lung metastases test the nasopharyngeal carcinoma cell 5-8F further confirmed in EBV feminine genders into knurl
Middle importing BART6-3p or specificity can suppress swollen for lncRNA genes LOC553103 RNA interference sequences (siRNA)
The invasion and attack transfer ability of oncocyte.
BART6-3p is imported in the negative nasopharyngeal carcinoma cell 5-8F of EBV or specificity is directed to lncRNA genes
LOC553103 RNA interference sequences (siLOC), after the artificial expression for being overexpressed BART6-3p or suppressing LOC553103, it will locate
The cell managed finally puts to death nude mice, observes each group nude mice lung through in tail vein injection to nude mouse, continuing thereafter with raising 40 days
The situation of transfer neoplasia in dirty, arrow show metastatic tumor.Transfection BART6-3p or specificity are directed to lncRNA genes
Metastatic tumor number in two groups of nude mice lung tissues of LOC553103 RNA interference sequences is considerably less than negative control group, further
Confirm that the expression for being overexpressed BART6-3p or suppression LOC553103 can suppress tumor cell invasion and transfer.
Figure 18 is that nude mice tail vein injection Lung metastases count into knurl experimental result.
Figure 19 is that nude mice by subcutaneous further confirms to import BART6- in the negative nasopharyngeal carcinoma cell 5-8F of EBV into knurl experiment
3p or specificity can suppress the life of tumour cell for lncRNA genes LOC553103 RNA interference sequences (siRNA)
Long, propagation,
BART6-3p is imported in the negative nasopharyngeal carcinoma cell 5-8F of EBV or specificity is directed to lncRNA genes
LOC553103 RNA interference sequences (siLOC), after the artificial expression for being overexpressed BART6-3p or suppressing LOC553103, it will locate
The cell infusion managed continues thereafter with raising 30 days, finally puts to death nude mice, observe each group Xenografts in nude mice to nude mice by subcutaneous
Size.Transfect the two groups of nude mice by subcutaneous of BART6-3p or specificity for lncRNA genes LOC553103 RNA interference sequences
Transplantable tumor is substantially smaller than negative control group, further demonstrate the expression for being overexpressed BART6-3p or suppressing LOC553103
To suppress the growth of tumour cell and propagation.
Figure 20 counts for Xenografts in nude mice experimental result；
BART6-3p is imported in the negative nasopharyngeal carcinoma cell 5-8F of EBV or specificity is directed to lncRNA genes
LOC553103 RNA interference sequences (siLOC), after the artificial expression for being overexpressed BART6-3p or suppressing LOC553103, it will locate
The cell infusion managed continues thereafter with raising 30 days, the size of every 5 days measurement subcutaneous transplantation knurls, statistical result to nude mice by subcutaneous
Show that the expression for being overexpressed BART6-3p or suppression LOC553103 can suppress growth and the propagation of tumour cell.
Figure 21 is that BART6-3p can influence cytoskeletal structure in tumour cell,
After BART6-3p people is imported in the negative nasopharyngeal carcinoma cell 5-8F of EBV to be overexpressed BART6-3p, specificity mark
Remember cytoskeleton (F-actin), tested by cellular immunofluorescence, find to be overexpressed BART6-3p in fluorescence microscopy Microscopic observation
Cytoskeletal structure changes there occurs obvious afterwards, shows that BART6-3p overexpression have impact on micro-pipe microfilament in tumour cell
Assembling.(DAPI is nucleus specific dye)
The expression that Figure 22 is interference lncRNA genes LOC553103 can influence cytoskeletal structure in tumour cell,
The RNA interference sequences that specificity is directed to lncRNA genes LOC553103 are imported in nasopharyngeal carcinoma cell 5-8F
(siRNA) after the expression for artificially reducing LOC553103, specific marker cytoskeleton (F-actin), cellular immunofluorescence is passed through
Experiment, cytoskeletal structure changes there occurs obvious after fluorescence microscopy Microscopic observation finds interference LOC553103 expression, table
The assembling of micro-pipe microfilament in bright LOC553103 modulate tumors cell.(DAPI is nucleus specific dye)
Figure 23 is that Real-Time Fluorescent Quantitative PCR Technique detects expression of the LOC553103 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium
Situation；
Expression of the LOC553103 in nasopharyngeal carcinoma (NPC) in normal nasopharyngeal epithelium (N) than significantly reducing (P<0.001), and
It is negatively correlated with BART6-3p expression.
Figure 24 is that Real-Time Fluorescent Quantitative PCR Technique detects tables of the LOC553103 in normal control tissue by stomach cancer and cancer
Up to situation；
Expression of the LOC553103 in stomach cancer (T) in control tissue (N) by cancer than significantly reducing (P<0.001).
Figure 25 is that in situ hybridization detects expressions of the LOC553103 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium；
The left side is control tissue sample by a nasopharyngeal carcinoma cancer, and LOC553103 is high in epithelial tissue by cancer to express；The right
For a tissues of nasopharyngeal carcinoma sample, LOC553103 is substantially not detectable in tissues of nasopharyngeal carcinoma, and LOC553103 is in nasopharyngeal carcinoma group
Expression and BART6-3p in knitting is significantly negatively correlated.
Figure 26 is the relation of LOC553103 expression Yu Nasopharyngeal Carcinoma Patients prognosis
LOC553103 expression and the prognosis of Nasopharyngeal Carcinoma Patients are closely related, with BART6-3p just on the contrary, i.e.
The survival of patients time of the high expression (High) of LOC553103 will be significantly shorter than the patient (P of LOC553103 low expressions (Low)<
0.05)。
Figure 27 is that in situ hybridization detects expressions of the LOC553103 in control tissue by stomach cancer and cancer；
The left side is control tissue sample by a Stomach Carcinomas, and LOC553103 is high in cancer beside organism to express；The right is one
Stomach organization sample, LOC553103 express relatively low in tissues of nasopharyngeal carcinoma.
Figure 28 is the relation of LOC553103 expression Yu patients with gastric cancer prognosis
LOC553103 expression and the prognosis of patients with gastric cancer are closely related, with BART6-3p just on the contrary, i.e.
The survival of patients time of the high expression (High) of LOC553103 will be significantly shorter than the patient (P of LOC553103 low expressions (Low)<
0.05)。
Embodiment
The present invention is further illustrated below in conjunction with embodiment, is not intended to limit the present invention.
