CN109701025A - CircCDYL2 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation - Google Patents

CircCDYL2 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation Download PDF

Info

Publication number
CN109701025A
CN109701025A CN201910162070.XA CN201910162070A CN109701025A CN 109701025 A CN109701025 A CN 109701025A CN 201910162070 A CN201910162070 A CN 201910162070A CN 109701025 A CN109701025 A CN 109701025A
Authority
CN
China
Prior art keywords
circcdyl2
nasopharyngeal carcinoma
cell
preparation
treatment
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910162070.XA
Other languages
Chinese (zh)
Inventor
熊炜
范春梅
熊芳
曾朝阳
郭灿
赵梦瑶
王忆安
龚朝建
张姗姗
周鸣
李小玲
李桂源
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Central South University
Original Assignee
Central South University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Central South University filed Critical Central South University
Priority to CN201910162070.XA priority Critical patent/CN109701025A/en
Publication of CN109701025A publication Critical patent/CN109701025A/en
Pending legal-status Critical Current

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to oncomolecularbiology technical fields, and in particular to circCDYL2 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation.We have found that circCDYL2 is likely to become the potential target spot for the treatment of of nasopharyngeal carcinoma for the first time.The present invention uses antisense oligonucleotides (antisense oligonucleotide, ASO) circCDYL2 is interfered for the splicing site implementation sequence at circular rna headtotail, scratch Healing Experiments, matrigel invasion experiment are carried out in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2, relative to NC group, the invasion of ASO group cell and transfer ability obviously weaken, i.e. silencing circCDYL2 inhibits the invasion of nasopharyngeal carcinoma cell to shift.Inhibit circCDYL2 that can treat nasopharyngeal carcinoma, there is far-reaching clinical meaning and important popularization and application foreground.

