CN109908351B - Application of circ _ ADARB1 in preparation of nasopharyngeal carcinoma treatment preparation and treatment preparation - Google Patents

Abstract

The invention belongs to the technical field of tumor molecular biology, and particularly relates to application of circ _ ADARB1 in preparation of a nasopharyngeal carcinoma treatment preparation and a treatment preparation. We found for the first time that circ _ ADARB1 could be a potential target for nasopharyngeal carcinoma treatment. As the siRNA has good silencing effect, the siRNA is designed aiming at splicing sites at the head-to-tail connection of the circular RNA to interfere with the circ _ ADARB1, and a scratch healing experiment and a matrigel invasion experiment are carried out in nasopharyngeal carcinoma cell lines HNE2 and CNE2, compared with a control group, the invasion and migration capacity of cells of the circ _ ADARB1 group knocked down by the siRNA is obviously weakened, namely, the silencing circ _ ADARB1 inhibits the invasion and transfer of nasopharyngeal carcinoma cells. Shows that the inhibition of circ _ ADARB1 can treat nasopharyngeal carcinoma, and has profound clinical significance and important popularization and application prospects.

Description

Application of circ _ ADARB1 in preparation of nasopharyngeal carcinoma treatment preparation and treatment preparation

Technical Field

The invention belongs to the technical field of tumor molecular biology, and particularly relates to a reagent for inhibiting circular RNA circ _ ADARB1 and application thereof in preparation of a nasopharyngeal carcinoma treatment preparation.

Background

Circular RNA (circular RNA) is a large research hotspot, and is a non-coding RNA molecule formed by reverse splicing of pre-mRNA (pre-mRNA) and having no 5 'end cap and 3' end poly (a) tail, and forming a circular structure by covalent bonding. Has the characteristics of high stability, conservation, specificity and high content. The circRNA is mainly derived from exonic regions of the protein-coding gene, and may also be formed from intronic regions, UTR regions, intergenic regions, non-coding RNA sites and antisense sites of known transcripts.

The process of CircRNA formation can be divided into two major categories, exonic circularization (exon circularization) and intron circularization (intron circularization). Jeck et al propose that exon-derived circRNAs (exonic-driven circularization) can be divided into two forming modes of lasso-driven circularization (large-driven-circularization) and intron-paired driven circularization (intron-driven-circularization), wherein lasso-driven circularization is that the 3 'end of an exon is used as a splice donor (splice donor) to attack a 5' end splice acceptor (splice acceptor), Alu regions are covalently combined to form a lasso structure, and the lasso structure is internally spliced and then an intron is cut to form the circRNAs; intron pairing-driven circularization is the complementary pairing of two intron bases to form a circular structure, and then the intron is cut off to form a circRNA. In fact, the intron itself may be circularized, and circular RNA (circular intracellular RNA) derived from the intron may be formed.

Nasopharyngeal carcinoma (NPC) belongs to a tumor of the head and neck, originating from the epithelial tissue of the nasopharynx. Generally, the disease occurs in the posterolateral crypt (Fossa of rosenmuller) of the nasopharynx, where nasopharyngeal carcinoma cells invade adjacent tissues and organs. Because the occurrence and development of nasopharyngeal carcinoma are multi-stage complex gene regulation processes caused by accumulated familial heredity and somatic genetic mutation and epigenetic mutation, the activation and silencing of protooncogenes and cancer suppressor genes, the epigenetic regulation of ncRNA participation and the like are involved. Therefore, the specific molecular mechanism of occurrence and development of nasopharyngeal carcinoma is not clear, and the curative effect of the traditional radiotherapy and chemotherapy is not significant due to tumor heterogeneity and individual difference. Therefore, the research on occurrence and development mechanisms of the circulating RNA and the nasopharyngeal carcinoma by the circulating RNA further has important significance for diagnosing the nasopharyngeal carcinoma and controlling the proliferation, invasion and metastasis of the nasopharyngeal carcinoma.

We detected a circ _ ADARB1 of 290bp in length. It is a circular RNA formed by reverse splicing of exons 2 and 3 of the ADARB1 gene. Experiments show that the circular RNA is related to the occurrence and development of nasopharyngeal carcinoma, and can be used as a nasopharyngeal carcinoma diagnosis marker and a therapeutic target.

Disclosure of Invention

The invention discovers circ _ ADARB1 with the size of 290bp, discovers the relation between the circ _ ADARB1 and nasopharyngeal carcinoma and has the possibility of being used as a diagnostic marker and a therapeutic target of the nasopharyngeal carcinoma.

The first purpose of the invention is to provide an application of an agent for inhibiting circ _ ADARB1 in preparing a nasopharyngeal carcinoma therapeutic preparation, wherein the sequence of the circ _ ADARB1 is shown as SEQ No. 1.

Further, the preparation for inhibiting circular RNA circ _ ADARB1 comprises siRNA.

Further, the siRNA is as follows:

sense strand (5'-3') GCCAGAGUGGAGCCUUUCAUU

The antisense strand (5'-3') UGAAAGGCUCCACUCUGGCUU,

but are not limited to the specific siRNAs mentioned above.

Further, the reagent for inhibiting circ _ ADARB1 also comprises a negative control:

sense strand (5'-3') UUCUCCGAACGUGUCACGUUU

Antisense strand (5'-3') ACGUGACACGUUCGGAGAAUU.

But are not limited to the specific negative controls described above.

The second purpose of the invention is to provide an agent for treating nasopharyngeal carcinoma, which comprises an agent for inhibiting cyclic RNAcir _ ADARB1, wherein the sequence of the cyclic RNAcir _ ADARB1 is shown in SEQ ID NO. 1.

Further, the agent for inhibiting cyclic RNAcirc _ ADARB1 comprises siRNA.

Further, the siRNA is as follows:

sense strand (5'-3') GCCAGAGUGGAGCCUUUCAUU

Antisense strand (5'-3') UGAAAGGCUCCACUCUGGCUU

But are not limited to the specific siRNAs mentioned above.

