CN105506154B

CN105506154B - In situ hybridization detects the application of long-chain non-coding RNA LOC284454 reagent in tissues of nasopharyngeal carcinoma

Info

Publication number: CN105506154B
Application number: CN201610065131.7A
Authority: CN
Inventors: 曾朝阳; 李桂源; 熊炜; 李小玲; 唐艳艳; 杨丽婷; 孛昊; 李夏雨; 龚朝建; 张文玲; 张姗姗; 郭灿
Original assignee: Central South University
Current assignee: Central South University
Priority date: 2016-01-29
Filing date: 2016-01-29
Publication date: 2019-04-26
Anticipated expiration: 2036-01-29
Also published as: CN105506154A

Abstract

The invention discloses the applications of long-chain non-coding RNA LOC284454 reagent in situ hybridization detection tissues of nasopharyngeal carcinoma, mainly for the preparation of nasopharyngeal carcinoma auxiliary diagnosis or outcome prediction preparation.Confirm that LOC284454 expression in normal nasopharyngeal epithelium (NPE) is lower by hybridization in situ technique, only have the low expression for detecting LOC284454 in 6 (15%) in 40 normal nasopharyngeal epitheliums, can't detect in remaining 34；And have the expression that LOC284454 is detected in 89 nasopharyngeal carcinoma (79.5%) in 112 tissues of nasopharyngeal carcinoma, wherein 71 are high expression, 18 are low expression, and the expression of LOC284454 is not detected in remaining 23 tissues of nasopharyngeal carcinoma；The Nasopharyngeal Carcinoma Patients of height expression LOC284454 total life span and disease-free survival time are significantly shorter than LOC284454 and express patient that is low or not expressing.The present invention provides important reference frame for the early detection of nasopharyngeal carcinoma, early treatment.

Description

In situ hybridization detects long-chain non-coding RNA LOC284454 reagent in tissues of nasopharyngeal carcinoma Application

Technical field

The invention belongs to oncomolecularbiology fields, and in particular in situ hybridization detects the non-volume of long-chain in tissues of nasopharyngeal carcinoma Code RNALOC284454 reagent is used to prepare the purposes of nasopharyngeal carcinoma auxiliary diagnosis or outcome prediction preparation.

Background technique

The Human Genome Project and its subsequent DNA element encyclopedia plan (The Encyclopedia of DNA Elements Project, ENCODE) research achievement shows that protein coding gene sequence only accounts for the 1- of human genomic sequence 3%, and in human genome the transcribed sequences of the overwhelming majority be long-chain non-coding RNA (Long non-coding RNA, lncRNA).LncRNA is universally present in various biologies, and with the raising of biological complex degree, lncRNA in genome The ratio of sequence also correspondingly increases, and prompts lncRNA significant during biological evolution.With lncRNA constantly quilt It was found that their function is gradually interpreted, scientists discovery lncRNA actively participates in vital movement different layers extensively In the function controlling in face, the field brand-new as one has become international life science field new forward position and hot spot.

LncRNA can be used as signal (signal), induction (guide), bait (decoy) or the bracket of functional protein (scaffold) various ways such as molecule regulate and control base in chromatin reconstruct, genetic transcription, translation and the multiple levels such as protein modified The expression of cause, and irreplaceable role is played during including the basic physiologicals such as development, immune, reproduction, it is prior It is that the expression of lncRNA and functional disturbance are closely connected with a variety of diseases of the mankind including malignant tumour one It rises.Therefore, the function of lncRNA is furtherd investigate, is disclosed by the lncRNA hereditary information transfer mode mediated and expression regulation net Network not only can annotate and illustrate again the structure and function of genome from the angle other than protein coding gene, deeply find The essence and rule of vital movement are expected to recognize from a new visual angle a variety of mankind's common diseases including tumour Pathogenesis, and new molecular marker and therapy target are provided for the Clinics and Practices of these diseases.

Nasopharyngeal carcinoma is common high-incidence head-neck malignant tumor, is easy to happen metastasic cervical lymph nodes, and prognosis is poor.Research The occurrence and development for showing this tumour are polygenes participation, multi-step, multistage complex process, and LncRNA is in nasopharyngeal carcinoma Important role may be also played during occurrence and development.Recently, we found that lncRNA LOC284454 (NCBI Accession number:NR_036515) up-regulation is expressed in tissues of nasopharyngeal carcinoma and serum, for the detection system of the lncRNA Agent can be used for the auxiliary diagnosis of nasopharyngeal carcinoma.We further increase sample, there is the nasopharyngeal carcinoma of Clinical Follow-up data at 112 Paraffin achieves in sample, and the expression of LOC284454 is had detected by the method for in situ hybridization (in situ hybridization) Level, discovery LOC284454 express up-regulation in tissues of nasopharyngeal carcinoma, and the Nasopharyngeal Carcinoma Patients of height expression LOC284454 compare low expression The Nasopharyngeal Carcinoma Patients poor prognosis of LOC284454, therefore the detection preparation for being directed to the lncRNA can be used for the prognosis of nasopharyngeal carcinoma Judgement.

We pass through the short hairpin RNA (short-hairpin RNA, shRNAs) for designing and synthesizing targeting LOC284454 Sequence constructs the rna interference vector of targeting LOC284454, is transfected into human nasopharyngeal epithelioma 1, in vitro culture systems and naked Confirm that the expression of targeting interference LOC284454 can obviously inhibit the invasion of nasopharyngeal carcinoma cell and turn in mouse metastatic tumor In vivo model Shifting ability.The rna interference vector of LOC284454 is loaded to, nano gene is made on the nano silicon particles of polylysine modification Transporter, the nano silicon particles of polylysine modification can protect the rna interference vector of LOC284454 to degrade from nuclease, Extend action time, and has higher transfection efficiency.

Summary of the invention

For the above-mentioned prior art, the object of the present invention is to provide long-chain non-codings in situ hybridization detection tissues of nasopharyngeal carcinoma RNALOC284454 reagent is used to prepare the purposes of nasopharyngeal carcinoma auxiliary diagnosis or outcome prediction preparation.

