CN110358834B

CN110358834B - Application of lncRNA, kit and medicine

Info

Publication number: CN110358834B
Application number: CN201910628479.6A
Authority: CN
Inventors: 翟日洪; 钱有辉; 杨文瀚; 吴国栋
Original assignee: Shenzhen University
Current assignee: Shenzhen University
Priority date: 2019-07-12
Filing date: 2019-07-12
Publication date: 2023-05-16
Anticipated expiration: 2039-07-12
Also published as: CN110358834A

Abstract

The invention belongs to the technical field of molecular diagnosis, and particularly relates to application of lncRNA, a kit and a medicament, and application of lncRNA in preparation of a kit for diagnosis and/or prognosis evaluation of NSCLC. Wherein the nucleotide sequence of the lncRNA is shown as SEQ ID No. 1. The lncRNA is highly expressed in the plasma of NSCLC patients before operation, the expression level in the plasma after operation is obviously reduced, and the expression level in NSCLC cancer tissues, NSCLC patient plasma and NSCLC cells is respectively obviously higher than that of the adjacent cancer tissues, healthy human plasma and normal bronchial epithelial cells. The research result shows that the lncRNA has obvious capability of inhibiting the tumor activity of NSCLC cells, and is a newly discovered tumor inhibition lncRNA.

Description

Application of lncRNA, kit and medicine

Technical Field

The invention belongs to the technical field of molecular diagnosis, and particularly relates to application of lncRNA, a kit and a medicament.

Background

Lung cancer is the most common malignancy in the world today, and more than 180 tens of thousands of newly discovered lung cancer patients worldwide each year, with lung cancer causing about 30% of all cancer-related deaths. In the past three decades, the incidence rate and the death rate of the lung cancer in China are always in a rapid rising stage, the incidence rate of the lung cancer is nearly 100 tens of thousands of people each year at present, and the lung cancer becomes an important risk factor for threatening the survival health of residents in China. In lung cancer patients, small cell lung cancer (small cell lung cancer, SCLC) accounts for about 15%, and non-small cell lung cancer (non-small cell lung cancer, NSCLC) accounts for about 85%, the latter being the leading cause of lung cancer-related death. Although the treatment of NSCLC has increased over the last 20 years and the treatment level has been increasing, the overall survival rate of NSCLC patients has been only about 15% for 5 years.

Clinically, surgical excision is the best means of early (stage I-II) NSCLC treatment. Patients with pathological stage IA have survival rate of 80-90% after operation for 5 years; and the survival rate of patients in IV period after operation for 5 years is only 5 percent. However, since there are no typical clinical symptoms and signs in the early stage and there is a lack of effective early diagnosis, most NSCLC patients (-70%) are diagnosed at mid-late stage (stage III-IV), and therefore the opportunity for surgical treatment is lost. For patients with middle and late stages, combination chemotherapy based on platinum drugs is the dominant means for clinical treatment of NSCLC. Most patients are sensitive to drugs in the early stage of chemotherapy, and the clinical symptoms are obviously relieved as the tumor volume is reduced. However, the effect is poor in the later period, and the effective rate is only 20%. Moreover, the chemotherapy has great toxic and side effects, and most patients are easy to generate drug resistance. Among them, multidrug resistance (MDR) is a major cause of failure in lung cancer chemotherapy.

In recent years, targeting drugs represented by mutation of the gene activity acting on the epidermal growth factor receptor (epidermal growth factor receptor, EGFR) and anaplastic lymphoma kinase (anaplastic lymphoma kinase, ALK) gene rearrangement molecules open up a new way for the personalized treatment of advanced NSCLC with high efficiency and low toxicity. The principle of targeted therapy is to inhibit the growth of tumor cells by changing the signaling pathway of tumors at the gene molecular level, affecting angiogenesis, and the like. However, about 60% of patients with EGFR mutated NSCLC will develop acquired T790M mutation after 6-12 months of treatment with a primary EGFR-TKI targeting drug, resulting in secondary drug resistance. The second-generation EGFR-TKI targeting drug can inhibit T790M mutant and wild type simultaneously, and improves the treatment effect. However, the toxic effects associated with wild-type binding limit the use of secondary EGFR-TKI targeting drugs in patients with T790M mutant NSCLC. The third generation EGFR-TKI targeting drugs selectively act on L858R, ex del, T790M and other mutations of EGFR, but have little effect on wild EGFR. In general, targeted drug therapy is only effective in about 20% of NSCLC patients (mainly young adenocarcinoma patients), squamous cell carcinoma and advanced age patients have limited benefit from EGFR-TKI targeted drug therapy.

For the last 5 years, immunotherapy of the troops under soldier, represented by monoclonal antibodies against PD-1, PD-L1, CTLA-4, has become a further potential means of treating NSCLC following surgery, chemotherapy, targeted therapy. However, the effective rate of PD-1 antibody alone is only 20%; the result consistency of the different detection methods of PD-L1 is low, and the duration of the therapeutic effect is yet to be verified. As with any previous chemotherapeutic drug, the immune monoclonal antibodies also face significant drug resistance problems, including primary drug resistance, adaptive drug resistance, and acquired drug resistance.