Further, the reagent for inhibiting circ _ ADARB1 also comprises a negative control:

sense strand (5'-3') UUCUCCGAACGUGUCACGUUU

Antisense strand (5'-3') ACGUGACACGUUCGGAGAAUU.

However, the present invention is not limited to the negative control described above.

The nasopharyngeal cancer therapeutic preparation further comprises an agent required for transfection of siRNA.

Currently, siRNA has been developed as an important tool for gene function studies. To explore the role of circ _ ADARB1 in tumorigenesis development, we designed a pair of siRNAs based on the splice site of circ _ ADARB1 and transiently transfected the siRNAs and siNC (control) into CNE2 and HNE2 cell lines using Hiperfect's reagent to silence the expression of circ _ ADARB 1. After the transfection, the cells are cultured for 36 hours and collected, and the expression level of circ _ ADARB1 is detected by using a real-time fluorescent quantitative PCR technology to detect the transfection efficiency of siRNA, and the expression level of circ _ ADARB1 is detected at the same time, so that the designed siRNA can obviously inhibit the expression level of circ _ ADARB 1.

The present invention has confirmed the above conclusion through a number of experiments: namely, an agent inhibiting circ _ ADARB1 can be used for preparing a therapeutic agent for nasopharyngeal carcinoma. These tests included: in vitro overexpression circ _ ADARB1 test shows that the proliferation of nasopharyngeal carcinoma cells can be promoted, and in vitro silencing circ _ ADARB1 can inhibit the proliferation of nasopharyngeal carcinoma cells; in vitro overexpression of circ _ ADARB1 promotes migration of nasopharyngeal carcinoma cells, and in vitro silencing of circ _ ADARB1 inhibits migration of nasopharyngeal carcinoma cells; in vitro overexpression of circ _ ADARB1 promotes invasion of nasopharyngeal carcinoma cells, and in vitro silencing of expression of circ _ ADARB1 influences invasion of nasopharyngeal carcinoma.

The siRNA has good silencing effect. After ensuring that circ _ ADARB1 was disrupted, we performed MTT experiments in nasopharyngeal carcinoma cell lines CNE2 and HNE2 that silenced circ _ ADARB1, which significantly slowed proliferation of cells in the siRNA group relative to the NC (control) group, i.e., silencing circ _ ADARB1 inhibited proliferation of nasopharyngeal carcinoma cells. Namely, the inhibition of circ _ ADARB1 can treat nasopharyngeal carcinoma, and has profound clinical significance and important popularization and application prospects.

Drawings

FIG. 1 is a graph of the qRT-RCR assay for the expression level of circ _ ADARB1 in nasopharyngeal carcinoma tissues and non-tumor rhinitis epithelial tissues;

analysis of the expression level of circ _ ADARB1 non-tumor nasopharyngeal epithelial tissue was normalized to 1 with β -actin as a reference, N was non-tumor nasopharyngeal epithelial tissue, and the number of samples was 12; t is nasopharyngeal carcinoma tissue, the number of samples is 22, n is the number of samples, the T test is adopted, and P is less than 0.05, so that the statistical significance is achieved.

FIG. 2 shows Sanger sequencing;

the circ _ ADARB1 is formed by reversely splicing exons 2 and 3 of an ADARB1 gene, E represents exon, and underlined sequences represent head-to-tail joint sequences; schematic representation of circrna formation; c. the peak pattern of the sequencing results, the black arrows indicate the end-to-end relationship.

FIG. 3 is an overexpression vector map.

FIG. 4 is a graph of the qRT-RCR assay for the expression level of circ _ ADARB1 in nasopharyngeal carcinoma cell lines;

the results of qRT-PCR showed expression of circ _ ADARB1 in normal nasopharyngeal epithelial cells NP69, as well as nasopharyngeal carcinoma cells CNE2, HNE2, HONE1, and analysis of circ _ ADARB1 expression levels normalized to 1 for immortalized normal inflammatory nasopharyngeal epithelial cells NP69, <0.05, <0.01, <0.001, <0.0001 with β -actin as a reference.

FIG. 5 shows the effect of circ _ ADARB1 overexpression and cyclization efficiencies in nasopharyngeal carcinoma cell lines as measured by qRT-PCR;

qRT-PCR to detect circ _ ADARB1 overexpression effect and cyclization efficiency in nasopharyngeal carcinoma cell lines CNE2 and HNE 2; qRT-PCR to examine the effect of overexpression of circ _ ADARB1 on ADARB1mRNA levels in nasopharyngeal carcinoma cell lines CNE2, HNE 2; pcdnas 3.1(+) panel was normalized to 1 with β -actin as reference, ns representing no significance, P <0.05, P <0.01, P <0.001, P < 0.0001.

FIG. 6 shows the silencing efficiency of circ _ ADARB1siRNA in nasopharyngeal carcinoma cell lines detected by qRT-PCR technique;

qRT-PCR to examine the silencing efficiency of circ _ ADARB1siRNA in nasopharyngeal carcinoma cell lines CNE2, HNE 2; qrt-PCR to examine the effect of silencing circ _ adrb 1 on adrb 1mRNA levels in nasopharyngeal carcinoma cell lines CNE2, HNE 2; analysis of circ _ ADARB1 expression levels NCsiRNA groups were normalized to 1 with β -actin as a reference, ns representing no significance, P <0.05, P <0.01, P <0.001, P < 0.0001.

FIG. 7 is a graph of the effect of in vitro overexpression of circ _ ADARB1 on nasopharyngeal carcinoma cell proliferation;

qRT-PCR to detect the overexpression efficiency of circ _ ADARB1 in nasopharyngeal carcinoma cell lines CNE2 and HNE 2; c-d. the cells were tested for cell proliferation by performing MTT experiments, and analysis of the expression levels of circ _ ADARB1 normalized pcdna3.1(+) group to 1, ns for meaningless, # P <0.05, # P <0.01, # P <0.001, # P <0.0001, using β -actin as a reference.