In situ hybridization detects the application of long-chain non-coding RNA LOC284454 reagent in tissues of nasopharyngeal carcinoma, the reagent It is used to prepare nasopharyngeal carcinoma auxiliary diagnosis or outcome prediction preparation；The sequence such as SEQ of long-chain non-coding RNA LOC284454 Shown in NO:1.

Long-chain non-coding RNA LOC284454 reagent includes being used for below in the in situ hybridization detection tissues of nasopharyngeal carcinoma In situ hybridization detects one or more of the oligonucleotide probe of LOC284454 expression:

LOC284454 probe 1:5 '-GACCGGAAAATAACAAACAAAAACTCTGCCTCAG-3 '；

LOC284454 probe 2:5 '-GTGATAGAACTTTAGTCTACCCTCCTCCGAAAAA-3 '；

LOC284454 probe 3:5 '-GTACAGACAACAAGTTCATTTATTTTCAACGGGAC-3 '.

Long-chain non-coding RNA LOC284454 reagent includes the following positive in the in situ hybridization detection tissues of nasopharyngeal carcinoma One or more of control probe:

GAPDH probe 1:5'-CCACTTTACCAGAGTTAAAAGCAGCCCTGG-3'；

GAPDH probe 2:5'-CAGTAGAGGCAGGGATGATGTTCTGGAGAG-3'；

GAPDH probe 3:5'-GTCAGAGGAGACCACCTGGTGCTCAGTGTA-3'.

The present invention confirms that LOC284454 expression in normal nasopharyngeal epithelium (NPE) is lower by hybridization in situ technique, Only have the low expression for detecting LOC284454 in 6 (15%) in 40 normal nasopharyngeal epitheliums, is detected not in remaining 34 It arrives；And have the expression that LOC284454 is detected in 89 nasopharyngeal carcinoma (79.5%) in 112 tissues of nasopharyngeal carcinoma, wherein 71 Example is high expression, and 18 are low expression, and the expression of LOC284454 is not detected in remaining 23 tissues of nasopharyngeal carcinoma；Height expression It is low or not that the total life span of the Nasopharyngeal Carcinoma Patients of LOC284454 and disease-free survival time are significantly shorter than LOC284454 expression The patient of expression.The present invention provides important reference frame for the early detection of nasopharyngeal carcinoma, early treatment.

Detailed description of the invention

Fig. 1 is that fluorescence quantitative PCR detection finds that LOC284454 raises situation in nasopharyngeal carcinoma；

Real-Time Fluorescent Quantitative PCR Technique verifies lncRNA LOC284454 in nasopharyngeal carcinoma (27) and chronic inflammation nasopharynx Expression in skin tissue (9), the significant up-regulation (P=0.0056) of LOC284454 expression；

Fig. 2 is that equally situation is raised in expression to LOC284454 in patients with nasopharyngeal carcinoma；

Real-Time Fluorescent Quantitative PCR Technique detects lncRNA LOC284454 in patients with nasopharyngeal carcinoma (77) and normal person Expression in serum (14)；Expression of the LOC284454 in patients with nasopharyngeal carcinoma in normal human serum than significantly mentioning It is high.

Fig. 3 is that in situ hybridization detects expression of the LOC284454 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium；

LOC284454 expression in normal nasopharyngeal epithelium (NPE) is lower, only has 6 in 40 normal nasopharyngeal epitheliums (15%) low expression that LOC284454 is detected in can't detect in remaining 34；And in 112 tissues of nasopharyngeal carcinoma There is the expression that LOC284454 is detected in 89 nasopharyngeal carcinoma (79.5%), wherein 71 are high expression, 18 are low expression, The expression of LOC284454 is not detected in remaining 23 tissues of nasopharyngeal carcinoma；P<0.001.

Fig. 4 is that LOC284454 high expresses patient's poor prognosis, more easy to recur and transfer in tissues of nasopharyngeal carcinoma；

The high expression of LOC284454 is related to the poor prognosis of Nasopharyngeal Carcinoma Patients in nasopharyngeal carcinoma, i.e. LOC284454 high expression The total life span (Over-all survival, OS) of patient and the disease-free survival time (Deases-free sruvival, It DFS) will be significantly lower than LOC284454 low expression or the patient not expressed.Expression of the LOC284454 in nasopharyngeal carcinoma (NPC) with Patients on Recurrence (C) and DISTANT METASTASES IN (D) are closely related, and LOC284454 expresses high patient and is easier to recur, and LOC284454 is remote The ability for locating transfer is stronger.

Fig. 5 is the interference carrier that LOC284454 is imported in nasopharyngeal carcinoma cell, can significantly inhibit LOC284454 in nasopharynx Expression in cancer cell；

In Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and HK1 import targeting LOC284454 interference carrier (sh-1, sh-2, Sh-3 after), real time fluorescence quantifying PCR method has detected the expression of LOC284454 in nasopharyngeal carcinoma cell, LOC284454's Expression is significantly inhibited.Negative control (NC) is Scramble interference carrier.

Fig. 6 is after importing the interference carrier inhibition LOC284454 expression of LOC284454 in nasopharyngeal carcinoma cell, and cell is invaded Attack ability reduction；

Cell-penetrating (transwell) in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and HK1 it is experimentally confirmed that be transferred to targeting The interference carrier of LOC284454, after the expression for inhibiting LOC284454, the nasopharyngeal carcinoma cell number that can pass through matrix glue film is significant It reduces, shows the reduction of cell invasion ability.

Fig. 7 is after importing the interference carrier inhibition LOC284454 expression of LOC284454 in nasopharyngeal carcinoma cell, and cell moves Shifting ability reduces；

Cell scratch experiment confirms, the dry of targeting LOC284454 is transferred in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and HK1 Carrier is disturbed, after the expression for inhibiting LOC284454, nasopharyngeal carcinoma cell obviously slows down from scratch both sides toward scratch center migration velocity, The time of scratch healing extends, and shows the reduction of cell movement transfer ability.