Embodiment 1, quantitative real-time PCR detection confirm that BART6-3p raises in nasopharyngeal carcinoma
1. materials and methods：
5 normal nasopharyngeal epithelial tissues and 18 tissues of nasopharyngeal carcinoma are collected, with Trizol (invitrogen Products)
Extracted total RNA, 2 μ g RNA, into after cDNA, are used with miScript Reverse Transcriptase kits (Qiagen Products) reverse transcription
QuantiTect SYBR Green PCR kits (Qiagen Products) carry out real-time fluorescence quantitative PCR detection BART6-
3p and reference gene RNU6B expression.MicroRNA common primers (Universal Primer) and BART6-3p and RNU6B
Specific primer designed and synthesized by Qiagen companies.
Real-time fluorescence quantitative PCR reaction system
Real-time fluorescence quantitative PCR reactions steps
Reaction confirms the amplification curve and melting curve of real-time fluorescence quantitative PCR, the expression intensity root of each gene after terminating
After CT values (threshold cycle values), reference gene (RNU6B) markization, examined and calculated using group t-test
P values.
2. result
BART6-3p does not express or expressed very low, and the high expression P in tissues of nasopharyngeal carcinoma in normal control tissue<
0.001 (Fig. 1)
Embodiment 2, in situ hybridization detection find that expression of the BART6-3p in nasopharyngeal carcinoma and stomach cancer is related to patient's prognosis
1. MATERIALS METHODS
1.1 design and synthesize hybridization probe
In order to which using in-situ hybridization method detection BART6-3p expression, we devise detects in situ hybridization
The oligonucleotide probe and positive control in situ hybridization oligonucleotide probe of BART6-3p expression.
BART6-3p probes：UCUAAGGCUAGUCCGAUCCCCG
Positive control probe (detection house-keeping gene GAPDH)：
GAPDH probes：CAGUAGAGGCAGGGAUGAUGUUCU
Each gene specific oligonucleotides probe sequence of above-mentioned design is synthesized using chemical synthesis process, in building-up process
The marked biotin of uracil (bio-U) in probe sequence.
1.2 oligonucleotide probe labelling kits and in situ hybridization detection reagent
Digoxin oligonucleotides tailing reagent (Dig Oligonucleitide Tailing Kit 2ndGeneration,
Roche companies), anti-digoxin-horseradish peroxidase complex detection kit (Anti-Digoxigenin-POD, Fab
Fragments, Roche company), strengthen the TSA signal amplifying systems (TSA of detection of expression signal in situTMBiotin System,
NEL700 kits, PerkinElmer companies), DAB staining kits (Beijing Zhong Shan companies), 20x sodium citrate buffers
(saline sodium citrate, SSC), dextran sulfate (Dextran sulphate), deionized formamide
(Deionized Formamide), polyadenylic acid (polyadenylic acid, Poly A), poly deoxyadenylic acid
(polydeoxyadenylic acid, Poly dA), it is denatured salmon sperm DNA (the denatured and sheared of shearing
Salmon sperm DNA, ssDNA), yeast transfer RNA (yeastt-RNA, tRNA), dithiothreitol (DTT) (DTT), 50x Deng Han
Family name's buffer solution (Denhardts ' s solution), phosphate buffer (PBS buffer), pepsin K, bovine serum albumin(BSA)
(BSA), triethanolamine (TEA), TNB Buffer (0.1M Tris-HCl, pH7.5,0.15M NaCL, 0.5%Blocking
Reagent), TNT Buffer (0.1M Tris-HCl, pH7.5,0.15M NaCL, 0.05%Tween 20), acetic anhydride, resistance
Disconnected reagent (Blocking reagent agent, Roche companies).
1.3 other main agents and material
Absolute ethyl alcohol, 90% alcohol, 70% alcohol, 50% alcohol, turpentine oil, distilled water, PBS (pH7.2~
7.4, NaCl 137mmol/L, KCl 2.7mmol/L, Na2HPO44.3mmol/L, KH2PO41.4mmol/L)；3% methanol-bis-
The oxygen aqueous solution (80% methanol and the configuration of 30% hydrogen peroxide)；0.01mol/L citrate buffers (citrate buffer, CB,
PH 6.0 ± 0.1,9ml 0.1M citric acid solutions and 41ml 0.1M sodium citrate solutions are added in 450ml distilled water matches somebody with somebody temporarily
Postpone correction work liquid pH value again)；0.1% trypsase；Haematoxylin；1% hydrochloride alcohol (the wine of 1ml concentrated hydrochloric acids+99ml 70%
Essence configuration)；Mounting glue (PTS Cure Mount II).Leica low melting points (58 DEG C) paraffin, domestic beeswax, absolute alcohol, diformazan
Benzene, 10% neutral paraformaldehyde (0.01mol/L, pH7.4, DEPC distilled water and PBS are prepared), haematoxylin, Yihong, in
Property mounting natural gum, cover glass, slide.
1.4 label probe
Oligonucleotide probe mark is carried out using 3-tailing DIG Olignucleutide Kit, reaction system is such as
Under.
100pmol oligonucleotide+ddH2O=9 μ l (control:control oligonucleutide 5μ
l+ddH2O 4μl)
Mix, slightly centrifuge.37 DEG C of water-bath 30min, add 2 μ l EDTA (0.2M, PH 8.0) stopped reactions.
Purified after 1.5 oligonucleotide probes mark
In order to increase the purity of label probe, marked probe need to be purified, concrete operations are as follows：
1) 100% cold ethanol (- 20 DEG C) of+2.5 μ l 4M LiCl+75 μ l of probe reaction mixture (22 μ l)
2) -70 DEG C of precipitations 60min, or-20 DEG C of 2h.
3) 13.000 × g, 4 DEG C of centrifugation 15min.
4) supernatant is abandoned, is washed with 70% ice-cold (V/V) ethanol of 50 μ l.
5) 4 DEG C of 13.000xg, 5min is centrifuged.
6) supernatant, 4 DEG C of dryings of vacuum are abandoned.
7) with the molten probe of aseptic double-distilled water weight.
1.6 in situ hybridizations detection achieves the expression of BART6-3p in paraffin section
Paraffin section hybridizes pre-treatment
1) paraffin section of 4 DEG C of preservations is placed in 58 DEG C of roasting piece 30min, melted surface paraffin.
2) dimethylbenzene dewaxes 3 × 5min successively.
3) step ethanol wash, 100% 2 × 2min of alcohol → 95%, 1 × 5min of alcohol → 70%, 1 × 5min of alcohol →
50% 1 × 5min of alcohol → 2 × 3min of DEPC water washings → DEPC-PBS washs 2 × 5min.