FIG. 8 is a graph of the effect of in vitro silencing of circ _ ADARB1 on nasopharyngeal carcinoma cell proliferation;

qrt-PCR detects circ _ adrb 1 knockdown efficiency in nasopharyngeal carcinoma cell lines CNE2, HNE 2; c-d. the cells were tested for cell proliferation by MTT assay, and the analysis of the expression levels of circ _ ADARB1 normalized the NCsiRNA group to 1, ns representing no significance, P <0.05, P <0.01, P <0.001, P <0.0001, with β -actin as a reference.

FIG. 9 is a graph of the qrT-PCR assay for circ _ ADARB1 overexpression efficiency in scratch test cells;

the transfection efficiencies of nasopharyngeal carcinoma cell lines CNE2 and HNE2 used in the scratch test were tested by qRT-PCR test, and the expression level analysis of circ _ ADARB1 was performed by using beta-actin as a reference, and the pcDNA3.1(+) group was normalized to 1, P <0.05, P <0.01, P <0.001, and P < 0.0001.

FIG. 10 is a graph showing the effect of overexpression of circ _ ADARB1 on the nasopharyngeal carcinoma cells CNE2, HNE2 scratch healing experiments;

c-nasopharyngeal carcinoma CNE2 and HNE2 cells were transfected with pcDNA3.1(+) null, pcDNA3.1(+)/has _ circ _ ADARB1, and after the cell density reached 100%, they were scratched and photographed at 0,12, and 24 hours.

FIG. 11 is a statistical chart of nasopharyngeal carcinoma CNE2, HNE2 cell scratch test overexpressing circ _ ADARB 1;

a-b, randomly selecting 6 visual fields in each group to measure the scratch width, standardizing the scratch width of 0 hour to 1, and making a statistical chart; each experiment was repeated three times and counted using Student's t-test method. P <0.05, P <0.01, P <0.001, P < 0.0001.

FIG. 12 shows the interference efficiency of circ _ ADARB1 in scratch test cells detected by qRT-PCR;

the transfection efficiency of nasopharyngeal carcinoma cell lines CNE2 and HNE2 used in scratch test was tested by qRT-PCR test, and the expression level analysis of circ _ ADARB1 was performed by using beta-actin as a reference, and NC siRNA groups were normalized to 1, P <0.05, P <0.01, P <0.001, and P < 0.0001.

FIG. 13 is a graph of the effect of interference circ _ ADARB1 on nasopharyngeal carcinoma cells CNE2, HNE2 scratch healing experiments;

nasopharyngeal carcinoma CNE2 and HNE2 cells were transfected with NC siRNA/si-circ _ ADARB1, scored after the cell density reached 100%, and photographed at 0,12,24 hours.

FIG. 14 is a statistical chart of nasopharyngeal carcinoma CNE2, HNE2 cell scratch test interfering with circ _ ADARB 1;

a-b, randomly selecting 6 visual fields in each group to measure the scratch width, standardizing the scratch width of 0 hour to 1, and making a statistical chart; each experiment was repeated three times and counted using Student's t-test method. P <0.05, P <0.01, P <0.001, P < 0.0001.

FIG. 15 shows the overexpression efficiency of circ _ ADARB1 in the Transwell cell matrigel invasion assay by qRT-PCR;

transfection efficiencies of nasopharyngeal carcinoma cell lines CNE2 and HNE2 used in transwell matrigel invasion assay were tested by qRT-PCR assay, and analysis of circ _ ADARB1 expression levels normalized pcdna3.1(+) group to 1, P <0.05, P <0.01, P <0.001, P <0.0001 with β -actin as a reference.

FIG. 16 is a graph showing the effect of overexpression of circ _ ADARB1 on the invasive potential of the nasopharyngeal carcinoma cell lines CNE2, HNE 2;

the Transwell cell matrigel invasion experiments were performed on CNE2, HNE2 overexpressing circ _ adrb 1, respectively, and on the respective control cells.

FIG. 17 is a statistical plot of a Transwell cell matrigel invasion assay overexpressing circ _ ADARB 1;

randomly selecting 3 cell fields in each group for cell counting, and making a statistical chart; each experiment was repeated three times and counted using Student's t-test method; pcdnas 3.1(+) panel was normalized to 1, P <0.05, P <0.01, P <0.001, P <0.0001 with β -actin as reference.

FIG. 18 shows interference efficiency of circ _ ADARB1 in qRT-PCR detection of Transwell cell matrigel invasion experiments;

transfection efficiencies of nasopharyngeal carcinoma cell lines CNE2 and HNE2 used in transwell matrigel invasion experiments were tested by qRT-PCR experiments, and the expression level analysis of circ _ ADARB1 was performed with β -actin as a reference, and NC groups were normalized to 1, P <0.05, <0.01, <0.001, < 0.0001.

FIG. 19 is a graph of interference with the effect of circ _ ADARB1 on the invasive potential of the nasopharyngeal cancer cell lines CNE2, HNE 2;

CNE2, HNE2, and respective control cells, which interfered with circ _ ADARB1, respectively, were subjected to Transwell cell matrix gel invasion experiments.

FIG. 20 is a statistical plot of a Transwell cell matrix gel invasion assay interfering with circ _ ADARB 1;

randomly selecting 3 cell fields in each group for cell counting, and making a statistical chart; each experiment was repeated three times and counted using Student's t-test method; with β -actin as a reference, the NC groups were normalized to 1, P <0.05, P <0.01, P <0.001, P < 0.0001.

Detailed Description

The following detailed description is intended to further illustrate the invention without limiting it.

The normal inflammatory nasopharyngeal epithelial tissue and the nasopharyngeal carcinoma tissue specimen used by the invention are from the first-diagnosis patient treated by the affiliated tumor hospital of the university of Central and south China, and are not treated by radiotherapy, chemotherapy and operation. After fresh nasopharyngeal carcinoma tissues are collected, the tissues are immediately put into a liquid nitrogen tank for storage, and then relevant clinical data of all patients are collected, and all experimental tissue samples are collected and authorized by the ethical committee of the university of the south China and approved by the patients.