Description

CircCDYL2 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation
Technical field
The invention belongs to oncomolecularbiology technical fields, and in particular to a kind of inhibition circular rna circCDYL2 table The reagent that reaches and its preparing the application in treatment of nasopharyngeal carcinoma preparation.
Background technique
Nasopharyngeal carcinoma (Nasopharyngeal carcinoma, NPC) is a kind of malignant tumour of high transfer, is had different Pathogenesis and Histopathologic appearance.Genetic predisposition, epigenetic, race is derivative, geographical distribution, environmental factor and EBV Virus infection leads to that NPC's is pernicious.Nasopharyngeal carcinoma has apparent provincial characteristics, the disease in Southeast Asia especially south China and north African Example occupies the majority.The therapeutic strategy of NPC is mainly that radiotherapy is aided with chemotherapy.Although 5 years overall survivals of early stage NPC patient are up to 95%, but nasopharynx and Neck Recurrence rate are 8.6%~23.7%.This is because the occurrence and development of NPC are related to complexity Gene regulation and multistage process, molecular mechanism is unclear, individual difference caused by Tumor Heterogeneity and radiotherapy are resisted in addition Different, the therapeutic effect of conventional radiotheraphy is not unusual ideal.Therefore, the molecule of the therapeutic targets of research treatment nasopharyngeal carcinoma and diagnosis Marker is most important.
Circular rna (Circular RNA, circRNA) is mainly derived from the exon 1 of protein coding gene, can also To be formed by the antisense site for including sub-district, the area UTR, intergenic region, non-coding RNA site and known transcript.CircRNA is Do not have 5 ' ends by one kind that Pre-mRNA (precursor messenger RNA, pre-mRNA) is reversely spliced to form Cap and 3 ' end poly (A) tails and the non-coding RNA molecule that circular lasso structure is formed with covalent bond.
CircRNA forming process can be divided into two major classes, i.e. exon cyclisation is (exon circularization) and interior Containing the big mechanism of subring (intron circularization) two.CircRNA (the exonic in the proposition such as Jeck exon source CircRNA, ecircRNA) lasso trick driving cyclisation (lariat-driven circularization) and introne can be divided into Pairing driving cyclisation (intron-pairing-driven circularization) two kinds of generation types, lasso trick driving cyclisation It is exon 3 ' it holds as 5 ' end acceptor splicing site (splice receptor) of donor splicing site (splice donor) attack, the area Alu Covalent bond and form lasso structure, excision introne forms circRNA after lasso structure carries out internal splicing;Introne pairing Driving cyclisation is to wipe out introne after two introne base pair complementarities form cyclic structure and form circRNA.It includes in fact Son can also be cyclized itself, can form introne source circRNA (circular intronic RNA, ciRNA). CircRNA is that one kind for being reversely spliced to form by Pre-mRNA does not have 5 ' end cap and 3 ' end poly (A) tails are simultaneously The non-coding RNA molecule of the closed ring structure formed in the form of covalent bond.There are the stability, conservative, specificity of height, And the high feature of content.
CircRNA most had found that subsequent Hsu MT et al. uses electron microscope skill for the first time early in 1976 in RNA virus Art has found the presence of circRNA in the nephrocyte matter of monkey.More and more circRNA are found in recent years, so far Known circRNA number has reached more than 30,000.CircRNA is also no longer regarded as the rna transcription sheet of mistake, but makees It rises up slowly for the dazzling star in non-coding RNA research.It was found that more novel circRNA are as diagnosing tumor and prognosis Biomarker and its application, and the protection that can be got well as early as possible in patent field can be obviously improved China in the technical field International competitiveness.
We detect that a length is the circCDYL2 of 592bp.It is found through experiments that the circular rna in nasopharyngeal carcinoma Height expresses and the invasion of nasopharyngeal carcinoma can be promoted to shift, it is possible to as nasopharyngeal carcinoma diagnosis marker, and the target spot for the treatment of.
Summary of the invention
Present invention finds the circCDYL2 of a size 592bp, and have found its existing pass between nasopharyngeal carcinoma System, it is possible to the target spot as nasopharyngeal carcinoma diagnosis marker and treatment.
The first purpose of the invention is to provide a kind of reagents of inhibition circular rna circCDYL2 expression to treat in preparation Application in nasopharyngeal carcinoma preparation, the circular rna circCDYL2 sequence is as shown in SEQ ID NO.1.
Further, the reagent of inhibition circular rna circCDYL2 expression includes but is not limited to that (antisense is few by ASO Nucleotide antisense oligonucleotide).
Further, the ASO is preferably as follows:
Positive-sense strand (5'-3') GAGAACGGGCUCGGUUGAAAUU
Antisense strand (5'-3') UUUCAACCGAGCCCGUUCUCUU;
But it is not limited to above-mentioned specific ASO.
Further, the reagent of inhibition circCDYL2 expression further includes negative control:
Positive-sense strand (5'-3') GAGAACGGGAUAGCAUCGACUU
Antisense strand (5'-3') GUCGAUGCUAUCCCGUUCUCUU,
But it is not limited to above-mentioned specific negative control.
A second object of the present invention is to provide a kind of preparations for treating nasopharyngeal carcinoma, including inhibit circular rna The reagent of circCDYL2 expression, the circular rna circCDYL2 sequence is as shown in SEQ ID NO.1.
Further, the reagent of inhibition circular rna circCDYL2 expression includes singly being not limited to ASO.
Further, the ASO is preferably as follows:
Positive-sense strand (5'-3') GAGAACGGGCUCGGUUGAAAUU
Antisense strand (5'-3') UUUCAACCGAGCCCGUUCUCUU;
But it is not limited to above-mentioned specific ASO.
Further, the reagent of inhibition circCDYL2 expression further includes negative control:
Positive-sense strand (5'-3') GAGAACGGGAUAGCAUCGACUU
Antisense strand (5'-3') GUCGAUGCUAUCCCGUUCUCUU,
But it is not limited to above-mentioned specific negative control.
Treatment of nasopharyngeal carcinoma preparation of the present invention further includes reagent needed for transfection ASO.
Currently, ASO has evolved into the important tool of gene functional research.Occur to probe into circCDYL2 in tumour Developing effect, the present invention devise a pair of of ASO according to the splicing site of circCDYL2, will using Hiperfect reagent ASO and siNC (control) transiently transfects the expression of the silencing circCDYL2 into HONE1, HNE2 and CNE2 cell line.It transfects subsequent 36 hours collection cells of continuous culture, using the expression of Real-Time Fluorescent Quantitative PCR Technique detection circCDYL2 to detect ASO Transfection efficiency, it is found that the ASO of design can significantly inhibit the expression of circCDYL2.
The present invention confirms above-mentioned conclusion by largely testing: i.e. the reagent of inhibition circCDYL2 expression can be used in making Standby treatment of nasopharyngeal carcinoma preparation.These tests include: that external overexpression circCDYL2 test discovery can promote nasopharyngeal carcinoma cell to invade And migration, external silencing circCDYL2 then inhibit the invasion and migration of nasopharyngeal carcinoma cell.