Chimeric antigen receptor gene modified T cells (CAR-T) as "live agents" kill cancer cells by recognizing tumor antigen activated T cell proliferation, cytokine release, cytotoxic effects, and the like. CAR-T has achieved exciting results in the treatment of hematological tumors, but the clinical efficacy of CAR-T for treating solid tumors is currently still to be further validated due to the lack of specific tumor antigens for solid tumors. The toxic and side effects such as off-target toxicity, cytokine storm and the like generated by the CAR-T are yet to be overcome.

Overall, although some encouraging results have been achieved in the treatment of NSCLC in recent years. However, the existing treatments are effective on only a small proportion of patients, the overall therapeutic effect is not ideal, and the total survival rate of NSCLC in 5 years is still lower than 20%.

Long non-coding RNA (lncRNA) is a type of non-coding RNA that is generally greater than 200bp in length. The lncRNA imbalance can influence the processes of cell differentiation, proliferation, metabolism, apoptosis and the like, thereby playing an important role in the occurrence, development and metastasis of tumors. lncRNA that inhibits the development of tumorigenesis are referred to as tumor-inhibiting lncRNAs. Finding new tumor-inhibiting lncRNAs and elucidating their function is important for developing new therapeutic targets, and inhibitory lncRNAs have broad potential and application prospects in tumor treatment.

Disclosure of Invention

The invention aims to provide an application of lncRNA, a kit and a medicament, and aims to solve the technical problem that the existing non-small cell lung cancer (NSCLC) has limited diagnosis, treatment and prognosis effects.

In order to achieve the above purpose, the invention adopts the following technical scheme:

in one aspect, the invention provides an application of lncRNA in preparing a kit for diagnosing and/or prognosticating NSCLC; wherein the nucleotide sequence of the lncRNA is shown as SEQ ID No. 1.

In another aspect the invention provides a kit for the diagnosis and/or prognosis of NSCLC comprising a lncRNA molecule as shown in SEQ ID No. 1.

And, an application of lncRNA gene as target spot in screening or preparing medicine for preventing and/or treating NSCLC; wherein the lncRNA gene codes an lncRNA molecule shown as SEQ ID No. 1.

And, use of lncRNA in the manufacture of a medicament for the prevention and/or treatment of NSCLC; wherein the nucleotide sequence of the lncRNA is shown as SEQ ID No. 1.

And a medicament for preventing and/or treating NSCLC, which comprises a nucleotide sequence of lncRNA shown as SEQ ID No.1 and a pharmaceutically acceptable carrier.

And a group of interfering RNAs aiming at BRCAT54 gene targets, wherein the sequence of the BRCAT54 gene targets is shown as SEQ ID NO.1, and the interfering RNAs comprise at least one of first siRNA, second siRNA and third siRNA; wherein, the liquid crystal display device comprises a liquid crystal display device,

the sense strand sequence of the first siRNA is shown as SEQ ID NO.4, and the antisense strand sequence is shown as SEQ ID NO. 5;

the sense strand sequence of the second siRNA is shown as SEQ ID NO.6, and the antisense strand sequence is shown as SEQ ID NO. 7;

the sense strand sequence of the third siRNA is shown as SEQ ID NO.8, and the antisense strand sequence is shown as SEQ ID NO. 9.

Experimental analysis proves that the lncRNA shown as SEQ ID No.1 is highly expressed in the plasma of NSCLC patients before operation, and the expression level of the plasma after operation is obviously reduced; furthermore, the expression difference of lncRNA shown in SEQ ID No.1 between NSCLC cancer tissue/paracancer tissue, NSCLC patient plasma/healthy control group plasma, NSCLC cancer cell/normal lung bronchial epithelial cell was analyzed. The results show that the lncRNA is significantly higher in NSCLC cancer tissue, in NSCLC patient plasma, and in NSCLC cells than in paracancestral cancer tissue, healthy human plasma, and normal bronchial epithelial cells, respectively. The detection result proves that BRCAT54 is highly expressed in NSCLC, and the research result shows that the lncRNA has obvious capability of inhibiting the tumor activity of NSCLC cells, and is a newly discovered tumor inhibition lncRNA. Therefore, the lncRNA can be used for preparing a kit for diagnosing and/or prognosticating NSCLC and a medicament for preventing and/or treating NSCLC. Moreover, the lncRNA gene can be used as a target spot for screening or preparing medicines for preventing and/or treating NSCLC.