Three nasopharyngeal cancer cell lines CNE2, HNE2 and HONE1 used in the invention are all stored in molecular genetic laboratories of the institute of tumor research of the university of Zhongnan. The cell culture conditions were: RPMI1640 liquid medium containing 10% Fetal Bovine Serum (FBS) and 1% diabody (penicillin, streptomycin), 37 deg.C, 95% humidity, 5% CO₂The constant temperature incubator with the concentration grows by adhering to the wall.

The design of the primer of the circular RNA is different from that of the linear RNA primer, the primer is designed according to two sides of a splicing site, is designed on a Primer3.0 website on line, and the final primer synthesis work is finished by sending an electronic mail order and entrusting the Changsha synthesis department of Ongken biology company.

(1)β-actin

An upstream primer: 5'-TCACCAACTGGGACGACATG-3', the sequence is shown in SEQ ID NO. 2;

a downstream primer: 5'-GTCACCGGAGTCCATCACGAT-3', and the sequence is shown in SEQ ID NO. 3.

(2) Circular RNA circ _ ADARB1 real-time quantitative PCR primer

An upstream primer: 5'-ACCCTCATTCATCCAGCGAG-3', the sequence is shown in SEQ ID NO. 4;

a downstream primer: 5'-GCCAGTGTGTCTCCTTCAGT-3', the sequence is shown in SEQ ID NO. 5;

(3) amplification of circ _ ADARB1 full-Length primer

An upstream primer: 5'-CCATCGATAGTGGAGCCTTTCAGGCTG-3', the sequence is shown in SEQ ID NO. 6.

A downstream primer: 5'-TCCCCGCGGCTGGCTGGCAAGGCG-3', and the sequence is shown in SEQ ID NO. 7.

In the invention, in order to specifically knock down the circular RNA without influencing the linear gene expression of the circular RNA, siRNA is designed according to splicing sites, and the ring _ ADARB1 is targeted and silenced.

circ _ ADARB1siRNA sequence:

the sequence of the sense strand (5'-3') GCCAGAGUGGAGCCUUUCAUU is shown in SEQ ID NO. 8.

The antisense chain (5'-3') UGAAAGGCUCCACUCUGGCUU, the sequence is shown in SEQ ID NO. 9.

Negative control:

the sequence of the sense strand (5'-3') UUCUCCGAACGUGUCACGUUU is shown in SEQ ID NO. 10.

The antisense chain (5'-3') ACGUGACACGUUCGGAGAAUU, the sequence is shown in SEQ ID NO. 11.

The test results of the invention are all analyzed by statistics: the t-test was used to evaluate the difference between the two groups. Chi-square test is used to assess differences in gene expression or lack thereof with respect to clinical parameters such as sex, age, tumor stage, clinical staging and metastasis. Survival analysis was performed using the Kaplan-Meier assay. p <0.05 was used to indicate statistical significance, and all p values were tested using a two-sided test. Statistical analysis was performed using SPSS 13.0 and graphpad7.0 software.

Example 1: expression of circ _ ADARB1 in nasopharyngeal carcinoma tissues and cells

1. According to the standard sample collection protocol, 34 tissue samples of nasopharyngeal carcinoma patients were collected from tumor hospitals in Hunan province. All cases were first-diagnosed patients in head and neck surgery in tumor hospitals in Hunan province (time interval: 2016 1 month to 2016 11 months). 22 cases of nasopharyngeal carcinoma and 12 cases of nasopharyngeal inflammation (excluding tumor diseases, inactive infectious diseases, serious immune diseases and other serious diseases) are diagnosed by a pathology department.

Complete personal information and clinical data including name, gender, age, clinic number, hospitalization number, pathology type, case stage, EBV infection and the like are recorded in the collection process, and detailed Excel electronic form screenshot is shown. All samples are collected and approved by the patient, and the patient signs a written agreement with the patient to establish a specimen bank with complete data.

2. RNA extraction of nasopharyngeal carcinoma or normal inflammatory nasopharyngeal tissue

(1) Preparation work: cleaning mortar with detergent, and soaking in 3% hydrogen peroxide (H)₂O₂) Washing for more than 4 hours, washing with distilled water for several times, covering mortar with tinfoil paper (for uniform heating and preventing pollution when taking out), and oven-drying at 180 deg.C for more than 8 hours. After reaching the dry baking time, closing the drying oven, and taking the product when the temperature of the drying oven is reduced to room temperatureTaking out of the mortar and storing in a clean area.

(2) Grinding by liquid nitrogen: adding liquid nitrogen into a mortar for precooling, then clamping and taking the nasopharynx tissue preserved in the freezing storage tube, quickly grinding, continuously adding a small amount of liquid nitrogen while grinding, and grinding again until the nasopharynx tissue is ground into powder. According to the optimal ratio, 1ml Trizol is added to every 50-100mg of normal or NPC sample (nasopharyngeal carcinoma sample). During our experiment, one nasopharyngeal carcinoma tissue sample is about 200mg, so 2ml Trizol is needed. Further grinding, mixing, and placing in refrigerator at 4 deg.C for 5-10min to allow complete tissue lysis. The lysate was transferred to a 2ml Tube when it had melted to a pink liquid. Each sample can be separated into 2 tubes and stored at-80 ℃.

(3) And (3) water phase separation: to 1000. mu.l of tissue lysate containing trizol was added 200. mu.l of 4 ℃ pre-cooled chloroform, and the mixture was mixed by shaking for about 30 seconds. After leaving in a low-temperature atmosphere for 5 minutes, centrifugation was carried out for 25 minutes (12,000rpm, 4 ℃). After centrifugation, the liquid in the tube was observed to separate into 3 layers, RNA was present in the upper transparent layer, the middle layer was a membranous white precipitate, and the lower layer was pink. Therefore, the upper aqueous phase containing RNA was further pipetted into 1.5ml of Tube and gently pipetted using a 100. mu.l gun to avoid as much as possible the aspiration into the middle and lower layers of material, which would cause RNA contamination.