Since ASO has good silencing efficiency, the present invention is used to be set for the splicing site at circular rna headtotail Meter ASO is interfered (silencing circRNA, on linear RNA without influence) to circCDYL2, in Nasopharyngeal Carcinoma Cell Line Scratch Healing Experiments, matrigel invasion experiment are carried out in HONE1, HNE2 and CNE2, relative to NC (control) group, ASO group cell Invasion and transfer ability obviously weaken, i.e. silencing circCDYL2 inhibits the invasion of nasopharyngeal carcinoma cell to shift.Inhibit CircCDYL2 can treat nasopharyngeal carcinoma, have far-reaching clinical meaning and important popularization and application foreground.
Detailed description of the invention
Fig. 1 is that the expression of the circCDYL2 shown in RNA sequencing and qRT-RCR are detected in Nasopharyngeal Carcinoma Cell Line The expression of circCDYL2;
Left figure N is non-tumour nasopharyngeal epithelium tissue, and sample number is 3;T is tissues of nasopharyngeal carcinoma, and sample number is 10, and n is Sample size, is all made of t inspection, and P < 0.05 has statistical significance;CircCDYL2 is detected in right figure in Nasopharyngeal Carcinoma Cell Line Expression, NP69 be immortalize normal nasopharyngeal epithelial cell, as reference, remaining is Nasopharyngeal Carcinoma Cell Line.
Fig. 2 is the sequencing of Sanger method;
A.circCDYL2 is spliced to form by the 2 exons head and the tail of CDYL2, and E indicates exon (exon), underscore sequence Column indicate the joint sequence of head and the tail;The schematic diagram that b.circRNA is formed;C. the peak figure of sequencing result, black arrow are indicated from this Locate headtotail.
Fig. 3 is that caryoplasm separates positioning of the RNA experiment detection circCDYL2 in cell;
Using the RNA in caryoplasm separating kit extracting nasopharyngeal carcinoma cell, using GAPDH as the internal reference of cytoplasm, U6 is cell The internal reference of core, circCDYL2 about 70% is located in core as the result is shown, and 30% is located in cytoplasm.
Fig. 4 is the silence efficiency that qRT-PCR technology detects circCDYL2ASO in Nasopharyngeal Carcinoma Cell Line;
The silence efficiency of a.qRT-PCR detection circCDYL2ASO in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2, CircCDYL2 expression is analyzed using β-actin as reference;B. it is transfected in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 After ASO, the expression of linear rna is detected, ns represents meaningless, P < 0.001 * P < 0.05, * * P < 0.01, * * *.
Fig. 5 is the plasmid map of over-express vector;
Fig. 6 is that qRT-PCR detects circCDYL2 overexpression efficiency;
Detection circCDYL2, which is tested, with qRT-PCR in HONE1, HNE2 and CNE2 cell line is overexpressed efficiency, CircCDYL2 expression is analyzed using β-actin as reference, and pcDNA3.1 group is standardized as 1, * P < 0.05, and * * P < 0.01,***P<0.001。
Fig. 7 is the influence that external silencing circCDYL2 is proliferated nasopharyngeal carcinoma cell;
NC, ASO circCDYL2 are transiently transfected in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 hiperfect, after Continuous culture carries out MTT experiment after 24 hours and detects ability of cell proliferation, by NC group be standardized as 1, ns represent it is nonsensical, * P < 0.05,**P<0.01,***P<0.001。
Fig. 8 is the external influence for being overexpressed circCDYL2 and being proliferated to nasopharyngeal carcinoma cell;
PcDNA3.1, circCDYL2 are transiently transfected in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 hiperfect, MTT experiment detection ability of cell proliferation is carried out after continuing culture 24 hours, pcDNA3.1 group, which is standardized as 1, ns representative, not to be had Meaning, P < 0.001 * P < 0.05, * * P < 0.01, * * *.
Fig. 9 is the influence that silencing circCDYL2 invades nasopharyngeal carcinoma cell;
With matrigel invasion test simulation cell pass through matrix barrier, in HONE1, HNE2 and CNE2 cell transfect NC, After ASO 24 hours, the influence that detection silencing circCDYL2 invades nasopharyngeal carcinoma cell is tested with matrigel invasion, wherein right figure For the statistical chart of number of cells, NC mark is turned into 1, * P < 0.05, P < 0.001 * * P < 0.01, * * *.
Figure 10 is the influence for being overexpressed circCDYL2 and invading to nasopharyngeal carcinoma cell;
Simulation cell is tested with matrigel invasion and passes through matrix barrier, is transfected in HONE1, HNE2 and CNE2 cell After pcDNA3.1, circCDYL2 24 hours, detection overexpression circCDYL2 is tested with matrigel invasion, nasopharyngeal carcinoma cell is invaded The influence attacked, wherein right figure is the statistical chart of number of cells, and pcDNA3.1 is marked and turns to 1, * P < 0.05, * * P < 0.01, * * * P < 0.001。
Figure 11 is influence of the external silencing circCDYL2 to nasopharyngeal carcinoma cell scratch healing ability;
After transfecting NC, ASO in HONE1, HNE2 and CNE2 cell, the scratch after cell density reaches 100%, according to thin Born of the same parents' healing rate is put take pictures in different times, and lower section is the statistical chart of scratch width, and NC is marked and turns to 1, * P < 0.05, and * * P < 0.01,***P<0.001。
Figure 12 is the influence for being overexpressed circCDYL2 to nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 scratch healing ability;
After transfecting pcDNA3.1, circCDYL2 in HONE1, HNE2 and CNE2 cell, reach 100% to cell density Scratch afterwards is put in different times according to cell healing rate and takes pictures, and lower section is the statistical chart of scratch width, and pcDNA3.1 is marked Turn to 1, * P < 0.05, P < 0.001 * * P < 0.01, * * *.
Specific embodiment
It is intended to further illustrate the present invention below in conjunction with specific embodiment, is not intended to limit the present invention.
The Nasopharyngeal Carcinoma Cell Lines such as HONE1, HNE2, CNE2 used in the present invention are Tumour Inst., Zhongnan Univ.'s molecular genetic Laboratory is saved.Cell culture condition are as follows: 10% fetal calf serum (FBS) and 1% dual anti-(penicillin, streptomysin) RPMI1640 fluid nutrient medium, 37 DEG C, 95% humidity, 5%CO2Adherent growth in the constant incubator of concentration.
The primer of circular rna of the present invention is different from the design of linear rna primer, is designed according to splicing site two sides, Photographing On-line on the website Primer3.0, final primer synthetic work, commission Qing Ke biotech firm Changsha combining unit synthesis.
(1)β-actin
Upstream primer: 5 '-TCACCAACTGGGACGACATG-3 ', as shown in SEQ ID NO.2,
Downstream primer: 5 '-GTCACCGGAGTCCATCACGAT-3 ', as shown in SEQ ID NO.3,
(2) circular rna circCDYL2 real-time quantitative PCR primer
Upstream primer: 5 '-CCTGGCTTGGATTTGAATGA-3 ', as shown in SEQ ID NO.4,
Downstream primer: 5 '-CTCCCGTAGCCTTTCCATC-3 ', as shown in SEQ ID NO.5,
(3) circCDYL2 overall length primer is expanded
Upstream primer: 5 '-CGCATCGATGTTGAAAGGATTGTAGACAAGAGG-3 ', as shown in SEQ ID NO.6,
Downstream primer: 5 '-AATCCGCGGCGAGCCCGTTCTCCGC-3 ', as shown in SEQ ID NO.7,
The present invention expresses to specifically strike low circular rna without influencing its glm gene, is designed according to splicing site ASO (antisense oligonucleotides), targeted silent circCDYL2.
CircCDYL2ASO sequence:
Positive-sense strand (5'-3') GAGAACGGGCUCGGUUGAAAUU, as shown in SEQ ID NO.8,