Fig. 8 is that zoopery further confirms that the expression of interference LOC284454 can inhibit the transfer ability of nasopharyngeal carcinoma cell；

It is transferred in nasopharyngeal carcinoma cell 5-8F after shRNA interference carrier inhibits LOC284454 expression, through tail vein by nasopharynx In cancer cell injection to nude mouse, Lung metastases situation is observed, is found compared with control group (NC), shRNA strikes low LOC284454 table The number of the 5-8F cell Pulmonary metastasis focuses reached tails off (Fig. 8 A, C), and the volume of transfer stove becomes smaller (Fig. 8 B, D), and P < 0.05 shows nose The transfer ability of pharynx cancer cell is obviously inhibited.

Specific embodiment

The present invention is further illustrated below in conjunction with specific embodiment, is not intended to limit the present invention.

Embodiment 1, quantitative real-time PCR detection discovery LOC284454 are raised in nasopharyngeal carcinoma

1. materials and methods:

Collect 9 chronic nasopharyngeal epithelium tissues and 27 tissues of nasopharyngeal carcinoma, extracted total RNA, 1 μ g RNA through reverse transcription at After cDNA, real-time fluorescence quantitative PCR is carried out.LOC284454 forward primer is 5 '-TTCCTAGCAGCCAGTTACCC-3 ' such as SEQ Shown in NO:2 and reverse primer 5 '-CTCCCGGCAAGTTAGAAAGC-3 ' is as shown in SEQ NO:3.

GAPDH forward primer for control is 5 '-ACCACAGTCCATGCCATCAC-3 ' as shown in SEQ NO:4, and Reverse primer 5 '-TCCACCACCCTGTTGCTGTA-3 ', as shown in SEQ NO:5.

Real-time fluorescence quantitative PCR reaction system

Real-time fluorescence quantitative PCR reaction step

The amplification curve and melting curve of real-time fluorescence quantitative PCR, the expression intensity root of each gene are confirmed after reaction After CT value (threshold cycle values), reference gene (GAPDH) markization, using group t-test checking computation P value.

2. result

LOC284454 do not express or express in normal control tissue it is very low, and in tissues of nasopharyngeal carcinoma high expression P < 0.001 (Fig. 1)

Embodiment 2, quantitative real-time PCR detection confirm that LOC284454 expresses up-regulation in patients with nasopharyngeal carcinoma

1. materials and methods:

14 normal persons of collection are acquired using BD 10ml sampled plasma pipe (EDTA anticoagulant tube) and 77 Nasopharyngeal Carcinoma Patients are quiet Arteries and veins fasting blood about 8ml is gently overturned 3 times, centrifugation, × 1600g, 10min, 4 DEG C in 1h；Upper plasma is carefully drawn on ice to new Centrifuge tube, number, label, -80 DEG C preservation.

Extracted total RNA utilizes blood plasma nucleic acid extraction kit QIAamp Circulating Nucleic Acid in blood plasma Kit (Catalog no.55114, Qiagen company) extracting, the specific steps are as follows:

(1) 300ul Proteinase K is drawn to 50ml centrifuge tube.

(2) add 3ml blood plasma to centrifuge tube.

(3) plus 2.4ml carrier-ACL mix is to centrifuge tube, covers pipe cap, vortex oscillation 30s is mixed.

(4) centrifuge tube is put into 60 DEG C of incubation 30min in water bath.

(5) centrifuge tube is taken out from water bath, unscrews pipe lid.5.4ml ACB buffer is added to centrifuge tube, closes pipe Lid, be vortexed concussion 20s, mixes well.

(6) centrifuge tube is placed in and is incubated for 10min on ice.Since fluorescence real-time quantitative PCR needs reference, serum recycles RNA Nothing is generally acknowledged reliable reference gene (house-keeping gene) in detection process, therefore we select that the unrelated matter of 1ng is added into 3ml blood plasma Grain pGL3 (being purchased from Promega company) is compared.

(7) vacuum suction method purified blood serum nucleic acid (the pGL3 Plasmid DNA including the RNA in serum and addition) is used: 20ml extension tube, mini column and vacuum coupling are assembled, vacuum pump is opened, until whole lysates pass through mini column (about 10 Minute), vacuum pump is closed, pressure is discharged into 0, unloads and abandons extension tube.

(8) plus 600ul ACW1 buffer is to mini column, maintains mini column lid in opened condition, opens vacuum pump, to Pass through mini column completely to ACW1, closes vacuum pump, pressure is discharged into 0.(first pass washing, removes impurity, purifies mini film On nucleic acid)

(9) plus 750ul ACW2 buffer is to mini column, maintains mini column lid in opened condition, opens vacuum pump, to Pass through mini column completely to ACW2, closes vacuum pump, pressure is discharged into 0.(second time washing, removes impurity, purifies mini film On nucleic acid)

(10) plus 100% ethyl alcohol of 750ul is to mini column, and maintenance mini column lid in opened condition, opens vacuum pump, to Pass through mini column completely to ethyl alcohol, closes vacuum pump, pressure is discharged into 0.(third removes impurity all over washing, purifies mini film On nucleic acid)

(11) lid for closing mini column, mini column is unloaded down, abandons connector, mini column is put into clean 2ml Collecting pipe, 20,000x g are centrifuged 3min.(removing remaining ethyl alcohol)

(12) mini column is put into a new 2ml collecting pipe, opens pipe lid, is put into 56 DEG C of incubation 10min in water bath, Until mini film is completely dried.Mini column is put into a clean 1.5ml elution pipe, the 2ml collecting pipe of previous step is abandoned, adds Enter 20ul AVE buffer (without carrier RNA) to the center of mini film, shuts lid, be incubated at room temperature 3min.20,000x G is centrifuged 1min, the nucleic acid being purified by flash.

1 μ g RNA carries out real-time fluorescence quantitative PCR after reverse transcription is at cDNA.LOC284454 forward primer is 5 '- ATCCCCAACTCTGCAACTGG-3 ' as shown in SEQ NO:6 and reverse primer 5 '-ACACAGCTGGCTTCCCTTTT-3 ' such as Shown in SEQ NO:7.

Plasmid pGL3 forward primer for control is 5 '-TCCATCTTGCTCCAACACCC-3 ' as shown in SEQ NO:8, With reverse primer 5 '-TCGTCTTTCCGTGCTCCAAA-3 ', as shown in SEQ NO:9.