(4) RNA precipitation: adding isopropanol with the volume of 1:1 equal to that of approximately 500 mu l into the supernatant, gently inverting and mixing the mixture up and down for a plurality of times, placing the mixture at the temperature of 20 ℃ in a refrigerator for 30 minutes, centrifuging the mixture for 30 minutes (4 ℃,12,000rpm) to see that RNA precipitates exist at the bottom of a tube, sucking the mixture by using a 100 mu l pipette gun, and discarding the supernatant to keep the RNA precipitates as much as possible.

(5) RNA washing: 1ml of 75% ethanol prepared with enzyme-free water was added to each tube of RNA pellet sample, and the centrifuge tube was gently inverted upside down to wash the RNA pellet. Then, the mixture was centrifuged for 5 minutes (4 ℃,7,600rpm), the supernatant was discarded as much as possible by using a 100. mu.l pipette gun, and the mixture was dried at room temperature for 10 to 15 minutes.

(6) RNA re-lysis and storage: each tube was filled with 15-30. mu.l DECP water and stored at-80 ℃.

3. Total RNA extraction from cells

Preparation work: after sterilization, the test table and the pipette are wiped with 75% alcohol before the test is started, wherein the sterile RNase-free water, 75% ethanol (prepared without RNase), chloroform, isopropanol, 1 XPBS, an enzyme-free tip and an EP tube are precooled to 4 ℃ by a high-speed low-temperature centrifuge.

(1) Taking cells of RNA to be extracted, and washing the cells twice by using 1 XPBS or D-hanks;

(2) adding 500 mul Trizol lysate into each hole of a 12-hole plate, performing room-temperature lysis for 1-2 minutes, gently blowing down cells by using a pipette gun, slightly reversing the upper and lower parts for 10 times, and standing for 5 minutes at room temperature;

(3) adding 100 μ l chloroform (1 ml Trizol:0.2ml chloroform: 0.5ml isopropanol), shaking vigorously for 15-30s, and standing on ice for 5 min;

(4)4℃，12000rpm/20min；

(5) putting the upper water phase into a precooled Tube, adding 250 mul of isopropanol, and uniformly mixing the mixture with a vortex mixer or a pipette (the temperature is 20 ℃ below zero is more than 1 hour);

(6) at 4 ℃, 12000rpm/30min, and discarding the supernatant;

(7) adding 1ml of 75% ethanol (precooling), and mixing uniformly;

(8) 7600rpm/5min at 4 ℃; discarding the supernatant, and repeating the steps 8 and 9;

(9) instantly separating for 10s, sucking the supernatant as much as possible, and inversely drying for 10 minutes;

(10) 20-30. mu.l DEPC water was added to measure the RNA concentration and OD value.

4. Reverse transcription PCR reaction of gene circRNA

(according to the manual of the instructions of 5 × All-In-OneRTMasterMix (with AccuRTGenomiccDNAremovalkit) (# G492) of abm Co.)

The following reaction system is configured:

the reverse transcription PCR reaction program is as follows:

25℃ 10min，

42℃ 15min，

85℃ 5min。

after the reaction is finished, the product is stored at-20 ℃ for later use.

5. Real-time fluorescent quantitative PCR

The reverse transcription reaction product was diluted 5 times and then the following reaction system was configured according to the instruction manual of EvaGreen qPCR MasterMix (MasterMix-R) from abm:

the reaction program on the real-time fluorescent quantitative PCR machine is as follows: (Cycle X39)

After the reaction is completed by the Bio-RadIQ5 real-time fluorescence quantitative PCR instrument, the gene is labeled with the reference gene beta-actin with 2-^ΔΔThe CT value indicates the relative expression level of the target gene, and the difference in expression of the gene is determined. P-values were calculated using unpaired t-test.

As a result: a plurality of nasopharyngeal carcinoma tissues and normal inflammatory nasopharyngeal epithelial tissues are collected, and the expression condition of circ _ ADARB1 is detected by utilizing a qRT-PCR technology. The results showed that circ _ ADARB1 was significantly highly expressed in 22 nasopharyngeal carcinoma tissues compared to 12 normal inflammatory nasopharyngeal epithelium tissues, and the level of circ _ ADARB1 expression in the nasopharyngeal carcinoma group was about 4-fold higher than that in the normal inflammatory nasopharyngeal epithelium, and the difference between the two groups of data was statistically significant (p ═ 0.0044), and the results are shown in fig. 1. In addition, we also tested the expression of circ _ ADARB1 in normal nasopharyngeal epithelial cells (NP69) and nasopharyngeal carcinoma cells (CNE2, HNE2, HONE1), and the results showed that the expression of circ _ ADARB1 in nasopharyngeal carcinoma cells was significantly higher than that of normal nasopharyngeal epithelial cells NP69 (see FIG. 4). Therefore, circa HGAP12 is highly expressed in nasopharyngeal carcinoma tissues and cells, and circ _ ADARB1 possibly has important biological functions for the occurrence and development of nasopharyngeal carcinoma and has the potential of serving as a nasopharyngeal carcinoma diagnosis molecular marker.

Example 2: sanger sequencing demonstrated that circular RNA was formed

To demonstrate that circ _ ADARB1 forms circular RNA rather than linear, the qRT-PCR product in FIG. 1 was recovered and sent to the company for sanger sequencing (Oncork Co.). The sequences returned by the company are compared by using DNASTAR software, and peak images are looked up by using chromas software to judge the sequencing quality. The results in fig. 2 show that a.circ _ ADARB1 is formed by splicing together the 2,3 exons of ARHGAP12 end-to-end, E denotes exon (exon), and underlined sequences denote end-to-end linker sequences; schematic representation of circrna formation; c. the peak pattern of the sequencing results, the black arrows indicate the end-to-end relationship.