Antisense strand (5'-3') UUUCAACCGAGCCCGUUCUCUU, as shown in SEQ ID NO.9.
Negative control:
Positive-sense strand (5'-3') GAGAACGGGAUAGCAUCGACUU, as shown in SEQ ID NO.10,
Antisense strand (5'-3') GUCGAUGCUAUCCCGUUCUCUU, as shown in SEQ ID NO.11.
Test result of the present invention is all made of statistical analysis: t, which is examined, to be used to evaluate the difference between two groups.Chi-square Test is used To assess gene expression or not express in terms of the clinical parameters such as gender, age, tumor stage, clinical stages and transfer case Difference.For indicating significance,statistical, all p values use two-sided test for p < 0.05.Statistical analysis uses 13.0 He of SPSS 5.0 software of Graphpad carries out.
Expression of the embodiment 1:circCDYL2 in nasopharyngeal carcinoma cell
1, cell total rna extracts
Preparation: after sterilizing without RNase water, 75% ethyl alcohol (no RNase prepare), chloroform, isopropanol, 1 × PBS, No enzyme tip are managed with EP, and high speed low temperature centrifugal machine is cooled to 4 DEG C in advance, and experiment will first test table top and liquid-transfering gun with 75% before starting Alcohol wipe.
(1) cell for taking RNA to be extracted, is cleaned twice with 1 × PBS or D-hanks;
Every hole adds 500 μ l Trizol lysates in (2) 12 orifice plates, lysis at room temperature 1-2 minutes, is gently blown down with liquid-transfering gun Cell, upper and lower gentle inversion 10 times are stored at room temperature 5 minutes;
(3) chloroform (pressing 1mlTrizol:0.2ml chloroform: 0.5ml isopropanol) of 100 μ l is added, firmly shakes 15-30s, It places 5 minutes on ice;
(4) 4 DEG C, 12000rpm/20min;
(5) it takes upper strata aqueous phase in the Tube pipe of pre-cooling, 250 μ l isopropanols is added, it is mixed with eddy mixer or liquid-transfering gun Even (- 20 DEG C > 1h);
(6) 4 DEG C, 12000rpm/30min, abandon supernatant;
(7) 75% ethyl alcohol (pre-cooling) 1ml is added, mixes;
(8) 4 DEG C, 7600rpm/5min;Abandoning supernatant, repetition step 8,9;
(9) it dodges from 10s, as far as possible exhaustion supernatant, is inverted 10 minutes dry;
(10) 20-30 μ l DEPC is added, surveys RNA concentration and OD value.
2, circRNA reverse transcription PCR reacts
(according to 5 × All-In-OneRTMasterMix of abm company (withAccuRTGenomicDNARemovalKit) The description of test handbook of (#G492) operates)
Configure following reaction system:
Machine response procedures are as follows on reverse transcription PCR:
25 DEG C of 10min,
42 DEG C of 15min,
85℃ 5min。
To which after reaction, -20 DEG C of preservation products are spare.
3, real-time fluorescence quantitative PCR
Reverse transcription reaction product is first diluted 5 times, then according to abm company EvaGreen qPCR MasterMix (MasterMix-R) description of test handbook operation, configures following reaction system:
Response procedures are as follows on real-time fluorescence quantitative PCR machine: (Cycle × 39)
Bio-RadIQ5 real-time fluorescence quantitative PCR instrument carry out it is above-mentioned after the reaction was completed, and reference gene β-actin markization, With the relative expression quantity of 2- Δ Δ CT value displaying target gene, the differential expression of gene is determined.It is examined using unpaired t-test It tests and calculates P value.
As a result: the expression of circCDYL2 is apparently higher than normal nasopharyngeal epithelial cell NP69 (result is shown in figure in nasopharyngeal carcinoma cell 1).Therefore, circCDYL2 high expression, circCDYL2 in Nasopharyngeal Carcinoma Cell Line may have weight to the occurrence and development of nasopharyngeal carcinoma The biological function wanted can carry out nasopharyngeal carcinoma diagnosis accordingly.
What embodiment 2:sanger sequencing proved to be formed is circular rna
In order to prove circCDYL2 formed be circular rna and it is nonlinear, by figure one qRT-PCR product recycle, Company is sent to carry out sanger sequencing (Qing Ke company).The sequence that company returns is compared with DNASTAR software, chromas Software sees peak figure, judges the quality of sequencing.The results show that circCDYL2 is strictly to be shown by 2,3 extras of female Gene A RHGAP12 Sub- headtotail is cyclized to be formed.A.circCDYL2 is spliced to form by 2, the 3 exons head and the tail of ARHGAP12, and E indicates exon (exon), underlined sequences indicate the joint sequence of head and the tail;The schematic diagram that b.circRNA is formed;C. the peak figure of sequencing result, Black arrow indicates headtotail from there (see Fig. 2).
Embodiment 3: caryoplasm separates the positioning of RNA detection circCDYL2 in the cell
Since ASO plays a role mainly in cytoplasm, can the positioning of detection circCDYL2 can determine whether fine The expression of ground interference circCDYL2.Nucleus and cytoplasmic RNA are separated using caryoplasm separating kit, then with real-time Fluorescence quantitative PCR detection circCDYL2 expresses shared specific gravity in core, matter.Using GAPDH as the internal reference of cytoplasm, U6 is cell The internal reference of core, distribution of the circCDYL2 in core, matter respectively accounts for 50% (see Fig. 3) as the result is shown.
Core, matter RNA are extracted:
1,10 are received7A cell, pancreatin digestion, 10%FBS terminate digestion, and PBS is washed one time, is centrifuged, is placed on ice;
2, the Cell Fractionation Buffer of 100-500ul is added, gently blows and beats, prevents karyorrhexis;
3, it is incubated for 5-10min on ice;
4,4 DEG C of centrifugations, 1-5min (upper layer is cytoplasmic compartment, and lower layer is nuclear fractions);
5, upper layer is sucked out to a new EP and is managed, be placed in (being in next step step 8, cytoplasmic compartment) on ice;
6, addition and the isometric Cell Fractionation Buffer of step 2 in former EP pipe, mild resuspension, 4 DEG C centrifugation, 500g/ minute (can repeat once);
7, the Cell Disruption Buffer with the pre-cooling of the medium volume of step 2 is added, acutely shakes, piping and druming mixes As on ice;
8, isometric 2X Lysis/Binding Buffer (room temperature) is added, piping and druming mixes immediately, if mixture is excessively It is sticky.It can be homogenized;
9,100% ethyl alcohol with the medium volume of step 8 is added, piping and druming mixes immediately;
10, mixture is moved to (in filter-collecting pipe), one time maximum volume 700ul, 12000rpm are centrifuged 30s, abandon Waste liquid;
11,700ul Wash Solution I is washed once, and 12000rpm is centrifuged 30s, abandons waste liquid;
12,500ul Wash Solution 2/3 is washed once, and 12000rpm is centrifuged 30s, abandons waste liquid;
13, step 12 is repeated;
14, sky was from 30 seconds
15, Filter column a new EP is moved to manage, be added the Elution Solution, 12000rpm of 40ul preheating from Heart 30s adds 20ul Elution Solution 12000rpm centrifugation 30s, it is spare to survey concentration.
Embodiment 4: the effect detection that silencing circCDYL2 is expressed in Nasopharyngeal Carcinoma Cell Line