4) 300 μ l pepsins K (10 μ g/ml) are added dropwise in section, 37 DEG C digest 20min.
5) cut into slices and wash 1min, stopped reaction into PBS (0.1M PBS+2mg/ml glutamic acid).
6) cut into slices into 0.2N HCL, react 20-30min in 37 DEG C, increase the permeability of tissue.
7) section fixes 10min, room temperature afterwards with 4% paraformaldehyde (0.1M PBS dissolvings).
8) in order to increase tissue positive intensity for hybridization, acetyl processing is carried out to section.Cut into slices into 0.25% acetic anhydride
Buffer I (0.1M triethanolamines), room temperature 10min.
9) 1M PBS wash 2 × 5min.
Prehybridization and hybridization
Prehybridization：The prehybridization solution of -20 DEG C of preservations, 37 DEG C of incubation 60min being first placed in, the dosage of prehybridization solution is 50 μ l,
Parafilm is carried out lid and cut into slices, prehybridization 2 hours in 37 DEG C of wet box.(prehybridization solution composition includes：2XSSC, 10%Dextran
Sulphate, 1X Denhardt ' s solution, 50mM Phosphate Buffer (PH 7.0), 50mM DTT, 250 μ l,
100 μ g/ml poly A, 5 μ g/ml poly dA, 250 μ g/ml yeast t-RNA, 500 μ g/ml ssDNA, 47%
Deionized formamide)。
1) Parafilm is removed, gets rid of prehybridization solution, section is placed in 5min in 2 × SSC.
2) hybridization reaction：37 DEG C of hybridized overnights (18-20h).Each section adds 250 μ l hybridization solutions and carried out with Parafilm
Lid.Corresponding probe is added in prehybridization solution just turns into hybridization solution.Hybridization solution is prepared in prehybridization, is placed 37 DEG C of incubations, is made
Probe is completely dissolved in hybridization solution, the final concentration of 500ng/ml of hybridization solution middle probe used in this experiment.
3) post-hybridization washing, section immerse 2 × SSC, 10min, throw off Parafilm.Washed successively in shake on shaking table, 2 ×
SSC (0.5%SDS), 2 × 15min → 0.25 × SSC (0.5%SDS), 2 × 15min.
Color developing detection is reacted after hybridization
1) using Anti-Digoxigenin-POD detection digoxigenin-probes and mRNA combination compounds；TSA amplification systems
Strengthen the positive signal of in situ hybridization reaction solution reaction, DAB colour developings.
2) section is gone in TNT buffer solutions, 3 × 5min.
3) TNB is added dropwise and blocks buffer solution, 300 μ l/TMAs, room temperature, 30min.
4) unnecessary blocking agent is sucked, 1:Anti-Digoxigenin-POD (the TBS+0.1%Triton X- of 100 dilutions
100+1% blocking agents), room temperature 4 hours.
5) TNT Buffer (0.1M Tris-CL, pH7.5,0.15M NaCL, 0.05%Tween 20) are washed,
3x5min。
6) signal amplification reagent Biotinyl Tyamid, 300 μ l/TMAs, (Biotinyl Tyramid are added dropwise in section
Store liquid：Biotinyl Tyramid are dissolved in 0.2ml DMSO, Biotinyl Tyramid working solutions：1 × dilution, 1:50
Dilute Biotinyl Tyramid storages liquid), room temperature 10 minutes.
7) TNT is washed, 3 × 5min.
8) SA-HRP (strepto- avidin-horseradish peroxidase), 300 μ l/TMAs, room temperature 30min are added dropwise in section.
9) TNT is washed, 3 × 5min.
10) distilled water washing, 1 × 1min.
11) DAB is developed the color, and chromogenic reaction is controlled under microscope.
12) haematoxylin is redyed,
13) alcohol step is dehydrated, chip drying.
14) mounting glue, the cover glass cover plate of dimension, crosslinking section 1min under uviol lamp is added dropwise.
1.7 results judge and standard
Application Optics microscope is observed under low power and high power lens respectively, looks first at target RNA positive expression
Signal is in the intracellular positioning of object observing：Positioned at nucleus, cytoplasm or cell membrane.
Carried out respectively with two kinds of standards of the intensity of the detection rna expression position positive signal and the cell number of positive expression again
Comprehensive grading, criterion are：(1) judge according to positive cell dyeing intensity：A. cell dye-free, 0 point is remembered；B. cell is dyed
Light brown is weakly positive, remembers 1 point；C. cell dyes brown and dyes dark-brown without background coloration, or cell and have the light brown back of the body
Scape is moderate positive, remembers 2 points；D. cell dyes dark-brown and is strong positive without background coloration, remembers 3 points.(2) according to positive cell
Express number score：A. no positive cell expression, remembers 0 point；B. positive expression cell number≤25%, 1 point is remembered；C.25% ＜ is positive thin
Born of the same parents' number ＜ 50%, remember 2 points；D. positive expression cell number >=50%, 3 points are remembered.
It is respective by one of above-mentioned standard respectively by two pathology experts in order to reduce the subjective factor of appraisal result as far as possible
Judged and scored, then both are scored multiplication, as a result for：1. 0 point of person is finally calculated as 0 point, it is believed that radiolucent table reaches；2. 1 point
1 point is finally calculated as with 2 points of persons, it is believed that weakly positive is expressed；3. 3 points and 4 points of persons are finally calculated as 2 points, it is believed that moderate positive is expressed；④
6, which assign to 9 points of persons, is finally calculated as 3 points, it is believed that strong positive is expressed.
1.8 analyses and statistical software
Statistical analysis is carried out to experimental result using SPSS13.0 statistical softwares, compares use χ two-by-two2Test or Fisher
Exact test, correlation analysis use Spearmen correlation methods；P ＜ 0.05 are that difference is statistically significant.
Survivorship curve analysis uses Kaplan-Meier method and log-rank test；Multi-variables analysis uses Cox ' s
proportional hazards model；P ＜ 0.05 are that difference is statistically significant.
2 results
Expression of the 2.1BART6-3p in nasopharyngeal carcinoma is than the notable rise of expression in control tissue by cancer
There is 34 BART6-3p expression in nasopharyngeal epithelium (Adjacent Epithelial of NPC) by 40 cancers
Low (Low) or be substantially not detectable (negative), and in 115 nasopharyngeal carcinoma (NPC) 57 detected BART6-3p
Low expression (Low), remaining 58 are high expression (high), P<0.001 (Fig. 2 and Fig. 3).