Drawings

FIG. 1 is a graph showing the results of the difference in the levels of BRCAT54expression in pre-operative/post-operative plasma of NSCLC patients in the examples of the present invention;

FIG. 2 is a graph showing the differential expression of BRCAT54 in NSCLC patients and healthy human plasma in accordance with the examples of the present invention;

FIG. 3 is a graph showing the results of differential expression levels of BRCAT54 in NSCLC cancer tissue and paracancerous tissue in examples of the present invention;

FIG. 4 is a graph showing the differential expression of BRCAT54 in NSCLC cancer cells and normal bronchial epithelial cells in accordance with the examples of the present invention;

FIG. 5 is a diagram of pcDNA3.1 plasmids used in the examples of the present invention;

FIG. 6 is a graph showing experimental results of inhibition of proliferation of NSCLC cells by overexpression of BRCAT54 in the examples of the present invention;

FIG. 7 is a graph showing experimental results of BRCAT54 knockdown promoting proliferation of NSCLC cells in examples of the present invention;

FIG. 8 is a graph showing experimental results of BRCAT54 overexpression inhibiting NSCLC migration and BRCAT54 knock-down promoting NSCLC migration in the examples of the present invention;

FIG. 9 is a graph showing experimental results of BRCAT54 overexpression promoting apoptosis of NSCLC cells and BRCAT54 knockdown inhibiting apoptosis of NSCLC cells in the examples of the present invention;

FIG. 10 is a graph of the results of an analysis of BRCAT54 overexpression in an embodiment of the invention to extend survival in NSCLC patients.

Detailed Description

In order to make the technical problems, technical schemes and beneficial effects to be solved more clear, the invention is further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.

In the embodiments of the present invention, the terms "first," "second," "third," and the like are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated.

The lncRNA provided by the embodiment of the invention is BRCAT54, and the BRCAT54 in NCBI gene library has another name called MRPS30-DT, and the gene ID of the BRCAT54 is 100506674; the nucleotide sequence is shown as SEQ ID No. 1.

In one aspect, embodiments of the invention provide an application of lncRNA in the preparation of a kit for diagnosing and/or prognosticating NSCLC; wherein the nucleotide sequence of the lncRNA is shown as SEQ ID No. 1.

Further, the primers for amplifying the nucleotide sequence of the lncRNA are shown as SEQ ID No.2 and SEQ ID No. 3.

Further, the kit also comprises a primer for amplifying the lncRNA, as shown in SEQ ID No.2 and SEQ ID No. 3. And, the kit further comprises a reagent for extracting total RNA; a reagent for reverse transcription of lncRNA into cDNA using total RNA as a template; reagents for real-time quantitative PCR of cDNA.

The embodiment of the invention also provides application of the lncRNA gene as a target spot in screening or preparing medicines for preventing and/or treating NSCLC; wherein the lncRNA gene codes lncRNA shown in SEQ ID No. 1.

The embodiment of the invention also provides an application of the lncRNA in preparing a medicament for preventing and/or treating NSCLC; wherein the nucleotide sequence of the lncRNA is shown as SEQ ID No. 1.

Further, the medicine comprises at least one of a recombinant vector of a nucleotide sequence of the lncRNA shown as SEQ ID No.1, a recombinant virus of a nucleotide sequence of the lncRNA shown as SEQ ID No.1 and a recombinant virus vector of a nucleotide sequence of the lncRNA shown as SEQ ID No. 1.

Wherein, the recombinant vector of the nucleotide sequence of the lncRNA shown in SEQ ID No.1 is obtained by cloning the nucleotide sequence of the lncRNA into an expression vector pcDNA3.1.

Specifically, the drug can be a drug for inhibiting the growth of NSCLC tumor cells, a drug for inhibiting the migration of NSCLC tumor cells and a drug for enhancing the apoptosis of NSCLC tumor cells.

Namely, the application of the BRCAT54 in preparing a product for inhibiting NSCLC tumor cell growth, the application of the BRCAT54 in preparing a product for inhibiting NSCLC tumor cell migration, and the application of the BRCAT54 in preparing a product for enhancing NSCLC tumor cell apoptosis. Such products include one of a pharmaceutical, therapeutic agent or agent, which may be used in a manner that includes use alone or in combination with other molecular components.

Finally, the embodiment of the invention also provides a group of interference RNA aiming at BRCAT54 gene targets, wherein the sequence of the BRCAT54 gene targets is shown as SEQ ID NO.1, namely the interference RNA can be aimed at BRCAT54 genes, and the interference RNA comprises at least one of first siRNA, second siRNA and third siRNA; wherein, the liquid crystal display device comprises a liquid crystal display device,

In one embodiment of the invention, the whole genome high throughput chip technology is used to analyze and compare the pre-operation/post-operation plasma lncRNAs expression differences of non-small cell lung cancer (NSCLC) patients, and quantitative PCR is used to verify the chip detection results. The analysis result shows that BRCAT54 is highly expressed in the plasma of NSCLC patients before operation, and the expression level of BRCAT54 in the plasma after operation is obviously reduced, which suggests that BRCAT54 (MRPS 30-DT) has high correlation with NSCLC tumor tissues.