Antisense oligonucleotides (ASO) is that one kind by sequence specific inhibits the base in conjunction with target gene DNA or mRNA Because of the molecule of expression.ASO is designed for splicing site and the sequence of target sequence complementation, to avoid the expression of interference linear rna. Currently, ASO has evolved into the important tool of gene functional research.In order to probe into circCDYL2 in tumor development Effect, we devise ASO according to the splicing site of circCDYL2, using Hiperfect reagent by ASO and NC (blank pair According to) transiently transfect into HONE1, HNE2 and CNE2 cell line silencing circCDYL2 expression.Continue culture 36 hours after transfection Cell is collected, the transfection efficiency of ASO is detected using the expression of Real-Time Fluorescent Quantitative PCR Technique detection circCDYL2, really Recognize circCDYL2 and strike inefficient fruit and reaches 0.5 or less (see Fig. 4 a).It is real however when linear with the sequence design of circCDYL2 primer When fluorescence quantitative PCR detection discovery ASO do not strike the expression of low linear rna, illustrate that ASO is specific silencing circCDYL2 (see Fig. 4 b).
Embodiment 5: circCDYL2 is overexpressed effect detection in Nasopharyngeal Carcinoma Cell Line
We select restriction enzyme site first, and circCDYL2 full length sequence is put into the online website NEB cutter 2.0 point Analysis, display ClaI and SacII restriction enzyme site is the site being not present in circCDYL2 full length sequence, while in pcDNA3.1 matter Single existing DNA restriction enzyme in grain carrier (being purchased from Sheng Gong bio-engineering corporation).By circCDYL2 full length sequence gram Grand unloaded into pcDNA3.1 plasmid, Fig. 5 is the over-express vector map drawn.
In order to detect the cyclic efficiency of circCDYL2, we are by the pcDNA3.1/circCDYL2 eukaryon mistake of building first Expression vector is overexpressed in nasopharyngeal carcinoma cell.Good third and fourth generation nasopharyngeal carcinoma cell HONE1 of upgrowth situation, HNE2 and CNE2 kind is into 12 orifice plates, when cell fusion degree reaches 60%-80%, with liposome method lipofectamine 3000 endotoxin-free plasmid pcDNA3.1 empty carriers and pcDNA3.1/circCDYL2 over-express vector transiently transfect nasopharyngeal carcinoma Cell HONE1, HNE2 and CNE2 are continued culture to 36h and collect cell, detected using Real-Time Fluorescent Quantitative PCR Technique The expression of circCDYL2 and cyclic efficiency.QPCR turns the results show that compared with pcDNA3.1 empty plasmid group cell The expression that pcDNA3.1/circCDYL2 is overexpressed circCDYL2 in the cell of plasmid group significantly increases, and as a result has system Meter learns meaning (see Fig. 6).
Embodiment 6:MTT experiment detection cell Proliferation
We transfect NC, ASO circCDYL2 with hiperfect first, or use liposome method accordingly Lipofectamine 3000 instantaneously turns endotoxin-free plasmid pcDNA3.1 and pcDNA3.1/circCDYL2 over-express vector Nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 are contaminated, after continuing culture for 24 hours, MTT experiment is carried out, verifies the shadow of its cell proliferation It rings.As a result, it has been found that ASO circCDYL2 can significantly inhibit the proliferation of three plants of cell line, and it is overexpressed circCDYL2 and remarkably promotes The proliferation (result see Fig. 7,8) of three plants of cell line
(1) prepare: Tip, the D-hanks of autoclave sterilization;Liquid-transfering gun, marker, the alcohol such as 15ml centrifuge tube Ultraviolet irradiation 30min in Biohazard Safety Equipment is placed on after disinfection again, divulge information 10min.
(2) plant plate and transfection: the previous day is by 25cm2Cell dissociation in good condition in cell bottle, which gets off, plants 6 orifice plates, Table was transfected to cell density length to 70% or so transfection NC, ASO circCDYL2, or to cell length to 80~90% or so Up to carrier.
(3) it after transfecting 12 hours, inhales and abandons cell conditioned medium, D-hanks is washed 3 times, and 100 μ l pancreatin, digestion is added in the every hole of 6 orifice plates After cell is rounded, cell is blown and beaten and is transferred to 15ml centrifuge tube, 1000rpm is centrifuged 5min, abandons supernatant, and 1~2ml is added Pei Ji is mixed, and is taken 10 μ l that cell counting board is added and is carried out cell count.According to cell counts, cell is diluted to 5000 A cell/ml.
(4) 96 orifice plates are added in the cell suspension diluted, 200 μ l of cell suspension, the outermost circle of 96 orifice plates is added in every hole 200 μ l Dank ' s buffer of Kong Zhongjia, is put into incubator and continues to cultivate.
(5) after 6~8h or so cell is adherent, 20 μ l MTT are added in every hole, continue culture 4 hours, and careful inhale is abandoned in hole Culture supernatant, every hole is added 200 μ l DMSO, is placed on shaking table and rocks 10min, select on enzyme-linked immunosorbent assay instrument The light absorption value of 490nm wavelength detecting DMSO well records result.Later daily at the same time point plus MTT and DMSO into The detection of row light absorption value, continuous detection carried out statistical analysis after 6 days.
Embodiment 7: cell transwell Matrigel:
(1) matrigel prepares: mentioning the previous day is placed in 4 DEG C of refrigerators in -20 DEG C of BD Matrigel glue and is melted into liquid freezing Tip head, the EP pipe of dilution glue are placed in -20 DEG C overnight by state, and Matrigel glue will not when spreading glue when operation in such second day Too fast solidification;
(2) matrigel dilutes: BD Matrigel glue: anteserum-less substrate=1:8, i.e. 20 μ l matrigels add 160 μ l 1640 Base featheriness is trained to mix;
(3) 100 μ l of the cell transwell is added in the matrigel diluted, then 80 μ l is sucked out along side, successively completed and be put into It is incubated for 2-3 hours in 37 DEG C of incubators, when it is white for seeing paving glue-line, shows that liquid Matrigel glue has been in solid-state;
(4) cell after digestion transfection for 24 hours is washed 2 times with anteserum-less substrate, then outstanding thin using the training base weight of serum-free Born of the same parents, carry out cell count, and adjustment cell concentration is 20,000 cells in every 200 μ l;
(5) 1640 culture mediums that 800 μ l contain 20%FBS are added to bottom chamber, tilts 24 orifice plates when being put into cell 45° angle generates bubble to avoid being put into during cell between cell and liquid level;
(6) every room adds 200 μ l to count indoor on the cell suspension to transwell of number, and 24 orifice plates are put back to 37 DEG C of cultures In case, according to cell state and cell invasion speed, it is incubated for about 24~48h.
(7) 24 orifice plates are taken out, are washed twice with PBS or D-hanks, 4% paraformaldehyde embathes 10min, washes 3 with clear water Time.
(8) it dyes: being added drop-wise to the bottom of the cell transwell with 0.1% crystal violet, be stored at room temperature 5-10min, use PBS is cleaned 2-3 times, and the matrigel above cell is carefully wiped with cotton swab;
(9) it is added in 800 μ l, transwell upper chamber of distilled water in 24 orifice plates and about 200 μ l of distilled water is added, then existed Under inverted microscope, optional 5 different visuals field are taken pictures, and count with image J software aobvious with statistical analysis difference Work property.
The expression of external silencing circCDYL2 influences the invasion of nasopharyngeal carcinoma