2.2BART6-3p expression and nasopharynx metastasis of cancer Close relation
We queried the clinical data of 115 Nasopharyngeal Carcinoma Patients, such as age of onset, sex, TNM stage etc., and right
They have carried out Effect of follow-up visit by telephone, have inquired their start time in detail, treatment, have whether there is recurrence, whether there is and suffer from other diseases again
Disease, recurrence and death time etc., and register life span and state.We have found that BART6- is detected in tissues of nasopharyngeal carcinoma
3p expression and DISTANT METASTASES IN (Distance metastasis) negatively correlated relation of Nasopharyngeal Carcinoma Patients, i.e., turn at a distance
Shifting group BART6-3p expression is than recurrence group in situ (Local relapse) relatively low, (Fig. 4, P<0.05).
The Nasopharyngeal Carcinoma Patients prognosis of 2.3BART6-3p low expressions is poor
The survival analysis that the life span and state of our expression and patient to BART6-3p in tissues of nasopharyngeal carcinoma are carried out,
It was found that BART6-3p expression and the prognosis of Nasopharyngeal Carcinoma Patients are closely related in nasopharyngeal carcinoma, the trouble of the high expression (High) of BART6-3p
Person's life span will be considerably longer than BART6-3p low expressions (Low) patient (Fig. 5).
Expression of the 2.4BART6-3p in stomach cancer is than the notable rise of expression in control tissue by cancer
The low expression (Low) that 29 detect BART6-3p in 37 stomach organizations, 8 are high expression in addition
(high), there are 35 BART6-3p expression low (Low) or basic inspection in cancer beside organism corresponding to these stomach cancer samples
Do not detect (negative), only 2 are BART6-3p positive, P<0.05 (Fig. 6).
The patients with gastric cancer prognosis of 2.5BART6-3p low expressions is poor
The survival analysis that the life span and state of our expression and patient to BART6-3p in stomach organization are carried out, hair
BART6-3p expression and the prognosis of patients with gastric cancer are closely related in existing stomach cancer, the survival of patients of the high expression (High) of BART6-3p
Time will be considerably longer than BART6-3p low expressions (Low) patient (Fig. 7).
Embodiment 3, it is overexpressed growing multiplication and invasion and attack transfer that BART6-3p suppresses tumour cell
1. MATERIALS METHODS
1.1 cell culture and transfection
Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 negative EBV, stomach cancer cell AGS are purchased from Central South University's cell centre, cell
RPMI 1640 used in culture trains base and hyclone, and the trypsase used in vitellophag is the production of Gibco companies of the U.S.
Product.
BART6-3p is synthesized by Invitrogen companies by chemical synthesis, and sequence is:
CGGGGAUCGGACUAGCCUUAGA
The good tumor cell line of growth conditions is pressed 2 × 105Individual cells/well is inoculated in 6 orifice plates, and 6 orifice plates are placed in
37 DEG C, 5%CO2In incubator, cell growth to be cultivated can start BART6-3p transfection to 50-70% density；Transfected
Journey is as follows：
The Hiperfect transfection reagents (Qiagen Products) that 8 μ l are added in sterile EP pipes are trained in 100 μ l serum-frees
Support to mix in base and stand 5min；
BART6-3p is added in 100 μ l serum free mediums；Then the μ of Hiperfect transfection reagents 100 is included with above-mentioned
L serum free mediums gently mix, and are stored at room temperature 30 minutes, them is formed complex；
Cell is washed with D-Hank's liquid 3 times；
800 μ l serum free mediums (antibiotic-free) will be added in said mixture, are added after gentle mixing in 6 orifice plates
1 hole；
6 orifice plates are placed in CO2In incubator, 37 DEG C are cultivated 6 hours, then abandon supernatant, are added complete medium and are continued to train
Support 48 hours.
The effect of 1.2 real-time quantitative PCRs detection BART6-3p expression：
After cell transfecting success, extracted total RNA, reverse transcription, quantitative real-time PCR detection BART6-3p expression,
Method and steps is the same as embodiment 1.
1.3 cell proliferation experiment
MTT experiment [3- (4,5-dimethylthiazole-2-yl) -2.5-dipheny-tetrazolium bromide
Assay] it is the conventional means for detecting tumor cell proliferation, specific experiment step is as follows：
1) by cell dissociation, count, 500 cells are inoculated with per hole in 96 orifice plates, need to set 5 multiple holes last daily
Average, set 5 days altogether；
2) incubator culture at least 5 hours is placed, after cell attachment, adds the μ l of MTT liquid (5mg/ml) 20.Continue culture 4
Hour, discard nutrient solution.200 μ l DMSO are added per hole, are placed 10 minutes on shaking table；
3) 490nm wavelength is selected, on enzyme-linked immunosorbent assay instrument, each hole absorbance is determined and records result, hereafter often
Every 24 hours repeat steps 2, a numerical value is recorded, is detected 5 days altogether；
4) test in triplicate.Using each time point as abscissa, absorbance is ordinate, draws MTT curves.
1.4 cell scratch experiments
Cell scratch experiment is the experimental method for verifying tumor cell migration ability.BART6-3p or control are transfected
(scramble) nasopharyngeal carcinoma of sequence or stomach cancer cell are inoculated in 6 orifice plates, when cell density reaches 90%, use 200ul
Pipet draws a straight line (cut) in each 6 orifice plate, then in the Each point in time such as 0,8,12,16,24,32,48 hour
(depending on different cell migration abilities) observe cut healing state under the microscope, take pictures, and calculate each group cell migration speed
Degree.
1.5 cell-penetratings are tested
((transwell) experiment is to verify the experimental method of tumor cell invasion ability to cell-penetrating.Transwell is small
Room (8 μm of aperture) and matrigel (Matrigel) are purchased from U.S. company BD, 4% paraformaldehyde fixer, crystal violet dye liquor
(0.1%g/ml) is purchased from Sigma companies.Matrigel is pressed 1:8 dilutions, it is coated on the upper chamber of Transwell cells bottom film
Face, putting 37 DEG C makes Matrigel aggregate into gel in 30 minutes.Using preceding matrigel film water is carried out by BD companies specification.
Serum free medium and 1 × 10 is added on each Transwell cells upper strata5It is individual to have transfected BART6-3p or control
(scramble) nasopharyngeal carcinoma or stomach cancer cell of sequence, in Transwell cells, lower floor adds the culture containing 20% hyclone
Base.After cell continues culture 36 hours, fixed with 4% paraformaldehyde fixer, violet staining, upper strata is dabbed off with cotton swab
Non- migrating cell, washed 3 times with PBS.The tumour cell through matrix glued membrane is observed under the microscope.