It carries out reverse transcription and obtains cDNA, taking cDNA is template, and primer and PCR shown in SEQ ID NO:6,7,8,9 is added Reaction solution carries out PCR amplification, detects sample threshold Cq；Meanwhile 10 times of gradient dilutions of pGL3 Plasmid DNA liquid, as check and correction sample This, is detected in each PCR reaction plate, records Cq value；The amplification of internal reference pGL3 plasmid PCR；Real-time fluorescence quantitative PCR reaction System

Real-time fluorescence quantitative PCR reaction step

Make standard curve: after the completion of above-mentioned detection, copy number takes logarithm as abscissa using 10 the bottom of for, and Cq value is vertical sits It is denoted as figure, draws standard curve, slope S is calculated, then according to formula E=10^(-1/S)- 1, calculate amplification efficiency E；

It calculates: choosing sample and check and correction pattern detection hole, obtain sample using the accompanying software of real-time fluorescence quantitative PCR instrument Threshold value Cq (T) and check and correction sample threshold Cq (C), according to formula Q=(E+1)^-△Cq, △ Cq=[Cq (T)-Cq (C)] obtains gene Correction starting copy number Q；By the Q value of LOC284454 compared with the geometric mean of the Q value of pGL3 plasmid, obtain The relative expression quantity of LOC284454, using unpaired t-test checking computation P value.

2. result

LOC284454 does not express or expresses very low, and the high expression P in patients with nasopharyngeal carcinoma in normal human serum < 0.001 (Fig. 2).

Embodiment 3, expression of the in situ hybridization detection discovery LOC284454 in nasopharyngeal carcinoma are related to patient's prognosis

1. MATERIALS METHODS

1.1 design and synthesize hybridization probe

In order to which using the expression of in-situ hybridization method detection LOC284454, we devise examines in situ hybridization Survey the oligonucleotide probe and two groups of in situ hybridization oligonucleotide probes of positive control each 3 that LOC284454 is expressed.

Oligonucleotide probe in situ hybridization detection LOC284454 expression:

LOC284454 probe 1:5 '-GACCGGAAAATAACAAACAAAAACTCTGCCTCAG-3 ' such as SEQ NO:10 institute Show,

LOC284454 probe 2:5 '-GTGATAGAACTTTAGTCTACCCTCCTCCGAAAAA-3 ' such as SEQ NO:11 institute Show,

LOC284454 probe 3:5 '-GTACAGACAACAAGTTCATTTATTTTCAACGGGAC-3 ' such as SEQ NO:12 institute Show.

Positive control probe (detection house-keeping gene GAPDH):

GAPDH probe 1:5'-CCACTTTACCAGAGTTAAAAGCAGCCCTGG-3', as shown in SEQ NO:13,

GAPDH probe 2:5'-CAGTAGAGGCAGGGATGATGTTCTGGAGAG-3', as shown in SEQ NO:14,

GAPDH probe 3:5'-GTCAGAGGAGACCACCTGGTGCTCAGTGTA-3', as shown in SEQ NO:15.

Each gene specific oligonucleotides probe sequence of above-mentioned design is synthesized using chemical synthesis process.

1.2 oligonucleotide probe labelling kits and in situ hybridization detection reagent

Digoxin oligonucleotides tailing reagent (Dig Oligonucleitide Tailing Kit 2^ndGeneration, Roche company), anti-digoxin-horseradish peroxidase complex detection kit (Anti-Digoxigenin-POD, Fab Fragments, Roche company), enhance the TSA signal amplifying system (TSA of detection of expression signal in situ^TM Biotin System, NEL700 kit, PerkinElmer company), DAB staining kit (Beijing Zhong Shan company), 20x sodium citrate Buffer solution (saline sodium citrate, SSC), dextran sulfate (Dextran sulphate), deionized formamide (Deionized Formamide), polyadenylic acid (polyadenylic acid, Poly A), poly deoxyadenylic acid (polydeoxyadenylic acid, Poly dA) is denaturalized frog essence DNA (the denatured and sheared of shearing Salmon sperm DNA, ssDNA), yeast transfer RNA (yeast t-RNA, tRNA), dithiothreitol (DTT) (DTT), 50x Deng Han Family name's buffer (Denhardts ' s solution), phosphate buffer (PBS buffer), pepsin K, bovine serum albumin(BSA) (BSA), triethanolamine (TEA), TNB Buffer (0.1M Tris-HCl, pH7.5,0.15M NaCL, 0.5%Blocking Reagent), TNT Buffer (0.1M Tris-HCl, pH7.5,0.15M NaCL, 0.05%Tween 20), acetic anhydride, resistance Disconnected reagent (Blocking reagent agent, Roche company).

1.3 other main agents and material

Dehydrated alcohol, 90% alcohol, 70% alcohol, 50% alcohol, turpentine oil, distilled water, PBS buffer solution (pH7.2~ 7.4, NaCl 137mmol/L, KCl 2.7mmol/L, Na₂HPO₄4.3mmol/L, KH₂PO₄1.4mmol/L)；3% methanol- Hydrogen peroxide solution (80% methanol and the configuration of 30% hydrogen peroxide)；0.01mol/L citrate buffer (citrate buffer, CB, pH6.0 ± 0.1,9ml 0.1M citric acid solution and 41ml 0.1M sodium citrate solution are added interim in 450ml distilled water With postponing correction work liquid pH value again)；0.1% trypsase；Haematoxylin；1% hydrochloride alcohol (1ml concentrated hydrochloric acid+99ml 70% Alcohol configuration)；Mounting glue (PTS Cure Mount II)；Dedicated coverslip (480 × 240mm²) customize in Zhengzhou glass apparatus Factory.Leica low melting point (58 DEG C) paraffin, domestic beeswax, absolute alcohol, dimethylbenzene, 10% neutrality paraformaldehyde (0.01mol/L, PH7.4, DEPC distilled water and PBS buffer solution are prepared), haematoxylin, Yihong, neutral mounting natural gum, coverslip, glass slide.

1.4 label probe

Oligonucleotide probe label is carried out using 3-tailing DIG Olignucleutide Kit, reaction system is such as Under.

It mixes, is slightly centrifuged.37 DEG C of water-bath 30min add 2 μ l EDTA (0.2M, PH 8.0) stopped reactions.

It is purified after 1.5 oligonucleotide probes label

In order to increase the purity of label probe, marked probe need to be purified, concrete operations are as follows:

1) cold ethyl alcohol (- 20 DEG C) of+2.5 μ l 4M LiCL+75 μ l of probe reaction mixture (22 μ l) 100%

2) -70 DEG C of precipitatings 60min, or-20 DEG C of 2h.

3) 13.000 × g, 4 DEG C of centrifugation 15min.

4) supernatant is abandoned, with 70% (V/V) ethanol washing that 50 μ l are ice-cold.

5) 4 DEG C of 13.000xg are centrifuged 5min.

6) supernatant, 4 DEG C of dryings of vacuum are abandoned.

7) with the molten probe of aseptic double-distilled water weight.

1.6 in situ hybridizations detection achieves the expression of LOC284454 in paraffin section

Paraffin section hybridizes pre-treatment

1) paraffin section of 4 DEG C of preservations is placed in 58 DEG C of roasting piece 30min, melted surface paraffin.

2) dimethylbenzene successively dewaxes 3 × 5min.

3) step ethanol wash, 100% 1 × 5min of the alcohol of 2 × 2min of alcohol → 95% alcohol of 1 × 5min → 70% → 50% 1 × 5min of alcohol → 2 × 3min of DEPC water washing → DEPC-PBS washs 2 × 5min.

4) 300 μ l pepsin K (10 μ g/ml) are added dropwise on slice, 37 DEG C of digestion 20min.

5) it is sliced and washs 1min, stopped reaction into PBS (0.1M PBS+2mg/ml glutamic acid).

6) it is sliced into 0.2N HCL, in 37 DEG C of reaction 20-30min, increases the permeability of tissue.

7) slice fixes 10min, room temperature with 4% paraformaldehyde (0.1M PBS dissolution) afterwards.

8) in order to increase tissue positive intensity for hybridization, acetyl processing is carried out to slice.It is sliced into 0.25% acetic anhydride Buffer I (0.1M triethanolamine), room temperature 10min.

9) 1M PBS washs 2 × 5min.

Prehybridization and hybridization

Prehybridization: the prehybridization solution of -20 DEG C of preservations is first placed in 37 DEG C of incubation 60min, and the dosage of prehybridization solution is 50 μ l, Parafilm is carried out lid and is sliced, prehybridization 2 hours in 37 DEG C of wet box.(prehybridization solution composition includes: 2XSSC, 10%Dextran Sulphate, 1X Denhardt ' s solution, 50mM Phosphate Buffer (PH 7.0), 50mM DTT, 250 μ l, 100 μ g/ml poly A, 5 μ g/ml poly dA, 250 μ g/ml yeast t-RNA, 500 μ g/ml ssDNA, 47% Deionized formamide)。

1) parafilm is removed, prehybridization solution is got rid of, slice is placed in 5min in 2 × SSC.

2) hybridization reaction: 37 DEG C of hybridized overnights (18-20h).Each slice is added 250 μ l hybridization solutions and is carried out with parafilm Lid.Corresponding probe is added in prehybridization solution just becomes hybridization solution.Hybridization solution is prepared in prehybridization, is placed 37 DEG C of incubations, is made Probe is completely dissolved in hybridization solution, this experiment is mixed with a plurality of oligonucleotide probe, is matched by each probe 500ng/ml concentration Probe hybridization solution is made.Digoxin tailing labelling kit label probe concentration calculation foundation: the concentration of each probe by its with Colour developing is compared when detection reaction when positive quantitative probe and the naked probe of 30 bases of 100pmol marks reaction theory to visit Needle yield is that two kinds of standards of 900ng carry out the concentration that COMPREHENSIVE CALCULATING goes out label probe.

3) post-hybridization washing, slice immerse 2 × SSC, 10min, throw off parafilm.Successively washed in shake on shaking table, 2 × SSC (0.5%SDS), 2 × 15min → 0.25 × SSC (0.5%SDS), 2 × 15min.

Color developing detection is reacted after hybridization

1) digoxigenin-probe compound in conjunction with mRNA is detected using Anti-Digoxigenin-POD；TSA amplification system Increase

The positive signal of strong in situ hybridization reaction solution reaction, DAB colour developing.

2) slice is gone in TNT buffer, 3 × 5min.

3) TNB is added dropwise and blocks buffer, 300 μ l/TMAs, room temperature, 30min.

4) extra blocking agent, the diluted Anti-Digoxigenin-POD of 1:100 (TBS+0.1%Triton X- are sucked 100+1% blocking agent), room temperature 4 hours.

5) TNT Buffer (0.1M Tris-CL, pH7.5,0.15M NaCL, 0.05%Tween 20) is washed, 3x5min。

6) signal is added dropwise on slice and amplifies reagent Biotinyl Tyamid, 300 μ l/TMAs, (Biotinyl Tyramid Store liquid: Biotinyl Tyramid is dissolved in 0.2ml DMSO, Biotinyl Tyramid working solution: 1 × dilution, 1:50 Dilute Biotinyl Tyramid and store liquid), room temperature 10 minutes.

7) TNT is washed, 3 × 5min.

8) SA-HRP (strepto- avidin-horseradish peroxidase) is added dropwise in slice, 300 μ l/TMAs, room temperature 30min.

9) TNT is washed, 3 × 5min.

10) distilled water washing, 1 × 1min.

11) DAB develops the color, and controls chromogenic reaction under microscope.

12) haematoxylin is redyed,

13) alcohol step is dehydrated, chip drying.

14) mounting glue, the coverslip cover plate of dimension, crosslinking slice 1min under ultraviolet lamp is added dropwise.

The judgement of 1.7 results and standard

Application Optics microscope is observed under low power and high power lens respectively, looks first at the positive expression of target RNA The signal positioning intracellular in object observing: it is located at nucleus, cytoplasm or cell membrane.

It is carried out respectively with two kinds of standards of the intensity of the detection rna expression position positive signal and the cell number of positive expression again Comprehensive score, judgment criteria are as follows: (1) judge according to positive cell dyeing intensity: a. cell dye-free remembers 0 point；B. cell is dyed Light brown is weakly positive, remembers 1 point；C. cell dyes brown and dyes dark-brown without background coloration or cell and have light brown back Scape is moderate positive, remembers 2 points；D. cell dyes dark-brown and is strong positive without background coloration, remembers 3 points.(2) according to positive cell Express number score: the no positive cell expression of a. remembers 0 point；B. positive expression cell number≤25% remembers 1 point；C.25% < is positive thin Born of the same parents' number < 50% remembers 2 points；D. positive expression cell number >=50% remembers 3 points.

In order to reduce the subjective factor of appraisal result as far as possible, it is respective that You Liangwei pathology expert presses one of above-mentioned standard respectively Judged and scored, then the two is scored and is multiplied, as a result are as follows: 1. 0 point of person is finally calculated as 0 point, it is believed that feminine gender expression；2. 1 point 1 point is finally calculated as with 2 points of persons, it is believed that weakly positive expression；3. 3 points and 4 points of persons are finally calculated as 2 points, it is believed that moderate positive expression；④ 6, which assign to 9 points of persons, is finally calculated as 3 points, it is believed that strong positive expression.

1.8 analyses and statistical software

Statistical analysis is carried out to experimental result using SPSS13.0 statistical software, compares use χ two-by-two²Test or Fisher Exact test, correlation analysis use Spearmen correlation method；P < 0.05 is that difference is statistically significant. Survivorship curve analysis uses Kaplan-Meier method and log-rank test；Multi-variables analysis uses Cox ' s proportional hazards model；P < 0.05 is that difference is statistically significant.

2 results

Expression of 2.1 LOC284454 in nasopharyngeal carcinoma is significantly increased than the expression in normal control tissue

LOC284454 (79/112) in 79.5% tissues of nasopharyngeal carcinoma has expression, and only 17.6%, (34 chronic 6 in inflammation epithelial tissue sample) normal nasopharyngeal epithelial tissue in have expression (Fig. 3), there is apparent system between the two Meter learns difference (P < 0.001).

The highly expressed Nasopharyngeal Carcinoma Patients prognosis of 2.2 LOC284454 is poor

We have carried out Effect of follow-up visit by telephone to 112 Nasopharyngeal Carcinoma Patients, have inquired their start time, treatment feelings in detail Condition, whether there is or not recurrence, whether there is or not suffering from other diseases, recurrence and death time etc. again, and register life span and state, and to nasopharynx The survival analysis that the expression of LOC284454 and the life span of patient and state carry out in cancerous tissue, finds LOC284454 high table The patient (Fig. 4) for being significantly shorter than LOC284454 low expression the mean survival time up to patient or not expressing.Illustrating LOC284454 is One molecular labeling relevant to nasopharyngeal carcinoma prognosis, lncRNA expression is high, patient's poor prognosis.

Embodiment 4, the expression of building shRNA carrier interference LOC284454

1. MATERIALS METHODS

1.1 reagent and kit

Restriction enzyme Hind III, Bgl II, EcoR I and Cla I, T4DNA ligase etc. are public purchased from TakaRa Department；

TRIZOL^TMReagent(Invitrogen)；

Plasmid extraction kit (#D6943-01, OMEGA)；

Plastic recovery kit (#M5212, OMEGA)；

Reverse Transcriptase kit (#A3500, Promega)；

Antibiotic G418 (Ameresc).

The design of 1.2 shRNA

First by the Block-It RNAi designer software of LOC284454 sequence inputting Invitrogen company, seek It is as follows to select optimal 3 corresponding target sequences for the shRNA best target for looking for the lncRNA:

ShRNA-1:GACTCAGAATCAGACCTGTGT as shown in SEQ NO:16,

ShRNA-2:GCATAGATAGGTGGGTGAGTG as shown in SEQ NO:17,

ShRNA-3:GACACAAGCAGGTGTGCTTAG as shown in SEQ NO:18,

Using the widely used Scramble sequence for not having any target spot in human genome as negative control, sequence It arranges as follows:

Scramble:5 '-GACACGCGACTTGTACCAC-3 ' is as shown in SEQ NO:19.

For this 3 lncRNA target sequences and Scramble sequence, according to OligoEngine company pSUPER carrier Specification, design can be formed hairpin structure oligonucleotides is single-stranded and its reverse complementary sequence, they can form two after annealing Hold the DNA double chain respectively with restriction enzyme site BglII and HindIII cohesive end.Each few nucleosides that need to specifically synthesize The DNA double chain formed after acid sequence and their pairing annealing is as follows:

ShRNA-1:

5’-GATCCCC GACTCAGAATCAGACCTGTGT TTCAAGAGA ACACAGGTCTGATTCTGAGTC TTTTTA-3’

3’-GGG CTGAGTCTTAGTCTGGACACA AAGTTCTCT TGTGTCCAGACTAAGACTCAG AAAAATTCGA-5’

As shown in SEQ NO:20,21,

ShRNA-2:

5’-GATCCCC GCATAGATAGGTGGGTGAGTG TTCAAGAGA CACTCACCCACCTATCTATGC TTTTTA-3’

3’-GGG CGTATCTATCCACCCACTCAC AAGTTCTCT GTGAGTGGGTGGATAGATACG AAAAATTCGA-5’

As shown in SEQ NO:22,23,

ShRNA-3:

5’-GATCCCC GACACAAGCAGGTGTGCTTAG TTCAAGAGA CTAAGCACACCTGCTTGTGTC TTTTTA-3’

3’-GGG CTGTGTTCGTCCACACGAATC AAGTTCTCT GATTCGTGTGGACGAACACAG AAAAATTCGA-5’。

As shown in SEQ NO:24,25,

Scramble

5’-GATCCCC GACACGCGACTTGTACCAC TTCAAGAGA GTGGTACAAGTCGCGTGTC TTTTTA- 3’

3’-GGG CTGTGCGCTGAACATGGTG AAGTTCTCT CACCATGTTCAGCGCACAG AAAAATTCGA- 5’

As shown in SEQ NO:26,27.

After the DNA annealing of two complementary pairings, the left side is the cohesive end of restriction enzyme Bgl II, and the right is Hind The cohesive end of III.

1.3 shRNA vector constructions

The corresponding 8 single-stranded oligo sequences of above-mentioned 4 shRNA of chemical synthesis, by synthetic oligo oligo Annealing buffer is dissolved into 20 μM, and complementary single strand respectively takes 10 μ l to mix.Then by oligo mixture 95 in PCR instrument DEG C heating 5 minutes, then cooled to room temperature formed double-strand oligo segment.

With Bgl II and Hind III double digestion pSUPER plasmid, the carrier segments of 3.1kb are recycled, by the viscosity after annealing The DNA of end and the carrier of digestion recycling are mixed according to the ratio of the amount of substance of 3:1, and with T4 ligase, 16 DEG C of connections are overnight.Turn Change E.coil competence, selects transformant, bacterium colony PCR and sequencing identification, then built with Cla I and I digestion of EcoR PSUPER plasmid, 2% agarose DNA gel electrophoresis, using blank pSUPER as blank control, judgement inserts target fragment Positive colony, for interfering the expression of intracellular LOC284454 after positive colony sequencing verifying.

1.4 cell culture and transfection

Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and HK1 are purchased from Central South University's cell centre, RPMI 1640 used in cell culture Trypsase used in Pei Ji and fetal calf serum and vitellophag is U.S.'s Gibco Products.

Growth conditions good Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and HK1 are pressed 2 × 10⁵A cells/well is inoculated in 6 holes In plate, 6 orifice plates are placed in 37 DEG C, 5%CO₂In incubator, cell to be cultivated, which grows to 50-70% density, can start shRNA The transfection of expression vector；Transfection process is as follows:

The lipofectamine 3000 that 3 μ l are added in sterile EP tube mixes standing in 100 μ l serum free mediums 5min；

The shRNA expression vector of building is added in 100 μ l serum free mediums；Then include with above-mentioned The 100 μ l serum free mediums of lipofectamine mildly mix, and are stored at room temperature 30 minutes, form DNA with liposome compound Body；

It is washed cell 3 times with D-Hank's liquid；

800 μ l serum free mediums (antibiotic-free) will be added in said mixture, be added in 6 orifice plates after mild mixing 1 hole；

6 orifice plates are placed in CO₂In incubator, 37 DEG C are cultivated 6 hours, and supernatant is then abandoned, and complete medium is added and continues to train It supports 48 hours.

1.5 real-time quantitative PCRs detect the effect of shRNA interference lncRNA expression:

By various shRNA carriers transfection after nasopharyngeal carcinoma cell extracted total RNA, 2 μ g RNA after reverse transcription is at cDNA, into Row real-time fluorescence quantitative PCR.LOC284454 primer is 5 '-TTCCTAGCAGCCAGTTACCC-3 ' and 5 '- CTCCCGGCAAGTTAGAAAGC-3’。

GAPDH primer for control is 5 '-ACCACAGTCCATGCCATCAC-3 ' and 5 '- TCCACCACCCTGTTGCTGTA-3’。

Real-time fluorescence quantitative PCR reaction system

Real-time fluorescence quantitative PCR reaction step

2. result

After these three shRNA carriers transfect nasopharyngeal carcinoma cell 5-8F, HNE2 and HK1, nasopharyngeal carcinoma cell can be significantly lowered The expression (Fig. 5) of middle LOC284454.

Embodiment 5, the nano particle for preparing load shRNA interference carrier inhibit the table of LOC284454 in nasopharyngeal carcinoma cell It reaches

1. MATERIALS METHODS

1.1 prepare the coated nano silicon particles of poly-D-lysine

The coated nano silicon particles of poly-D-lysine are carried out with OP10/ hexamethylene/ammonia microemulsion self-assembling technique The synthesis of nano silicon particles (silica nanoparticle, SiNP), and can and pass through ion using the surface of nano silicon particles Electrostatic interaction prepares the nano silicon particles of polylysine modification；The nano particle can be prepared by following methods:

1) OP-10, hexamethylene and ammonium hydroxide are mixed, the positive different ester of silicic acid (TEOS) is added after being stirred at room temperature uniformly, continues to stir Mix to polymerization and complete, be added equal-volume acetone, ultrasonic disperse, centrifugation, distilled water washs three times, be collected by centrifugation be deposited in 80 DEG C it is dry It is dry, it is finely ground to obtain nano silicon particles (SiNP).Wherein H₂O and OP-10 and H₂The molar ratio of O and TEOS is 2~10, ammonia concn is 1.6~28%, molar concentration of the TEOS in hexamethylene is 0.1~3mol/L.

2) SiNP is resuspended in 0.6M NaCO by 0.1~10mg/ml₃In solution, supernatant is abandoned in ultrasonic disperse, centrifugation, then Sediment is resuspended in PBS (pH 7.4) by 0.1~10mg/ml, ultrasonic disperse, add polylysine (final concentration of 4~ 15nmol/mL), it mixes well, room temperature is mixed to shake；Centrifugation, abandons supernatant, and precipitating is resuspended in distilled water, obtains poly-D-lysine and repair The nano silicon particles of decorations.Final concentration of 4~15nmol/mL of poly-D-lysine.

1) by modified nano silicon particles ultrasonic disperse, in mass ratio 5~30:1 and targeting described in embodiment 3 The rna interference vector of LOC284454 mixes, and is stored at room temperature and makes it combine.

1.2 cell culture and transfection

Growth conditions good nasopharyngeal carcinoma cell 5-8F, HNE2 and HK1 are pressed 2 × 10⁵A cells/well is inoculated in 6 orifice plates In, 6 orifice plates are placed in 37 DEG C, 5%CO₂In incubator, cell to be cultivated, which grows to 50-70% density, to be started The transfection of LOC284454 carrier for expression of eukaryon；Transfection process is as follows:

The poly-D-lysine that the carrying LOC284454 eukaryon expression plasmid that 100 μ l are prepared is added in sterile EP tube is repaired The nano silicon particles suspension of decorations is mildly mixed with 100 μ l serum free mediums；It is washed cell 3 times with D-Hank's liquid；It will be above-mentioned 800 μ l serum free mediums (antibiotic-free) are added in mixture, 1 hole in 6 orifice plates is added after mild mixing；By 6 orifice plates It is placed in CO₂In incubator, 37 DEG C are cultivated 6 hours, and supernatant is then abandoned, and complete medium is added and continues overnight incubation.With carrying The nano silicon particles of the polylysine modification of Scramble sequence are as experiment contrast.

The experiment of 1.3 cell-penetratings

((Transwell) experiment is to verify the experimental method of tumor cell invasion ability to cell-penetrating.Transwell is small Room (8 μm of aperture) and matrigel (Matrigel) are purchased from U.S. company BD, 4% paraformaldehyde fixer, crystal violet dye liquor (0.1%g/ml) is purchased from Sigma company.Matrigel is diluted by 1:8, is coated on the upper chamber of the cell Transwell bottom film Face, setting 37 DEG C makes Matrigel aggregate into gel in 30 minutes.Matrigel film water is carried out by BD company specification using preceding.

Serum free medium and 1 × 10 is added on each cell Transwell upper layer⁵It is a to have transfected LOC284454shRNA The nasopharyngeal carcinoma cell of interference carrier or control vector (Scramble) is added in the cell Transwell lower layer and contains 20% tire ox blood Clear culture medium.After cell continues culture 36 hours, fixed with 4% paraformaldehyde fixer, violet staining, gently with cotton swab The non-migrating cell in upper layer is wiped, is washed 3 times with PBS.The nasopharyngeal carcinoma cell across matrix glue film is observed under the microscope.

1.4 cell scratch experiments

Cell scratch experiment is the experimental method for verifying tumor cell migration ability.LOC284454shRNA interference is transfected Carrier or the nasopharyngeal carcinoma cell of control vector (Scramble) are inoculated in 6 orifice plates, when cell density reaches 90%, use 200ul Pipet draws a straight line (scratch) in each 6 orifice plates, then in the various time points such as 0,8,12,16,24,32,48 hour (depending on different cell migration abilities) observe scratch healing state under the microscope, take pictures, and calculate group of cells migration speed Degree.

2. result

After 2.1 interference carriers for importing LOC284454 in nasopharyngeal carcinoma cell inhibit LOC284454, cell invasion ability It reduces

Cell-penetrating (Transwell) in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and HK1 it is experimentally confirmed that be transferred to targeting The interference carrier of LOC284454, after the expression for inhibiting LOC284454, the nasopharyngeal carcinoma cell number that can pass through matrix glue film is significant It reduces, shows that cell invasion ability reduces (Fig. 6).

After 2.2 interference carriers for importing LOC284454 in nasopharyngeal carcinoma cell inhibit LOC284454 expression, cell migration Ability reduces

Cell scratch experiment confirms, the dry of targeting LOC284454 is transferred in Nasopharyngeal Carcinoma Cell Line 5-8F, HNE2 and HK1 Carrier is disturbed, after the expression for inhibiting LOC284454, nasopharyngeal carcinoma cell slows down from scratch both sides toward the speed that scratch center migrates, and draws The time of trace healing extends, and shows that cell movement transfer ability reduces (Fig. 7).

The expression of embodiment 6, nude mice metastatic tumor model validation inhibition LOC284454 can inhibit the transfer of nasopharyngeal carcinoma cell Ability

1. materials and methods

10 male BALB/C nude mices, 4 week old, weight are 19 ± 2g, are bought in the limited public affairs of Shanghai Si Laike experimental animal Department.The equal quality inspections of all nude mices are qualified, raise in no-special pathogen (SPF) under the conditions of in experimental animal portion, Central South University. Preparation, the cell culture of the nano silicon particles of the building of LOC284454 interference carrier and polylysine modification are equal real with transfection Apply example 4.The 5-8F cell of transfection LOC284454 interference carrier or Scramble carrier (NC) respectively takes 1 × 10⁶It is a, through tail vein It injects in nude mouse (5 every group), puts to death nude mice after 10 weeks, the transfer case for observing nasopharyngeal carcinoma cell (is mainly transferred to nude mice In lung).

2. result

Zoopery further confirms that the expression of interference LOC284454 can inhibit the transfer ability (Fig. 8) of nasopharyngeal carcinoma cell. Compared with control group (NC), the number (Fig. 8 A, C, P < 0.05) for striking the 5-8F cell Pulmonary metastasis focuses of low LOC284454 tails off, and turns The volume for moving stove becomes smaller (Fig. 8 B, D), shows that the transfer ability of nasopharyngeal carcinoma cell is obviously inhibited.

Claims

1. the application that in situ hybridization detects long-chain non-coding RNA LOC284454 reagent in tissues of nasopharyngeal carcinoma, which is characterized in that institute The reagent stated is used to prepare nasopharyngeal carcinoma auxiliary diagnosis or outcome prediction preparation；The sequence of long-chain non-coding RNA LOC284454 For column as shown in SEQ NO:1, the long-chain non-coding RNA LOC284454 expresses up-regulation in tissues of nasopharyngeal carcinoma；

Long-chain non-coding RNA LOC284454 reagent includes below in situ in the in situ hybridization detection tissues of nasopharyngeal carcinoma One or more of the oligonucleotide probe of hybridization check LOC284454 expression:

LOC284454 probe 1:5 '-GACCGGAAAATAACAAACAAAAACTCTGCCTCAG -3 '；

LOC284454 probe 2:5 '-GTGATAGAACTTTAGTCTACCCTCCTCCGAAAAA-3 '；

LOC284454 probe 3:5 '-GTACAGACAACAAGTTCATTTATTTTCAACGGGAC-3 '.

2. application according to claim 1, which is characterized in that long-chain is non-in the in situ hybridization detection tissues of nasopharyngeal carcinoma Coding RNA LOC284454 reagent includes one or more of following positive control probe:

GAPDH probe 1:5'-CCACTTTACCAGAGTTAAAAGCAGCCCTGG-3'；

GAPDH probe 2:5'-CAGTAGAGGCAGGGATGATGTTCTGGAGAG-3'；

GAPDH probe 3:5'-GTCAGAGGAGACCACCTGGTGCTCAGTGTA-3'.