In order to probe into after silencing circCDYL2 the invasion that whether can influence nasopharyngeal carcinoma, we are again in three plants of cell lines The experiment of the cell Transwell matrigel invasion is carried out, using Hiperfect reagent by circCDYL2ASO and NC (blank pair According to) transiently transfect into HONE1, HNE2 and CNE2 cell line silencing circCDYL2 expression.Silencing circCDYL2's Matrigel invasion experiment in the cell Transwell is carried out in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2, the results show that ASO group The tumor cell number that can be observed in the small chamber lower surface of Transwell is considerably less than NC group, and three plants of cell line results become Gesture is consistent.Random shooting 5 opens photo and records cell number, has notable difference between two group data in each cell line, and With statistical significance.The above result shows that in silencing Nasopharyngeal Carcinoma Cell Line circCDYL2 expression, be able to suppress nasopharyngeal carcinoma The invasive ability of cell HONE1, HNE2 and CNE2 in vitro (result is shown in Fig. 9).
The external invasion for being overexpressed circCDYL2 and promoting nasopharyngeal carcinoma cell
We have carried out the experiment of the cell Transwell matrigel invasion in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2, The influence for being overexpressed circCDYL2 to cell invasion ability is observed.We are also with liposome method lipofectamine 3000 endotoxin-free plasmid pcDNA3.1 and pcDNA3.1/circCDYL2 over-express vectors transiently transfect nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 continue to cultivate to after 48 hours.Cell is collected, is detected using Real-Time Fluorescent Quantitative PCR Technique The expression of circCDYL2 and cyclic efficiency.After being determined that circCDYL2 is overexpressed the overexpression good result of plasmid, We seed cells into the cell Transwell of paving matrigel, and discovery is overexpressed under the cell invasion to cell of plasmid group The number on surface is obviously more than zero load group, and the trend of three plants of cell line results is consistent.Random shooting 3 opens photo and records cell Number has notable difference in each cell line, and has statistical significance between two group data.The above result shows that crossing table Up to the expression of circCDYL2 in Nasopharyngeal Carcinoma Cell Line, nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 invading in vitro can be promoted Attack ability.It is proved by positive and negative both direction, circular rna circCDYL2 can promote the invasion of nasopharyngeal carcinoma cell, and (result is shown in figure 10)。
Embodiment 8: the healing migration experiment of cell scratch:
(1) photo cell platform: the D-Hank ' s of 1000 μ l/10 μ l Tip, autoclave sterilization, ruler, 1000 μ l/10 μ l Liquid-transfering gun, marker etc., ultraviolet irradiation 30 minutes in super-clean bench are placed on after disinfecting in alcohol again;
(2) ASO and NC group or transfected plasmids are transfected respectively to cell length to 50%~70% or so;
(3) 10 μ l pipette tips second day beginning scratch after cell covers with tiling board bottom: are compared into ruler perpendicular to 6 orifice plates bottom Portion simply quickly carries out cross or well stroke trace, not tilt, strength is consistent, to ensure that scratch width is as consistent as possible;
(4) it inhales and abandons culture solution, gently washed with D-hanks 3 times, wash off the patched cell due to caused by scratch as far as possible;
(5) 1640 culture mediums of 1% dual anti-2% fetal calf serum are added;
(6) scratch width beside cross at this time is photographed to record, 0h is denoted as;
(7) 6 orifice plates are put back into incubator culture, interval 12h shoots same position, is denoted as 12h;
(8) same position is clapped again when being spaced for 24 hours, until scratch healing, arranges all pictures, and for statistical analysis.
External silencing circCDYL2 inhibits the migration of nasopharyngeal carcinoma cell
ASO and NC is transiently transfected into the silencing into HONE1, HNE2 and CNE2 cell line using Hiperfect reagent The expression of circCDYL2.It is real that scratch is carried out in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 of silencing circCDYL2 It tests, verifies its influence to cell migration.Multiple time points of the scratch Healing Experiments in these cells confirm: relative to NC The transfer ability of group, ASO group cell obviously weakens.Scratch width difference is obvious, and has statistical significance.Result above is aobvious Show, the expression of circCDYL2 in silencing Nasopharyngeal Carcinoma Cell Line is able to suppress nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2 in vitro Transfer ability (the result is shown in Figure 1 1).
The external migration for being overexpressed circCDYL2 and promoting nasopharyngeal carcinoma cell
Using liposome method lipofectamine 3000 endotoxin-free plasmid pcDNA3.1 and pcDNA3.1/has_ CircCDYL2 over-express vector transiently transfects nasopharyngeal carcinoma cell HONE1, HNE2 and CNE2.CircCDYL2 overexpression is being determined After the overexpression good result of plasmid, we have carried out the healing of cell scratch in fact in Nasopharyngeal Carcinoma Cell Line HONE1, HNE2 and CNE2 It tests.Multiple time points of the scratch Healing Experiments in these cells confirm: relative to unloaded pcDNA3.1 (+) plasmid group, The transfer ability that pcDNA3.1/circCDYL2 is overexpressed plasmid group cell is remarkably reinforced.Scratch width differs greatly, and has Statistical significance.The above results show that being overexpressed the expression of circCDYL2 in Nasopharyngeal Carcinoma Cell Line, nasopharyngeal carcinoma can be promoted thin The transfer ability of born of the same parents HONE1, HNE2 and CNE2 in vitro.Being verified by positive and negative both direction proves, circCDYL2 can promote The migration (the result is shown in Figure 1 2) of nasopharyngeal carcinoma cell.
Sequence table
<110>Central South University
<120>circCDYL2 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 592
<212> RNA
<213>homo sapiens (Homo sapiens)
<400> 1
aaaaggguau ucaggcaagc ccucuucagg aggugacagg gccaccaaga cggugucuua 60
caggacuacc cccagugguu ugcaaauaau gccccugaaa aagucucaga acgggaugga 120
aaauggggac gccggcucug agaaggauga gaggcacuuu ggaaaugggu cccaucagcc 180
uggcuuggau uugaaugauc auguuggaga gcaagauaug ggugaaugug acgugaauca 240
cgcuacacug gcggagaacg ggcucgguug aaaggauugu agacaagagg aagaacaaga 300
aaggaaaaug ggaguaucuu auccgaugga aaggcuacgg gagcaccgag gacacguggg 360
agccggagca ccaccucuug cacugugagg aguuuauuga ugaauucaau ggguugcaca 420
uguccaagga caagaggauc aagucaggga agcaguccag uaccuccaag cugcugcgug 480
acagucgagg cccgucgguu gagaaacugu cccacagacc uucagauccu ggaaagagca 540
aggggaccuc ccauaaacgg aagcgaauua acccuccccu ggccaagcca aa 592
<210> 2
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 2
tcaccaactg ggacgacatg 20
<210> 3
<211> 21
<212> DNA
<213>unknown (Unknown)
<400> 3
gtcaccggag tccatcacga t 21
<210> 4
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 4
cctggcttgg atttgaatga 20
<210> 5
<211> 19
<212> DNA
<213>unknown (Unknown)
<400> 5
ctcccgtagc ctttccatc 19
<210> 6
<211> 33
<212> DNA
<213>unknown (Unknown)
<400> 6
cgcatcgatg ttgaaaggat tgtagacaag agg 33
<210> 7
<211> 25
<212> DNA
<213>unknown (Unknown)
<400> 7
aatccgcggc gagcccgttc tccgc 25
<210> 8
<211> 22
<212> RNA
<213>unknown (Unknown)
<400> 8
gagaacgggc ucgguugaaa uu 22
<210> 9
<211> 22
<212> RNA
<213>unknown (Unknown)
<400> 9
uuucaaccga gcccguucuc uu 22
<210> 10
<211> 22
<212> RNA
<213>unknown (Unknown)
<400> 10
gagaacggga uagcaucgac uu 22
<210> 11
<211> 22
<212> RNA
<213>unknown (Unknown)
<400> 11
gucgaugcua ucccguucuc uu 22