2. result
After 2.1 transfection BART6-3p, BART6-3p expression significantly raises in tumour cell
After transfecting BART6-3p in EBV negative nasopharyngeal carcinoma cell 5-8F, HNE2, stomach cancer cell AGS, BART6-3p exists
Expression in nasopharyngeal carcinoma and stomach cancer cell significantly raises (Fig. 8), shows that BART6-3p is transfected successfully.
Tumor cell proliferation speed slows down after 2.2 transfection BART6-3p
MTT cell proliferation experiments are confirmed, BART6- is transferred in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2, gastric carcinoma cell lines AGS
After 3p, the growing multiplication speed of 3 plants of tumour cells substantially slows down (Fig. 9).
Cell migration reduced capability after 2.3 transfection BART6-3p
Cell scratch experiment confirms, after being transferred to BART6-3p in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and stomach cancer cell AGS
3 plants of tumour cells slow down from cut both sides toward the speed of cut center migration, the time lengthening of cut healing, show cell movement
Transfer ability reduces (Figure 10).
Cell invasion ability reduces after 2.4 transfection BART6-3p
Cell-penetrating (transwell) is it is experimentally confirmed that in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and stomach cancer cell AGS transfers
After entering BART6-3p, the tumor cell number of matrix glued membrane can be passed through to substantially reduce, show cell invasion reduced capability (Figure 11).
Embodiment 4, it is overexpressed the expression that BART6-3p suppresses lncRNA genes LOC553103 in tumour cell
1. MATERIALS METHODS
1.1 cell culture and transfection
Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 negative EBV, stomach cancer cell AGS are purchased from Central South University's cell centre, cell
RPMI 1640 used in culture trains base and hyclone, and the trypsase used in vitellophag is the production of Gibco companies of the U.S.
Product.
BART6-3p is synthesized by Invitrogen companies by chemical synthesis, and sequence is:
CGGGGAUCGGACUAGCCUUAGA
BART6-3p method and steps is transfected in tumour cell with embodiment 3.
LncRNA genes LOC553103 expression after 1.2 real-time quantitative PCRs detection transfection BART6-3p：
After cell transfecting success, extracted total RNA, reverse transcription, quantitative real-time PCR detection lncRNA genes
LOC553103 expression, method and steps are as follows with embodiment 1, the primer sequence：
Primer sequence for real time fluorescent quantitative detection LOC553103 expression：
LOC553103 forward primers：5’-acagtagtgcgatcaaggct-3’
LOC553103 reverse primers：5’-tcaccacctccctgttcttc-3’
Reference gene GAPDH Specific PCR primers：
- the ACCACAGTCCATGCCATCAC-3 ' of forward primer 5 '
- the TCCACCACCCTGTTGCTGTA-3 ' of reverse primer 5 '.
2. result
After transfecting BART6-3p, LOC553013 expression significantly reduces in tumour cell
After BART6-3p being transfected in EBV negative nasopharyngeal carcinoma cell 5-8F, HNE2, stomach cancer cell AGS, lncRNA genes
LOC553103 expression significantly reduces (Figure 12), shows that BART6-3p can suppress LOC553010 expression, in other words
LncRNA genes LOC553103 is BART6-3p target gene.
Embodiment 5, the expression that RNA interference methods suppress LOC553103 in tumour cell can suppress the growth of tumour cell
Propagation and invasion and attack transfer
1. MATERIALS METHODS
1.1 cell culture and transfection
Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2, stomach cancer cell AGS are purchased from Central South University's cell centre, used in cell culture
RPMI1640 trains base and hyclone, and the trypsase used in vitellophag is U.S.'s Gibco Products.
Specificity is as follows for LOC553103 RNA interference sequences (siRNA)：
siRNA-1：5’-AUAACAUGACAGCUUGCUUGUCUCC-3’
siRNA-2：5’-CUUCCAAGCUCACUCAAGGUUGUUG-3’
siRNA-3：5’-CUAAUAUUCCCUCAGAGCUGGGCUG-3’
Above-mentioned specificity is synthesized for LOC553103 RNA interference sequences by Invitrogen companies, negative control (NC,
Scramble) sequence is also synthesized and provided by Invitrogen companies.
The method and steps of cell transfecting is the same as embodiment 3.
It is real by cell proliferation experiment, cell-penetrating experiment and cell cut after 1.2RNA interference LOC553103 expression
Test and have detected artificial growth, propagation, invasion and attack and the change of transfer ability for lowering cell after LOC553103 is expressed.Specific method
With step with embodiment 3.
2. result
After 2.1 transfection specificity are for LOC553103 RNA interference sequences, LOC553103 expression water in tumour cell
It is flat to significantly reduce
RNA interference sequence of the specificity for LOC553103 is transfected in nasopharyngeal carcinoma cell 5-8F, HNE2, stomach cancer cell AGS
After row, expression of the LOC553103 in above-mentioned cell significantly reduces (Figure 13), shows the RNA interference sequences for LOC553103
Row transfect the positive effect for successfully suppressing LOC553103 expression.
Tumor cell proliferation speed slows down after 2.2 interference LOC553103 expression
MTT cell proliferation experiments are confirmed, specificity is transferred in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2, gastric carcinoma cell lines AGS
After LOC553103 RNA interference sequences, the growing multiplication speed of 3 plants of tumour cells substantially slows down (Figure 14).
Cell migration reduced capability after 2.3 interference LOC553103 expression
Cell scratch experiment confirms that being transferred to specificity in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and stomach cancer cell AGS is directed to
LOC553103 RNA interference sequence posterior nasopharynx cancers and stomach cancer cell slows down from cut both sides toward the speed of cut center migration, draws
The time lengthening of trace healing, show that cell movement transfer ability reduces (Figure 15).
Cell invasion ability reduces after 2.4 interference LOC553103 expression
Cell-penetrating (transwell) is it is experimentally confirmed that in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and stomach cancer cell AGS transfers
After entering specificity for LOC553103 RNA interference sequences, the tumor cell number of matrix glued membrane can be passed through to substantially reduce, table
Clear-cells invasive ability weakens (Figure 16).