In one embodiment of the invention, the quantitative PCR technique is used to analyze the difference in BRCAT54expression between NSCLC cancer tissue/peri-cancerous tissue, NSCLC patient plasma/healthy control plasma, NSCLC cancer cell/normal lung bronchial epithelial cell, respectively. The results indicate that BRCAT54 is expressed at significantly higher levels in NSCLC cancer tissue, in NSCLC patient plasma, and in NSCLC cells than in paracancestral tissue, healthy human plasma, and normal bronchial epithelial cells, respectively. The detection result proves that BRCAT54 is highly expressed in NSCLC.

In one embodiment of the invention, BRCAT54 overexpression vectors are constructed, and the BRCAT54 overexpression vectors are respectively transfected into NSCLC cell lines, so that the BRCAT54 overexpression is found to remarkably inhibit proliferation and migration capacity of NSCLC cells and induce apoptosis of the NSCLC cells. The research result shows that BRCAT54 has obvious capability of inhibiting the tumor activity of NSCLC cells, and BRCAT54 is a newly discovered tumor inhibition lncRNA.

In one embodiment of the invention, interfering RNA (siRNA) against BRCAT54 is synthesized, and after si-BRCAT54 is transfected into NSCLC cells, it is found that knocking down the expression of BRCAT54 promotes proliferation and migration of NSCLC cells and inhibits apoptosis of NSCLC cells.

In the embodiment of the invention, kaplan-Meier and multi-factor COX regression analysis show that NSCLC patients with high BRCAT54expression have longer survival time than patients with low BRCAT54expression, and the survival time difference has statistical significance.

Therefore, the embodiment of the invention discovers a new lncRNA with obvious anticancer activity: BRCAT54 provides scientific basis for new ideas of personalized accurate treatment scheme of NSCLC. And provides a BRCAT54 over-expression recombinant vector which has anticancer application value by inhibiting proliferation and migration of cancer cells and promoting apoptosis to inhibit tumor activity of NSCLC cells. And provides the primers related to the BRCAT54, and the primers can detect the expression level of the BRCAT54 in biological samples, thus providing a foundation for further researching the functions of the BRCAT54 in NSCLC cancer cells and developing medicaments for targeting the BRCAT 54.

The invention has been tested several times in succession, and the invention will now be described in further detail with reference to a few test results, which are described in detail below in connection with specific examples.

Example 1 selection of BRCAT54 and expression differential analysis thereof

1. Study selection and grouping

Adult (18 years or more) NSCLC cases meeting the requirements of research conditions and healthy controls matched with the case ages are collected from a first affiliated hospital of Shenzhen university (Shenzhen second people hospital). Study subjects all signed informed consent. The study protocol was approved by the medical ethics committee of hospitals.

Diagnosis of NSCLC is carried out according to diagnosis standards related to Chinese primary lung cancer diagnosis and treatment Specification (2015 edition), and a case with clear diagnosis of pathology is taken as a research case. The NSCLC patient has no operation or radiotherapy and chemotherapy treatment before blood sampling. Through analysis and arrangement of sample data, a specimen meeting the standard is selected as an lncRNA chip and a subsequent series of experimental samples verified by qRT-PCR:

group A: NSCLC-related lncRNA was screened using whole genome lncRNA chips for pre-operative/post-operative plasma analysis of NSCLC patients.

Group B: the results of the chip analysis were verified by qRT-PCR with independent plasma samples from NSCLC patients and healthy controls.

Group C: the differentially expressed candidate lncRNA was analyzed with NSCLC cancer tissue and paracancerous tissue.

Group D: analysis by qRT-PCR method was used to verify the difference in expression of lncRNA in NSCLC patients/healthy control plasma candidates.

Analysis and comparison of the plasma Whole genome lncRNA expression profiles of NSCLC patients before/after surgery

And 8 patients with NSCLC matched with the age are selected from the individuals meeting the conditions, and the whole genome lncRNA chip is used for analyzing and comparing the plasma lncRNA expression profile before operation and after operation to obtain relevant experimental data. The method comprises the following specific steps:

(1) Plasma/serum RNA was extracted with TRIzol reagent (Invitrogen life technologies) and worked up in a conventional manner. The extracted RNA was purified using the RNasey Mini Kit (Qiagen p/n 74104). By using

ND-1000 determination of RNA concentration and purity.

(2) Samples were labeled using Quick Amp Labeling Kit, one-Color (Agilent p/n 5190-0442), and labeled samples were purified using RNeasy Mini Kit (Qiagen p/n 74104) and NanoDrop ND-1000.

(3) Samples were hybridized using Agilent Gene Expression Hybridization Kit (Agilent p/n 5188-5242).

(4) Chips were washed with Gene Expression Wash Buffer (Agilent p/n 5188-5325), gene Expression Wash Buffer 2 (Agilent p/n 5188-5326), magnetic stir bar (Corning p/n 401435), magnetic stir plate (Corning p/n 6795-410), slide-starting disc, with Slide rack (Thermo Shandon p/n 121), respectively.