Example 3: detection of the overexpression Effect of circ _ ADARB1 in nasopharyngeal carcinoma cell lines

Firstly, we select the enzyme cutting sites, put the full-length sequence of circ _ ADARB1 into NEB cutter 2.0 online website for analysis, and show that the ClaI and SacII enzyme cutting sites are sites which do not exist in the full-length sequence of circ _ ADARB1, and DNA restriction enzymes which exist singly in the pcDNA3.1 plasmid vector. Constructing an overexpression body according to the expression vector; FIG. 3 is a map of the over-expression vector.

To examine the cyclization efficiency of circ _ ADARB1, we first expressed the constructed pcDNA3.1/circ _ ADARB1 eukaryotic over-expression vector in nasopharyngeal carcinoma cells. And (3) inoculating third and fourth generation nasopharyngeal carcinoma cells CNE2 and HNE2 with good growth condition into a 12-well plate, when the cell fusion degree reaches 60-80%, transiently transfecting the nasopharyngeal carcinoma cells CNE2 and HNE2 by using a liposome method lipofectamine 3000 and an endotoxin-free plasmid pcDNA3.1 empty vector and a pcDNA3.1/circ _ ADARB1 overexpression vector, and continuously culturing for 48 hours. The cells were collected and the expression level and cyclization efficiency of circ _ ADARB1 were determined by real-time fluorescent quantitative PCR. The qPCR results showed that the expression level of circ _ ADARB1 was significantly increased in the pcDNA3.1/circ _ ADARB1 over-expressing plasmid group cells compared to the pcDNA3.1 empty plasmid group cells, and the expression fold was over 1000 fold in both CNE2 and HNE2 cell lines, see FIG. 5, which results are statistically significant. However, the expression level of ADARB1mRNA did not change significantly, indicating that the mRNA level of ADARB1 was not affected by the transfection of circ _ ADARB1, and the function of the subsequent experiment results was performed by circ _ ADARB1 rather than ADARB1 gene.

Example 4: effect test of silencing circ _ ADARB1 expression in nasopharyngeal carcinoma cell lines

According to the splicing site, an SI sequence of circ _ ADARB1 is designed, and siRNA is a double-stranded RNA molecule which has the length of 21-25 nucleotides, can be complementarily combined with homologous RNA, and can specifically degrade target RNA so as to inhibit the expression of the target RNA. Currently, siRNA has been developed as an important tool for gene function studies. To explore the role of circ _ ADARB1 in tumorigenesis development, we designed sirnas based on the splice site of circ _ ADARB1, and transiently transfected sirnas and siNC (blank control) into CNE2 and HNE2 cell lines using Hiperfect reagent to silence the expression of circ _ ADARB 1. After transfection, cells are collected after culturing for 48 hours, the expression level of circ _ ADARB1 is detected by using a real-time fluorescent quantitative PCR technology to detect the transfection efficiency of siRNA, the effect of the knocking-down is confirmed to reach more than 50%, and the mRNA expression level of ADARB1 is not influenced, so that the mRNA level of ADARB1 is not influenced by the transfection of circ _ ADARB1, and the functions in the subsequent experimental results are all exerted by circ _ ADARB1 but not by ADARB1 gene. The results are shown in FIG. 6.

Example 5: in vitro overexpression of circ _ ADARB1 to promote proliferation of nasopharyngeal carcinoma cells

Firstly, transiently transfecting endotoxin-free plasmids pcDNA3.1 and pcDNA3.1/circ _ ADARB1 overexpression vectors into nasopharyngeal carcinoma cells CNE2 and HNE2 by using a liposome method lipofectamine 3000, continuously culturing for 48 hours, ensuring that the expression level of circ _ ADARB1 in the nasopharyngeal carcinoma cell lines is increased by using qRT-PCR, and then performing an MTT (maximum transcription-polymerase chain reaction) experiment to verify the influence of the endotoxin-free plasmids pcDNA3.1 and pcDNA3.1/circ _ ADARB1 on cell proliferation. Based on the detection results from the first to the fifth days, we found that there was a significant difference in cell proliferation between the pcDNA3.1 empty plasmid group and the pcDNA3.1/circ _ ADARB1 overexpressed plasmid group, and that the overexpressed circ _ ADARB1 had a promoting effect on the proliferation of nasopharyngeal carcinoma cells under in vitro culture conditions. (results are shown in FIG. 7)

Example 6: in vitro silencing of circ _ ADARB1 inhibits proliferation of nasopharyngeal carcinoma cells

siRNA and siNC (blank) were transiently transfected into CNE2 and HNE2 cell lines using Hiperfect reagent to silence the expression of circ _ adrb 1. After transfection, cells were collected by culturing for 48 hours, and the expression level of circ _ ADARB1 was measured by real-time fluorescent quantitative PCR to examine the transfection efficiency of siRNA. The results show that the siRNA has good silencing effect. After ensuring that circ _ ADARB1 was disrupted, we performed MTT experiments in nasopharyngeal cancer cell lines CNE2 and HNE2 that silenced circ _ ADARB1, verifying its effect on cell proliferation. Based on the detection results of the first to fifth days, the proliferation speed of the cells in the siRNA group is obviously reduced compared with that in the NC group, namely, the silent circ _ ADARB1 inhibits the proliferation of nasopharyngeal carcinoma cells. Through the verification of positive and negative directions, we can say that circ _ ADARB1 has the promotion effect on the proliferation of nasopharyngeal carcinoma cells under the in vitro culture condition. (see FIG. 8 for results)

Example 7: cell scratch healing migration experiment

(1) A cell illumination table: a Tip head of 1000 mul/10 mul, D-Hank's sterilized at high temperature and high pressure, a ruler, a pipette gun of 1000 mul/10 mul, a marker pen and the like, and the components are sterilized by alcohol and then placed in an ultra-clean bench for ultraviolet irradiation for 30 minutes;

(2) respectively transfecting siRNA and NC groups or transfection plasmids when the cells grow to about 50-70%;