Embodiment 6, further confirm to be overexpressed BART6-3p in animal model or suppress tumour cell with RNA interference methods
Middle LOC553103 expression can suppress growing multiplication and the invasion and attack transfer of tumour cell
1. MATERIALS METHODS
1.1 cell culture and transfection
Nasopharyngeal Carcinoma Cell Line 5-8F is purchased from Central South University's cell centre, and RPMI 1640 used in cell culture trains base and tire ox
Serum, and trypsase used in vitellophag is U.S.'s Gibco Products.
BART6-3p method is overexpressed in 5-8F cells with embodiment 3；
Specificity is transfected in 5-8F cells for LOC553103 RNA interference sequences to suppress intracellular LOC553103
The method of expression is the same as embodiment 5.
1.2 nude mices " tail vein injection-Lung metastases " model inspection BART6-3p and LOC553103 RNA interference sequences pair
The inhibitory action of metastatic ability of nasopharyngeal carcinoma cells
4 week old male nude mouses are purchased from Central South University's Experimental Animal Center, divide 3 groups, every group 10, growth period of taking the logarithm turns
BART6-3p or RNA interference sequences and 5-8F cell (such as backs of Scramble sequences (as negative control, NC) are contaminated
It is described), after pancreatin digests, under room temperature (15~25 DEG C), 1000rpm, centrifuge minute, supernatant discarding, 1 × PBS washings 2
It is secondary, cell is then resuspended and counts.Take 3.5 × 106Cell/only, through in tail vein injection to nude mouse.Continue conventinal breeding 40
My god, nude mice is put to death, observes the size and distribution situation of metastatic tumor in nude mice lungs.
1.3 Xenografts in nude mice model inspection BART6-3p and LOC553103 RNA interference sequences are to nasopharyngeal carcinoma cell
The inhibitory action of multiplication capacity
4 week old male nude mouses are purchased from Central South University's Experimental Animal Center, divide 3 groups, every group 4, growth period of taking the logarithm turns
BART6-3p or RNA interference sequences and 5-8F cell (such as backs of Scramble sequences (as negative control, NC) are contaminated
It is described), after pancreatin digests, under room temperature (15~25 DEG C), 1000rpm, centrifuge minute, supernatant discarding, 1 × PBS washings 2
It is secondary, cell is then resuspended and counts.Take 3.5 × 106Cell/only, it is subcutaneous to be inoculated in armpit on the right side of nude mice.Observation connects on time daily
The ordinary circumstance and the state of mind of nude mice, weigh after kind tumour cell, the time of record transplanting neoplasia and size.Use vernier
Slide calliper rule survey transplantable tumor length (length, L), wide (width, W) and high (height, H), calculating gross tumor volume (V), V=4 π/3*
(L/2*W/2*H/2).Growth of transplanted human curve is drawn according to tumor size.Nude mice is put to death after 35 days, transplanting tumor tissue is taken out and uses
10% formaldehyde is fixed.
2. result
2.1 nude mices " tail vein injection-Lung metastases " model further confirms that transfecting BART6-3p or specificity is directed to
After LOC553103 RNA interference sequences, Nasopharyngeal neoplasms ability reduces
After BART6-3p or specificity are transfected in nasopharyngeal carcinoma cell 5-8F for LOC553103 RNA interference sequences, with
Transfection negative control (Scramble sequences, NC) compare, in nude mice " tail vein injection-Lung metastases " model BART6-3p and
The number of metastatic tumor significantly reduces (Figure 17 and Figure 18) in two groups of nude mice lungs of LOC553103, show be overexpressed BART6-3p or
The invasion and attack transfer of tumour cell can be suppressed really by suppressing LOC553103 expression.
2.2 Xenografts in nude mice models further confirm that transfecting BART6-3p or specificity is directed to LOC553103 RNA
Tumor cell proliferation speed slows down after interference sequence
After BART6-3p or specificity are transfected in nasopharyngeal carcinoma cell 5-8F for LOC553103 RNA interference sequences, with
Transfection negative control (Scramble sequences, NC) is compared, the life of two groups of Xenografts in nude mice of BART6-3p and LOC553103
Long growth rate substantially slows down (Figure 19, Figure 20).
Embodiment 7, the expression expressed BART6-3p or suppress LOC553103 in tumour cell with RNA interference methods can change
Become the integrality of cytoskeleton in tumour cell
1. MATERIALS METHODS
1.1 cell culture and transfection
Nasopharyngeal Carcinoma Cell Line 5-8F is purchased from Central South University's cell centre, and RPMI 1640 used in cell culture trains base and tire ox
Serum, and trypsase used in vitellophag is U.S.'s Gibco Products.
BART6-3p method is overexpressed in 5-8F cells with embodiment 3；
Specificity is transfected in 5-8F cells for LOC553103 RNA interference sequences to suppress intracellular LOC553103
The method of expression is the same as embodiment 5.
1.2 immunofluorescence experiment
1) cell is inoculated with：By the cover glass disinfected (75% ethanol for disinfection soaked 2 hours, and in ultraviolet irradiation 1 hour)
It is placed in the hole of six orifice plates, the 5-8F of BART6-3p or transfection specificity for LOC553103 RNA interference sequences will be overexpressed
Cell and negative control cell (transfection Scramble sequences) are added separately on the cover glass in six orifice plates, after be placed in cell training
Support case culture 24 hours；Tissue Culture Plate is taken out, the PBS of 37 DEG C of preheatings, which leniently shakes, to be washed 3 times；Natural air drying；
2) 4% paraformaldehydes of 37 DEG C of preheatings are in 37 DEG C of fixed 15min, and the PBS of preheating, which gently shakes, to be washed 3 times, each 5min；
3) by FITC-phalloidin (Sigma companies being purchased from, for flag F-actin) 1:500 dilutions, 37 DEG C of incubations
50min, the PBS of preheating are washed three times；
4) DAPI dyes 5min, the PBS of preheating 3 times；
5) clear water washes 3 times and removes PBS, dries mounting, observes and take pictures under laser confocal microscope.
2. result
Immunofluorescence results show that the F-actin (cytoskeleton) of FITC marks in green, is distributed in endochylema, DAPI marks
The nucleic acid of note is distributed in nucleus in blueness.Cellular control unit regular shape, cytoskeleton clearly become clear, and rich content, are in
Fiber radial air arranges along cell major axis, and stress fiber clear layer, karyon is dyed to navy blue；BART6-3p groups (Figure 21) and
LOC553103 interference group (Figure 22) cytoskeleton depolymerization, Microfilaments In Cells shorten, and arrangement is sparse, and stress fiber number significantly reduces
Attenuate, nucleus is intensely dark, and cell shrinkage is rounded, and nucleus is intensely dark, and intercellular bridge shape skeleton connection fiber subtracts
Less or disappear, prompt cytoskeleton assembling after being overexpressed BART6-3p or interference LOC553103 expression to receive obvious suppression,
And it have impact on growth, propagation and the invasion and attack transfer ability of tumour cell.