(5) After chip washing, scan was performed using Agilent DNA Microarray Scanner. Chip signal values were collected using Agilent Microarray Scanner (Agilent p/n G2565 BA). Chip normalization and selection of differentially expressed lncRNAs and mRNAs was performed using Agilent GeneSpring GXv12.1 software and GO and KEGG analyses were performed on the differential lncRNAs and mRNAs.

(6) The preoperative/postoperative plasma lncRNA expression differences were compared with fold change (t-test).

(7) Whole genome lncRNAs and mRNAs chip analysis results: compared with preoperative, the plasma of NSCLC patients has 826 increase in lncRNA expression and 359 decrease in lncRNA expression (Fold change ≡ 2.0; P value < 0.01).

Measurement of plasma lncRNA expression level by qRT-PCR method

(1) According to the analysis result of the lncRNA chip, selecting lncRNAs meeting the following conditions, and further verifying the chip measurement result by using a qRT-PCR method: the difference expression is more than or equal to 4.0 before operation and the P value is less than 0.001 after operation. The lncRNA selected for validation is shown in tables 1 and 2.

(2) Total RNA extraction: shaking a 1.5ml centrifuge tube for 2min, and incubating for 5min at room temperature; chloroform was added to 0.2ml chloroform/1 ml Trizol and shaken well for 20s;12000g, centrifuging at 4 ℃ for 10min; the supernatant (0.5 ml supernatant/1 ml Trizol) was pipetted into a new centrifuge tube and isopropanol was added at 0.5ml isopropanol/1 ml Trizol; mixing, and freezing at-20deg.C for 30minThe method comprises the steps of carrying out a first treatment on the surface of the Centrifuging 12000g at 4 ℃ for 10min, discarding supernatant to retain RNA precipitate; RNA pellet was washed with 1ml of 75% ethanol/1 ml Trizol, and 75% ethanol was added; mixing, and freezing at-20deg.C for 30min;7500g, centrifuging at 4deg.C for 5min, discarding supernatant, and retaining RNA precipitate; opening the EP pipe cover for 10min to evaporate the residual ethanol naturally; mu.l of RNase-free ddH was added ₂ O, dissolving RNA precipitate at room temperature for 10min; detecting the quality of the RNA samples by electrophoresis, measuring the OD260/OD280 of each RNA sample by a spectrophotometer, and calculating the total RNA concentration and the magazine pollution degree;

(3) Preparing cDNA: the cDNA mixed reaction solution was prepared by using a TaKaRa PrimeScript II 1st Strand cDNA Synthesis Kit (D6210A) kit. 700ng of RNA; 1 μl of gene specific primer mix (10 uM); dNTPs Mix (2.5 mM) 1.6. Mu.l; adding RNase-free H ₂ O to a total volume of 14.5. Mu.l. The mixture was placed on ice for 2 minutes in a 65℃water bath for 5 minutes. After centrifugation, RT reaction solution was added sequentially to the centrifuge tube: 5 XFirst-Strand Buffer 4. Mu.l; 0.1M DTT 1 μl; RNase inhibitor 0.3 μl; superScript III RT 0.2.2. Mu.l. After mixing, the temperature was kept at 37℃for 1 minute. Incubation at 50℃for 60 min; the enzyme is inactivated by incubation at 70 ℃ for 15 minutes; the cDNA is placed in ice bath for standby or preserved at-20 ℃.

(4) qRT-PCR reaction: all cDNA samples were separately configured into Real time PCR reaction systems. The system configuration is as follows: 2 XMaster Mix 5 μl;10uM PCR specific primer F0.5. Mu.l; 10uM PCR specific primer R0.5 μl; water was added to a total volume of 8. Mu.l. Centrifuge briefly at 5000 rpm. Sample adding: a. mu.l of the mixture was added to each well corresponding to the 384-PCR plate; b. then adding 2 μl of cDNA; c. carefully adhering a Sealing Film of a Sealing Film, and centrifugally mixing for a short time; c. placing the prepared PCR plate on ice before setting up the PCR program; the 384-PCR plate was placed on a Real time PCR apparatus for PCR reaction. The PCR plate was placed on a PCR instrument for PCR reactions as follows: 95 ℃ for 10min;40 PCR cycles (95 ℃,10 seconds; 60 ℃,60 seconds (fluorescence collected)). To establish a melting curve of the PCR product, after the amplification reaction was completed (95 ℃,10 seconds; 60 ℃,60 seconds; 95 ℃,15 seconds), the mixture was slowly heated from 60 ℃ to 99 ℃ (instrument automated-Ramp Rate was 0.05 ℃/sec). Results and calculations: performing Real time PCR reaction on target lncRNA or mRNA of each sample and internal reference beta-actin respectively; data acquisitionWith 2 ^-△△ Analysis was performed by CT method.

(5) qRT-PCR assay results showed significant differences in expression between the two groups of plasma lncRNAs pre/post-operative in NSCLC patients, as shown in Table 1. Specifically, BRCAT54expression level differences are shown in fig. 1: the Relative expression level of BRCAT54 (Relative BRCAT54expression level) is significantly higher before surgery (pre-operation) than after surgery (post-operation).