Claims (8)

1. inhibiting application of the reagent of circular rna circCDYL2 expression in preparation treatment nasopharyngeal carcinoma preparation, the ring-type RNA circCDYL2 sequence is as shown in SEQ ID NO.1.
2. application according to claim 1, which is characterized in that the examination for inhibiting circular rna circCDYL2 expression Agent includes antisense oligonucleotides.
3. application according to claim 2, which is characterized in that the antisense oligonucleotides is as follows:
Positive-sense strand (5'-3') GAGAACGGGCUCGGUUGAAAUU
Antisense strand (5'-3') UUUCAACCGAGCCCGUUCUCUU.
4. application according to claim 2, which is characterized in that the reagent of the described inhibition circCDYL2 expression further includes Negative control:
Positive-sense strand (5'-3') GAGAACGGGAUAGCAUCGACUU
Antisense strand (5'-3') GUCGAUGCUAUCCCGUUCUCUU.
5. a kind of preparation for treating nasopharyngeal carcinoma, which is characterized in that the reagent including inhibiting circular rna circCDYL2 expression, institute The circular rna circCDYL2 sequence stated is as shown in SEQ ID NO.1.
6. the preparation for the treatment of nasopharyngeal carcinoma according to claim 5, which is characterized in that the inhibition circular rna The reagent of circCDYL2 expression includes antisense oligonucleotides.
7. the preparation for the treatment of nasopharyngeal carcinoma according to claim 5, which is characterized in that the antisense oligonucleotides is as follows:
Positive-sense strand (5'-3') GAGAACGGGCUCGGUUGAAAUU
Antisense strand (5'-3') UUUCAACCGAGCCCGUUCUCUU.
8. the preparation for the treatment of nasopharyngeal carcinoma according to claim 5, which is characterized in that the inhibition circCDYL2 expression Reagent further include negative control:
Positive-sense strand (5'-3') GAGAACGGGAUAGCAUCGACUU
Antisense strand (5'-3') GUCGAUGCUAUCCCGUUCUCUU.
CN201910162070.XA 2019-03-05 2019-03-05 CircCDYL2 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation Pending CN109701025A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910162070.XA CN109701025A (en) 2019-03-05 2019-03-05 CircCDYL2 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910162070.XA CN109701025A (en) 2019-03-05 2019-03-05 CircCDYL2 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation

Publications (1)

Publication Number Publication Date
CN109701025A true CN109701025A (en) 2019-05-03

Family

ID=66266159

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910162070.XA Pending CN109701025A (en) 2019-03-05 2019-03-05 CircCDYL2 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation

Country Status (1)

Country Link
CN (1) CN109701025A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108660215A (en) * 2018-05-28 2018-10-16 中南大学 Detect application and the kit of circMAN1A2 and circRNF13 reagents
CN108721319A (en) * 2018-05-28 2018-11-02 中南大学 Inhibit application and preparation of the reagent of circ_CLASP2 in preparing treatment of nasopharyngeal carcinoma preparation
CN109666674A (en) * 2019-03-04 2019-04-23 中南大学 CircCDYL2 and its preparing application and diagnostic preparation in nasopharyngeal carcinoma diagnosis preparation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108660215A (en) * 2018-05-28 2018-10-16 中南大学 Detect application and the kit of circMAN1A2 and circRNF13 reagents
CN108721319A (en) * 2018-05-28 2018-11-02 中南大学 Inhibit application and preparation of the reagent of circ_CLASP2 in preparing treatment of nasopharyngeal carcinoma preparation
CN109666674A (en) * 2019-03-04 2019-04-23 中南大学 CircCDYL2 and its preparing application and diagnostic preparation in nasopharyngeal carcinoma diagnosis preparation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
NM_157342: "hsa_circ_0004087", 《CIRCBASE》 *

Similar Documents

Publication Publication Date Title
CN108721319A (en) Inhibit application and preparation of the reagent of circ_CLASP2 in preparing treatment of nasopharyngeal carcinoma preparation
CN102782155A (en) Compositions and methods for microrna expession profiling in plasma of lung cancer
CN108660214A (en) Detect application and kit of the reagent of circ_CLASP2 in preparing nasopharyngeal carcinoma diagnosis preparation
CN109666674A (en) CircCDYL2 and its preparing application and diagnostic preparation in nasopharyngeal carcinoma diagnosis preparation
CN110066875B (en) Application of long-chain non-coding RNA lncLCIR-1 as lung cancer molecular marker
CN108034655B (en) Application of long non-coding RNA and composition thereof in diagnosis/treatment of colorectal cancer
CN107164554B (en) Application of ASPRV1 as biomarker in diagnosis and treatment of laryngeal squamous cell carcinoma
CN107312855B (en) Gene related to laryngeal squamous cell carcinoma and application thereof
CN108841955A (en) Application of the C22orf41 as Pancreatic Cancer Tumor Markers object
CN108531544A (en) A kind of method of miR-181b target genes screening
CN109971759A (en) Circ_ADARB1 and its preparing application and diagnostic preparation in nasopharyngeal carcinoma diagnosis preparation
CN105288659B (en) The application of TENM1 gene and its expression product in diagnosis and treatment papillary adenocarcinoma
Lin et al. The expression profile of miRNA in glioma and the role of miR-339-5p in glioma
CN108660211B (en) Hepatocellular carcinoma-related biomarker LINC01549 and application thereof
CN110317878A (en) A kind of long-chain non-coding RNA and its application for bladder cancer diagnosis and treatment monitoring
CN109652556A (en) CircARHGAP12 and its preparing application and diagnostic preparation in nasopharyngeal carcinoma diagnosis preparation
CN109701025A (en) CircCDYL2 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation
CN110577952B (en) Application of siRNA interfering long non-coding RNA in preparation of medicine for treating breast cancer
CN109852692A (en) Circ_3480 and its preparing application and diagnostic reagent in nasopharyngeal carcinoma diagnosis preparation
CN107893119B (en) Application of ZCCHC12 in osteosarcoma
CN107881240B (en) The diagnosis and treatment marker of osteosarcoma
CN109700825A (en) CircARHGAP12 is preparing application and treatment preparation in treatment of nasopharyngeal carcinoma preparation
CN107385081B (en) Gene related to kidney cancer and application thereof
CN107184983B (en) Diagnosis and treatment target for lung adenocarcinoma
CN105385781B (en) Application of the LCE3E in diagnosis and treatment carcinoma of mouth

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20190503