Embodiment 8, quantitative real-time PCR detection confirm that LOC553103 expresses downward in nasopharyngeal carcinoma and stomach cancer
1. materials and methods：
It is right by 5 normal nasopharyngeal epithelial tissues and 18 tissues of nasopharyngeal carcinoma and 18 pairs of stomach organizations and corresponding cancer to collect
Trizol (invitrogen Products) extracted total RNA, 2 μ g RNA Reverse Transcriptase kit (Qiagen companies are used according to tissue
Product) reverse transcription into after cDNA, carries out in real time with QuantiTect SYBR Green PCR kits (Qiagen Products)
Fluorescence quantitative PCR detection LOC553103 and reference gene GAPDH expression.PCR primer and amplification method are the same as embodiment 4.
Reaction confirms the amplification curve and melting curve of real-time fluorescence quantitative PCR, the expression intensity root of each gene after terminating
After CT values (threshold cycle values), reference gene (GAPDH) markization, examined and calculated using group t-test
P values.
2. result
LOC553103 is expressed higher (Figure 24) in control tissue by normal nasopharyngeal epithelium (Figure 23) or Stomach Carcinomas, and
Expression is relatively low in tissues of nasopharyngeal carcinoma (Figure 23) or stomach organization (Figure 24).
Embodiment 9, in situ hybridization detection find that expression of the LOC553103 in nasopharyngeal carcinoma and stomach cancer is related to patient's prognosis
1. MATERIALS METHODS
1.1 design and synthesize hybridization probe
In order to which using in-situ hybridization method detection LOC553103 expression, we devise examines in situ hybridization
Survey the oligonucleotide probe and positive control (GAPDH) in situ hybridization oligonucleotide probe of LOC553103 expression.
LOC553103 probe sequences -1：5'-CAGAAAAUAAAGUCACAGAGCUCCUGGAAC-3'
LOC553103 probe sequences -2：5'-ACUGUUUCCUCUCUGCCUUGAUUGAAAUUC-3'
LOC553103 probe sequences -3：5'-ACACUUUGAAAUUUUUGUCACCUCCCUUGA-3'
Positive control probe (detection house-keeping gene GAPDH)：
GAPDH probe sequences -1：5'-CCACUUUACCAGAGUUAAAAGCAGCCCUGG-3'
GAPDH probe sequences -2：5'-CAGUAGAGGCAGGGAUGAUGUUCUGGAGAG-3'
GAPDH probe sequences -3：5'-GUCAGAGGAGACCACCUGGUGCUCAGUGUA-3'
Each gene specific oligonucleotides probe sequence of above-mentioned design is synthesized using chemical synthesis process, in building-up process
The marked biotin of uracil (bio-U) in probe sequence.
1.2 oligonucleotide probe labelling kits and in situ hybridization detection method, result judgement and statistical method are equally real
Apply example 2
2 results
Expression of the 2.1LOC553103 in nasopharyngeal carcinoma significantly reduces than the expression in control tissue by cancer
There is 36 LOC553103 expression in nasopharyngeal epithelium (Adjacent Epithelial of NPC) by 40 cancers
Higher (Figure 25 is left), and relatively low (Figure 25 the is right) P of 57 LOC553103 expression in 115 nasopharyngeal carcinoma (NPC)<0.001.
LOC553103 expression is with BART6-3p in significantly negatively correlated.
2.2LOC553103 the high Nasopharyngeal Carcinoma Patients prognosis of expression is poor
The existence point that the life span and state of our expression and patient to LOC553103 in tissues of nasopharyngeal carcinoma are carried out
Analysis, it is found that LOC553103 expression and the prognosis of Nasopharyngeal Carcinoma Patients are closely related in nasopharyngeal carcinoma, LOC553103 low expressions (Low)
The survival of patients time to be considerably longer than the patients (Figure 26, P=0.03) of the high expression (high) of LOC553103.
Expression of the 2.3LOC553103 in stomach cancer significantly reduces than the expression in control tissue by cancer
The low expression (Figure 27 is right) that 29 detect LOC553103 in 37 stomach organizations, remaining 8 are high table
Reach, and have that 35 LOC553103 expression is higher (Figure 27 left) in cancer beside organism corresponding to these stomach cancer samples, P<0.05.
2.4LOC553103 the patients with gastric cancer prognosis of height expression is poor
The survival analysis that the life span and state of our expression and patient to LOC553103 in stomach organization are carried out,
It was found that LOC553103 expression and the prognosis of patients with gastric cancer are closely related in stomach cancer, the patient of the high expression (High) of LOC553103
Life span will be significantly shorter than patient (Figure 28, the P of LOC553103 low expressions (Low)<0.05).
Claims (4)
1. suppress application of the preparation of long-chain non-coding RNA LOC553103 expression on stomach cancer cell inhibitor is prepared, its
It is characterised by, the preparation that suppressor LOC553103 is expressed, which is used to prepare, suppresses Growth of Gastric, propagation and pre- preventing tumor
The preparation of cell invasion transfer, sequence number of the gene in NCBI：NR_110997.
2. application according to claim 1, it is characterised in that be used to prepare by gene LOC553103 RNA interference sequences
Suppress the preparation of Growth of Gastric, propagation and prevention tumor cell invasion transfer.
3. application according to claim 2, it is characterised in that gene LOC553103 RNA interference sequences are following three kinds
In one or more：
siRNA-1：5’-AUAACAUGACAGCUUGCUUGUCUCC-3’
siRNA-2：5’-CUUCCAAGCUCACUCAAGGUUGUUG-3’
siRNA-3：5’-CUAAUAUUCCCUCAGAGCUGGGCUG-3’.