TABLE 1

lncRNA name	Preoperative method	Postoperative course	Multiple of difference	P-value
					RRM-AS1	0.0148	0.00732	2.02	0.0159
TLN2	0.00571	0.00212	2.69	0.0025
					TAPT1-AS1	0.129	0.0541	2.38	0.0496
BRCAT54	0.07	0.03	2.53	0.0225

4. Differential expression qRT-PCR experiment first stage verification of plasma lncRNAs in NSCLC patient and healthy control group

The qRT-PCR assay data are shown in Table 2, and show that the plasma BRCAT54 shows the highest value and the smallest value of the difference times in the plasma of NSCLC patients and healthy control groups. Specifically, BRCAT54expression level differences are shown in fig. 2: the expression level of BRCAT54 is significantly higher in the NSCLC patient group than in the Healthy Control group (health Control). It is suggested that BRCAT54 may play an important role in NSCLC. Therefore, we selected BRCAT54 for further functional and clinical analysis.

TABLE 2

Comparison of the differences in expression of BRCAT54 in cancerous and paracancerous tissues

(1) Tissue sample total RNA extraction: after grinding the tissue samples to powder in a mortar with liquid nitrogen, 1ml Trizol was added per 0.1g of tissue and transferred to a 1.5ml centrifuge tube. The procedure for extracting total RNA was followed as described above for Trizol method.

(2) The expression level of BRCAT54 in NSCLC cancer tissues and corresponding paracancerous tissues was analyzed by qRT-PCR 8, and the detection results are shown in fig. 3: BRCAT54 was shown to be significantly higher in NSCLC cancer tissue (Tumor) than in paracancerous tissue (Adjacent) (p=0.0036).

Comparison of expression differences of BRCAT54 in NSCLC cancer cells and normal tracheal epithelial cells

(1) Cell sample total RNA extraction: according to 10 ⁷ The amount of cells was added to 1mL of Trizol, and the procedure for extracting total RNA was performed according to the Trizol method described above.

(2) The expression level of BRCAT54 in 3 NSCLC cell lines (a 549, H226, PC 9) and normal lung tracheal epithelial cells (bias 2 b) was analyzed by qRT-PCR, and the detection results showed that BRCAT54 was significantly higher in all 3 NSCLC cells than in normal cells, as shown in fig. 4.

In addition, BRCAT54 overexpression prolonged NSCLC patient survival as shown in figure 10: NSCLC patients with higher (High) BRCAT54expression levels have a relatively higher survival rate (Survival Probability).

Example 2 inhibition of proliferation, migration, and promotion of apoptosis of NSCLC cells by high expression of BRCAT54

1. Construction of BRCAT54 overexpression plasmid:

primers were designed based on the sequence of BRCAT54 (NR_ 109862) in NCBI database as follows:

upstream primer

SEQ ID No.2：5′CCCAAGCTTAGTCGTGGTTTCCTGCGTTTGTAGA3′；

Downstream primer

SEQ ID No.3：5′CCGCTCGAGAGCATGATTCCCTGAGATAGGGTTT3′。

The above primers were used to amplify the human full-length BRCAT54 sequence (1395 bp). And cloning the target fragment into an expression vector pcDNA3.1 (Life, USA), wherein the map is shown in FIG. 5 and finally named pcDNA3.1-BRCAT54, and the insertion interval of the BRCAT54 is between HindIII and XhoI.

The primers are used for amplifying the target genes by PCR, then the pcDNA3.1 plasmid is digested by HindIII and XhoInei endonucleases, and the target genes and vector quantity 3:1 to 8:1 (vector 1. Mu.l, gene 1. Mu.l, T4ligase 0.5. Mu.l, 10 Xligase Buffer 1. Mu.l, ddH) ₂ O To 10 μl), ligation was completed at 14-16 ℃ for 16hrs, the ligation product heat shock method was used To transform E.coli competent cells, positive colonies were identified by PCR, and a generation sequencing verification was performed using sequencing primers.

Construction of sirna: 3 interfering siRNAs and an siRNA control were designed according to the BRCAT54 sequence, respectively:

(1)S154：

the sense strand F (5 '-3') is GUCAGCAAUGUGAUGGUGUUU (SEQ ID No. 4),

the antisense strand R (5 '-3') is ACACCAUCACAUUGCUGACUU (SEQ ID No. 5);

(2)S155：

the sense strand F (5 '-3') is CACAUAACACCUUCACUAG UU (SEQ ID No. 6),

the antisense strand R (5 '-3') is CUAGUGAAGGUGUUAUGUGUU (SEQ ID No. 7);

(3)S156：

the sense strand F (5 '-3') is GUAAGUGUCUGAUUUCACAUU (SEQ ID No. 8),

the antisense strand R (5 '-3') was UGUGAAAUCAGACACUUACUU (SEQ ID No. 9).

(4)siRNA NCS20

The sense strand F (5 '-3') is UUCUCUCUCCGAACGUCGUCACGUTtDT,

the antisense strand R (5 '-3') was ACGUGACACGUUCGGAGAA dTdT.

3. Cell grouping: air culture control group, blank control group (Blank), empty plasmid Vector group (Empty Vector, or VEC for short), over-expressed BRCAT54 plasmid group (pcDNA3.1-BRCAT 54, VEC BRCAT54 for short), interference control group (scrambled, containing a sequence similar to BRCAT 54), siRNAa group (i.e., siBRCAT54 a, using the above S154 interference siRNA control), siRNAb group (i.e., siBRCAT54 b, using the above S155 interference siRNA control).

4. Cell transfection: cells in the logarithmic growth phase were digested with trypsin, counted and seeded in 6-well plates and diluted with Opti-MEM for transfection. Growing for about 24 hours until the cells grow fully, and respectively transfecting with Lipofectamine 2000. Plasmid pcDNA3.1-BRCAT54 is added into the BRCAT54 over-expression group for transfection, and the empty plasmid pcDNA3.1 is transferred into the negative control group, and the blank control group is not treated. Standing for 10-20 min, placing at 37deg.C and 5% CO ₂ The cell culture box is incubated for 24 to 48hrs, and then the cells are collected for downstream experimental detection.

5. Cell proliferation assay: log phase cells were collected, cell suspension concentration was adjusted, 100uL per well was added, and 2000 cells per well were seeded into 96-well plates. 37 ℃,5% CO ₂ The incubation was carried out overnight,balancing endoFectin-Lenti, plasmid or siRNA and serum-free DMEM to +15-25 ℃; diluting a proper amount of plasmid with serum-free DMEM medium, and diluting the endoFectin-Lenti reagent with the same medium; gently swirling the plasmid solution, adding diluted endoFectin-Lenti reagent dropwise, fully and uniformly mixing, and standing at room temperature for 10-25 min to form a DNA-endoFectin-Lenti compound; dropwise adding the DNA-endoFectin-Lenti compound into a culture dish, and shaking while adding; 37 ℃,5% CO ₂ Culturing for 24h; mu.L of CCK8 solution was added to each well, incubation was continued for 1-4h, and the culture was terminated. The absorbance at 450nm was measured with a microplate reader.

6. The results of the cell proliferation experiments are shown in FIGS. 6 and 7, and compared with no-load vector (Empty Vector), the PC9 cell proliferation activity can be significantly inhibited by the overexpression of pcDNA3.1-BRCAT54 (Rate of Cell Proliferation). PC9 cell proliferation was promoted following siRNA transfection (i.e., si BRCAT54, including S154, S155, and S156) interference compared to scrambled.

7. Cell invasion assay: after the cells grow to 70-80%, carrying out serum-free treatment for 12-24h, and grouping; before the experiment, the transwell chamber paved with extracellular matrix is hydrated with serum-free culture medium overnight; the transfected cells were digested with pancreatin and counted in the form of cell suspension with the same number of cells per group as 1.2X10 ⁴ /ml; after 700. Mu.l of medium containing 15% FBS serum was added to the lower chamber of the transwell chamber with the extracellular matrix laid thereon, the chamber was gently placed thereon; 200 μl of the prepared cell suspension is added into the upper chamber, and the mixture is placed into an incubator for culturing for 24 hours; taking out the upper chamber, placing into another clean 24 plate hole, washing with PBS for 3 times, adding 200 μl of pure methanol, fixing cells for 15min, sucking out, adding 200 μl of crystal violet, and dyeing for 15min; sucking out crystal violet, adding PBS and cleaning for 2 times; the cell number was calculated by randomly selecting 5 fields using phase contrast microscopy.

8. Cell invasion experiments are shown in figure 8: a is Blank, B is empty plasmid Vector (VEC), C is over-expressed BRCAT54 plasmid (vecbRCAT 54), D is interference control (scrambled), E is siRNAa (i.e., siBRCAT54 a), and F is siRNAb (i.e., siBRCAT 54B). The cell invasion rate of transfected sibracat 54 was increased compared to scrambled; the cell invasion rate of transfected vecBRCAT54 was reduced compared to VEC.

9. Apoptosis experiments: adjusting the concentration of the test cells to 5×10 ⁵ About one/ml. 1ml of cells were centrifuged at 1000rpm at 4℃for 5 minutes and the supernatant was discarded. 1ml of cold PBS was added and the cells were suspended by gentle shaking. Binding Buffer (4ml Binding Buffer+12ml deionized water) was diluted 1:3 with deionized water. Cells were resuspended in 250. Mu.l Binding Buffer and the concentration was adjusted to 1X 10 ⁶ /ml. Mu.l of the cell suspension was taken in a 5ml flow tube and 5. Mu.l of Annexin V/FITC and 10. Mu.l of 20. Mu.g/ml PI solution were added. After mixing, incubate for 15 minutes at room temperature in the dark. 400 μl PBS was added to the reaction tube and analyzed by flow cytometry.

10. Apoptosis experiments are shown in fig. 9: apoptosis rate (Apoptotic rate) decreased after BRCAT54 interference compared to the scrambled control; the apoptosis rate increased after BRCAT54 was overexpressed compared to VEC.

The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, and alternatives falling within the spirit and principles of the invention.

Sequence listing

<110> Shenzhen university

<120> use of lncRNA, kit and medicament

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1395

<212> DNA

<213> Homo sapiens

<400> 1

agtcgtggtt tcctgcgttt gtagatggaa ggaagaactt gtgtgcttag acctgacgct 60

gggaggagat gctgccacct aggttacttg taggacccta tacggcaacc tcctttgcca 120

ggaactattt ataaacatcc tgcaggaaaa tgcagtgaag tagaagagac agggatatcc 180

cagaaggtta tgcaaaacat caagagaaga tgagaggagt ctatatgtca gaatacacat 240

ttcccacctt gcccaacagt agaaaaacat aagaagagaa aaacattaaa aaatgacaag 300

gaagttaatg gaagtcagca atgtgatggt gtttggaggt ggagccttca gaaggtaatt 360

aatgcccttg taagaagagg ccagagagct tgcgcacctt cttcctgcca tgtgaggagc 420

caagaagccg gctgtctgca acctgcaaga ggaccctcac tagaagctag ccatactggc 480

atcctcatct tggctttcca acttccagaa ctgtgagaag tatatgtttg tggtttagtc 540

aatggtctat ggtaattttt ttatagcagt cccagccaag acagtgcctc atttactaca 600

taccatttat attattatat aggctccttt cagaaaccca tgttcaaata agagataaga 660

tactgaaaca cataacacct tcactagttt ttagtataca aatattgaga aatagtttgt 720

tattaactat ctcatccaag aaatgcagat tcatgttgtt tctaattttt tatatataat 780

tgacaaaatg aagaaactta acaccatcct agattttagc tgcccaaaga atgaaaagaa 840

tgaaaaaaaa atctttgaaa acccacaagt gatatggatc taatttatgg ttaaatagat 900

atagataaca aacagaatac gcctgtttaa aactgttaaa atgacattgg ttctaattat 960

acttttattt aaattgaaag acaaggcatt tatatggtat ctctaaccat cacaactttt 1020

gtgtgacaaa aagaaattat caccaaaata cacctcctta agtaagtgtc tgatttcaca 1080

cttccagaaa aagtgctctt tctggtcaag ccagcaagaa ttgagaaaga ttaagaaagt 1140

gcttcaaaga tgtttattaa aaagttgtca taaaaatgtg aagtagatgt agcatcaagc 1200

ataccaaata aagtaaaact gtcatcaaga agattcaaca gctatgaaaa gagttcttca 1260

aaatatgata tgtttttcta gatgataata aaatttatca attccaaatg tccacattag 1320

tctttcataa agacaccaat gagtcacagg aaaaaaaatt aaaaataaaa aaaccctatc 1380

tcagggaatc atgct 1395

<210> 2

<211> 34

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

cccaagctta gtcgtggttt cctgcgtttg taga 34

<210> 3

<211> 34

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

ccgctcgaga gcatgattcc ctgagatagg gttt 34

<210> 4

<211> 11

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gucagcaaug ugaugguguu u 11

<210> 5

<211> 11

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

acaccaucac auugcugacu u 11

<210> 6

<211> 11

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

cacauaacac cuucacuagu u 11

<210> 7

<211> 11

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

cuagugaagg uguuaugugu u 11

<210> 8

<211> 11

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

guaagugucu gauuucacau u 11

<210> 9

<211> 11

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

ugugaaauca gacacuuacu u 11

Claims

1. Use of a reagent for detecting lncRNA expression levels in the preparation of a kit for prognostic evaluation of NSCLC; the nucleotide sequence of the lncRNA is shown as SEQ ID No. 1.

2. The use of claim 1, wherein the reagent comprises a primer for amplifying the nucleotide sequence of the lncRNA, the primer having the nucleotide sequence shown in SEQ ID No.2 and SEQ ID No. 3.

3. Use of an overexpression vector of lncRNA gene in the preparation of a medicament for treating NSCLC; wherein the sequence of the lncRNA gene is shown as SEQ ID No. 1.

4. The use of claim 3, wherein the over-expression vector comprises a recombinant vector encoding a nucleotide sequence of lncRNA as set forth in SEQ ID No. 1.

5. The use of claim 3, wherein the over-expression vector comprises a recombinant virus encoding a nucleotide sequence of lncRNA as set forth in SEQ ID No. 1.

6. The use of claim 3, wherein the over-expression vector comprises a recombinant viral vector encoding a nucleotide sequence of lncRNA as set forth in SEQ ID No. 1.