(3) scratching is started the next day after the cells grow over the bottom of the flat plate: the 10 mul gun head is perpendicular to the bottom of the 6-hole plate than a ruler to perform cross or # -shaped scratch quickly without inclination, and the force is consistent, so as to ensure that scratch broadband is as same as possible;

(4) the culture solution is removed by suction, and the cells are washed by D-hanks for 3 times, so that the broken cells caused by scratches are washed away as much as possible;

(5) adding 1640 culture medium of 1% double-antibody 2% fetal bovine serum;

(6) taking a picture to record the width of the scratch beside the cross at the moment, and recording the width as 0 h;

(7) putting the 6-hole plate back to the incubator for culture, taking out the 6-hole plate at intervals of 12 hours, and taking the position of the picture taken when 0 hour is taken, wherein the position is marked as 12 hours;

(8) the same position was again photographed at 24h intervals until the scratch healed, all pictures were collated and statistical analysis was performed.

In vitro overexpression of circ _ ADARB1 to promote migration of nasopharyngeal carcinoma cells

After determining that the cyclic circ _ ADARB1 has a promoting effect on the proliferation capacity of nasopharyngeal carcinoma cells, we performed a scratch experiment in the nasopharyngeal carcinoma cell lines to verify that circ _3480 has no effect on the migration of the nasopharyngeal carcinoma cell lines. The endotoxin-free plasmids pcDNA3.1 and pcDNA3.1/has _ circ _ ADARB1 overexpression vectors were transiently transfected into nasopharyngeal carcinoma cells CNE2 and HNE2 by using liposome method lipofectamine 3000, and the cells were cultured for 48 hours. The cells were collected and the expression level and cyclization efficiency of circ _ ADARB1 were determined by real-time fluorescent quantitative PCR. After confirming the good effect of overexpression of the circ _ ADARB1 overexpression plasmid, we performed cell scratch healing experiments on nasopharyngeal carcinoma cell lines CNE2 and HNE 2. Scratch healing experiments were confirmed at various time points (0 h, 12h, 24h for CNE 2; 0h, 12h, 24h for HNE 2) in these cells: the migration ability of cells of pcDNA3.1/circ _ ADARB1 over-expressing plasmid set was significantly enhanced relative to the unloaded pcDNA3.1(+) plasmid set. The width difference of the scratch is large and has statistical significance. The above results show that the overexpression of circ _ ADARB1 in nasopharyngeal carcinoma cell lines can promote the migration ability of nasopharyngeal carcinoma cells CNE2 and HNE2 in vitro. (results are shown in FIGS. 9,10 and 11)

In vitro silencing of circ _ ADARB1 inhibits migration of nasopharyngeal carcinoma cells

siRNA and NC were transiently transfected into CNE2 and HNE2 cell lines using Hiperfect reagent to silence the expression of circ _ adrb 1. After transfection, cells were collected by culturing for 48 hours, and the expression level of circ _ ADARB1 was measured by real-time fluorescent quantitative PCR to examine the transfection efficiency of siRNA. The results show that the siRNA has good silencing effect. After ensuring that circ _ ADARB1 was disrupted, we performed scratch experiments in nasopharyngeal carcinoma cell lines CNE2 and HNE2 that silenced circ _ ADARB1, to verify its effect on cell migration. Scratch healing experiments were confirmed at various time points (0 h, 12h, 24h for CNE 2; 0h, 12h, 24h for HNE 2) in these cells: compared with the NC group, the migration capacity of the siRNA group cells is obviously weakened. The scratch width difference is obvious and has statistical significance. The above results show that silencing the expression of circ _ ADARB1 in nasopharyngeal carcinoma cell lines can inhibit the migration ability of nasopharyngeal carcinoma cells CNE2 and HNE2 in vitro. As proved by verification of the positive direction and the negative direction, the circ _ ADARB1 can promote the migration of nasopharyngeal carcinoma cells. (the results are shown in FIGS. 12,13 and 14)

Example 8: cell transwell invasion assay

(1) Preparing matrigel: the BDmatrigel glue frozen at-20 ℃ is placed in a refrigerator at 4 ℃ to be melted into liquid state one day in advance, a tip head and an EP pipe for releasing the glue are placed at-20 ℃ overnight, so that the Matrigel glue cannot be solidified too fast when being paved on the next day;

(2) matrix glue dilution: BDMatrigel gum: adding 20 mul of matrigel into 160 mul of 1640 culture medium, blowing and mixing evenly, wherein the serum-free culture medium is 1: 8;

(3) adding diluted matrix glue into a transwell chamber of 100 mu l, sucking out 80 mu l along the edge, sequentially paving the matrix glue and putting the matrix glue into an incubator at 37 ℃ for incubation for 2-3 hours, and when the glue paving layer is white, indicating that the liquid Matrigel glue is solid;

(4) digesting the transfected experimental cells, washing with a serum-free medium for 2 times, suspending the cells with a serum-free medium, and counting the cells, wherein the cell concentration is adjusted to 2,0000 cells per 200 μ l;

(5) adding 800 μ l of 1640 medium containing 20% FBS to the lower chamber, and placing the 24-well plate in the chamber while tilting at an angle of 45 ° to avoid air bubbles between the chamber and the liquid surface during placement in the chamber;

(6) 200 mul of the cell suspension with the uniform count is added into each chamber, and the 24-well plate is placed back into the 37 ℃ incubator and incubated for about 24-48 hours according to the cell state and the cell invasion speed.

(7) The 24-well plate is taken out and washed twice by PBS or D-hanks, soaked and washed for 10 minutes by 4 percent paraformaldehyde and washed 3 times by clear water.

(8) Dyeing: dripping 0.1% crystal violet to the bottom of the transwell chamber, standing at room temperature for 5-10min, washing with PBS for 2-3 times, and carefully wiping off the matrix glue on the chamber with cotton swab;

(9) 800. mu.l of distilled water was added to a 24-well plate, about 200. mu.l of distilled water was added to the upper chamber of the transwell, and observation was performed under an inverted microscope, photographs were taken of different fields, counted using image J software, and the significance of the difference was statistically analyzed.

In vitro overexpression of circ _ ADARB1 to promote invasion of nasopharyngeal carcinoma cells

We performed Transwell cell matrigel invasion experiments in nasopharyngeal carcinoma cell lines CNE2 and HNE2 to observe the effect of overexpression of circ _ ADARB1 on cell invasion capacity. We also transiently transfected endotoxin-free plasmids pcDNA3.1 and pcDNA3.1/circ _ ADARB1 over-expression vectors into nasopharyngeal carcinoma cells CNE2 and HNE2 using Lipofectamine 3000 by liposome method, and continued culturing for 48 hours. The cells were collected and the expression level and cyclization efficiency of circ _ ADARB1 were determined by real-time fluorescent quantitative PCR. After confirming that the overexpression of circ _ ADARB1 overexpression plasmid was good, we seeded the cells into matrigel-plated Transwell chambers and found that the number of cells that over-expressed the plasmid group invaded the lower surface of the chamber was significantly greater than the number of cells that did not reach the chamber, and that the trends in the results for the two cell lines were consistent. 3 pictures were taken randomly and the cell numbers were recorded, with significant differences between the two individual data in each cell line and statistical significance. The results show that the over-expression of circ _ ADARB1 in the nasopharyngeal carcinoma cell line can promote the invasion capacity of the nasopharyngeal carcinoma cells CNE2 and HNE2 in vitro. (the results are shown in FIGS. 15,16 and 17)

In vitro silencing of circ _ ADARB1 expression affects nasopharyngeal carcinoma invasion

To investigate whether silencing circ _ ADARB1 could reverse the phenotypic changes brought by overexpression of circ _ ADARB1, we performed Transwell cell matrigel invasion experiments in two cell lines, transiently transfecting circ _ ADARB1siRNA and NC into CNE2 and HNE2 cell lines using Hiperfect reagent to silence the expression of circ _ ADARB 1. After transfection, cells were collected by culturing for 48 hours, and the expression level of circ _ ADARB1 was measured by real-time fluorescent quantitative PCR to examine the transfection efficiency of siRNA. The results show that circ _ ADARB1siRNA has good silencing effect. After ensuring that circ _ ADARB1 was disrupted, we performed a Transwell cell matrigel invasion assay in nasopharyngeal carcinoma cell lines CNE2 and HNE2 that silenced circ _ ADARB1, which showed that the number of tumor cells observable under the Transwell cell surface in the siRNA group was significantly less than that in the NC group, and that the results of the two cell lines tended to be consistent. 3 pictures were taken randomly and the cell numbers were recorded, with significant differences between the two individual data in each cell line and statistical significance. The results show that the silencing of the expression of circ _ ADARB1 in the nasopharyngeal carcinoma cell lines can inhibit the invasion capacity of the nasopharyngeal carcinoma cells CNE2 and HNE2 in vitro. The ring-shaped RNAcirc _ ADARB1 is shown to promote the invasion of nasopharyngeal carcinoma cells by two directions. (the results are shown in FIGS. 18,19 and 20)

Sequence listing

<110> university of south-middle school

Application of <120> circ _ ADARB1 in preparation of nasopharyngeal carcinoma treatment preparation and treatment preparation

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 290

<212> RNA

<213> Intelligent (Homo sapiens)

<400> 1

aaauugaaau ggccaaugag cacacccuca uucauccagc gagcauugag gacccccuag 60

aggccaggcc caugagugau gaagaucccg aggaugaaga cgccuugcca gccagagugg 120

agccuuucag gcuggcaugg agagcuuaag gggcaacuga aggagacaca cuggccaagc 180

gcggaguucu gcuuacuuca guccugcuga gauacucucu caguccgcuc gcaccgaagg 240

aagcugccuu gggaucagag cagacauaaa gcuagaaaaa uuucaagaug 290

<210> 2

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 2

tcaccaactg ggacgacatg 20

<210> 3

<211> 21

<212> DNA

<213> Unknown (Unknown)

<400> 3

gtcaccggag tccatcacga t 21

<210> 4

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 4

accctcattc atccagcgag 20

<210> 5

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 5

gccagtgtgt ctccttcagt 20

<210> 6

<211> 27

<212> DNA

<213> Unknown (Unknown)

<400> 6

ccatcgatag tggagccttt caggctg 27

<210> 7

<211> 24

<212> DNA

<213> Unknown (Unknown)

<400> 7

tccccgcggc tggctggcaa ggcg 24

<210> 8

<211> 21

<212> RNA

<213> Unknown (Unknown)

<400> 8

gccagagugg agccuuucau u 21

<210> 9

<211> 21

<212> RNA

<213> Unknown (Unknown)

<400> 9

ugaaaggcuc cacucuggcu u 21

<210> 10

<211> 21

<212> RNA

<213> Unknown (Unknown)

<400> 10

uucuccgaac gugucacguu u 21

<210> 11

<211> 21

<212> RNA

<213> Unknown (Unknown)

<400> 11

acgugacacg uucggagaau u 21

Claims (2)

1. The application of a reagent for inhibiting the expression of circular RNA circ _ ADARB1 in preparing a preparation for treating nasopharyngeal carcinoma, wherein the sequence of the circular RNA circ _ ADARB1 is shown as SEQ ID NO. 1;

the agent for inhibiting the expression of circular RNA circ _ ADARB1 comprises siRNA;

the siRNA is as follows:

sense strand (5'-3') GCCAGAGUGGAGCCUUUCAUU

Antisense strand (5'-3') UGAAAGGCUCCACUCUGGCUU.

2. The use according to claim 1, wherein said agent that inhibits the expression of circ _ ADARB1 further comprises a negative control:

sense strand (5'-3') UUCUCCGAACGUGUCACGUUU

Antisense strand (5'-3') ACGUGACACGUUCGGAGAAUU.

Images