4. the application according to Claims 2 or 3, it is characterised in that described gene LOC553103 RNA interference sequences
Suppress the preparation of the assembling of stomach cancer cell skeleton and reconstruct for preparing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510728314.8A CN105267987B (en) | 2015-10-30 | 2015-10-30 | Applications of the long-chain non-coding RNA LOC553103 on stomach cancer cell inhibitor is prepared |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510728314.8A CN105267987B (en) | 2015-10-30 | 2015-10-30 | Applications of the long-chain non-coding RNA LOC553103 on stomach cancer cell inhibitor is prepared |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105267987A CN105267987A (en) | 2016-01-27 |
| CN105267987B true CN105267987B (en) | 2018-03-23 |
Family
ID=55138372
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510728314.8A Active CN105267987B (en) | 2015-10-30 | 2015-10-30 | Applications of the long-chain non-coding RNA LOC553103 on stomach cancer cell inhibitor is prepared |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105267987B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110257516A (en) * | 2019-06-26 | 2019-09-20 | 徐州医科大学 | For developing molecular marker and the application of diagnosing gastric cancer product |
| CN111518913B (en) * | 2020-06-04 | 2021-02-12 | 桂林医学院附属医院 | Non-coding RNA-LINC01819 for diagnosis and treatment of gastric cancer |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102268477A (en) * | 2011-06-15 | 2011-12-07 | 中山大学肿瘤防治中心 | Application of nasopharyngeal carcinoma related EB (Epstein-Barr) virus miRNAs (microribonucleic acids) |
| US20140296319A1 (en) * | 2011-05-25 | 2014-10-02 | Catholic University Industry Academic Cooperation Foundation | Composition For Promoting Apoptosis Or Inhibiting Cell Growth, Comprising Epstein-Barr Virus Microrna |
-
2015
- 2015-10-30 CN CN201510728314.8A patent/CN105267987B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140296319A1 (en) * | 2011-05-25 | 2014-10-02 | Catholic University Industry Academic Cooperation Foundation | Composition For Promoting Apoptosis Or Inhibiting Cell Growth, Comprising Epstein-Barr Virus Microrna |
| CN102268477A (en) * | 2011-06-15 | 2011-12-07 | 中山大学肿瘤防治中心 | Application of nasopharyngeal carcinoma related EB (Epstein-Barr) virus miRNAs (microribonucleic acids) |
Non-Patent Citations (4)
| Title |
|---|
| An atlas of genetic influences on human blood metabolites;So-Youn Shin等;《Nat Genet》;20141101;第46卷(第6期);第543-550页 * |
| EBV 相关性胃癌患者血浆miＲNAs 表达谱的研究;韦华军等;《胃肠病学和肝病学杂志》;20140831;第23卷(第8期);第885-888页 * |
| Epstein–Barr Virus MicroRNAs Are Evolutionarily Conserved and Differentially Expressed;Xuezhong Cai等;《PLoS Pathogens》;20060324;第2卷(第3期);第0236-0247页 * |
| 微小RNA与鼻咽癌;谭玉桃等;《医学综述》;20110430;第17卷(第7期);第993-996页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105267987A (en) | 2016-01-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105233304B (en) | Applications of the long-chain non-coding RNA LOC553103 on nasopharyngeal carcinoma cell inhibitor is prepared | |
| CN105200152B (en) | Applications of the long-chain non-coding RNA LOC553103 on nasopharyngeal carcinoma prognosis preparation is prepared | |
| CN109468382B (en) | Application of lncRNA in diagnosis and treatment of lung adenocarcinoma | |
| CN105200156B (en) | Long-chain non-coding RNA LOC553103 application | |
| CN107083433A (en) | Applications of the lncRNA in liver cancer diagnosis and treatment | |
| CN103667441B (en) | A kind of Hsa-miR-145-5p test kit and the application of ripe body analogies thereof | |
| CN105267987B (en) | Applications of the long-chain non-coding RNA LOC553103 on stomach cancer cell inhibitor is prepared | |
| CN106492228B (en) | The application of the siRNA of long-chain non-coding RNA LINC00673 and inhibitory preparation | |
| CN105200155B (en) | The application of the microRNA BART6-3p of Epstein-Barr virus coding | |
| CN105602951B (en) | The interference preparation of long-chain non-coding RNA LOC284454 and its application | |
| CN105288656B (en) | Applications of the microRNA BART6-3p of Epstein-Barr virus coding on preparing nasopharyngeal carcinoma cell inhibitor | |
| CN106480196B (en) | A kind of application of long-chain non-coding RNA LINC00152 | |
| CN105506154B (en) | In situ hybridization detects the application of long-chain non-coding RNA LOC284454 reagent in tissues of nasopharyngeal carcinoma | |
| CN106319044B (en) | Biomarker and its application of a kind of nasopharyngeal carcinoma auxiliary diagnosis or outcome prediction | |
| CN105238882A (en) | Application of EB virus encoded microRNA BART6-3p to preparation of nasopharyngeal cancer prognostic preparation | |
| CN105288657B (en) | Applications of the microRNA BART6-3p of Epstein-Barr virus coding on preparing stomach cancer cell inhibitor | |
| CN114457161A (en) | Application of lncRNA AC145207.5 in colorectal cancer diagnosis, treatment and drug sensitivity improvement | |
| CN106511368B (en) | The application of the siRNA of long-chain non-coding RNA LINC00152 and inhibitory preparation | |
| CN106381339B (en) | The application process of long-chain non-coding RNA LINC00152 in situ hybridization probes | |
| CN106337084B (en) | The in situ hybridization detection reagent and its application of long-chain non-coding RNA LINC01420 | |
| CN105483273B (en) | Detect the application of the reagent of long-chain non-coding RNA LOC284454 expression quantity in patients with nasopharyngeal carcinoma | |
| CN106480030B (en) | The application of long-chain non-coding RNA LINC00673 | |
| CN104894244B (en) | Long-chain non-coding RNA AFAP1 AS1 primer, detection reagent and its application | |
| CN107385081A (en) | A kind of gene related to kidney and its application | |
| CN105582536B (en) | Application of AGPAT9 gene in preparation of liver cancer treatment drug and diagnosis and prognosis evaluation reagent |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Xiang Bo Inventor after: Fan Songqing Inventor after: Shi Lei Inventor after: Gong Chaojian Inventor after: Bei Hao Inventor after: Xiong Wei Inventor after: Li Guiyuan Inventor after: Zeng Chaoyang Inventor after: Li Xiaoling Inventor after: He Baoyu Inventor after: Li Xiayu Inventor after: Zhang Wenling Inventor after: He Shuyi Inventor before: Xiong Wei Inventor before: Shi Lei Inventor before: Gong Chaojian Inventor before: Bei Hao Inventor before: Li Guiyuan Inventor before: Zeng Chaoyang Inventor before: Li Xiaoling Inventor before: He Baoyu Inventor before: Li Xiayu Inventor before: Zhang Wenling Inventor before: He Shuyi Inventor before: Fan Songqing |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |