CN110129447A - Application of the PQBP1 in Diagnosis of Ovarian Cancer - Google Patents
Application of the PQBP1 in Diagnosis of Ovarian Cancer Download PDFInfo
- Publication number
- CN110129447A CN110129447A CN201910471028.6A CN201910471028A CN110129447A CN 110129447 A CN110129447 A CN 110129447A CN 201910471028 A CN201910471028 A CN 201910471028A CN 110129447 A CN110129447 A CN 110129447A
- Authority
- CN
- China
- Prior art keywords
- pqbp1
- ovarian cancer
- expression
- oophoroma
- apoptosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57449—Specifically defined cancers of ovaries
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4703—Regulators; Modulating activity
- G01N2333/4704—Inhibitors; Supressors
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Animal Behavior & Ethology (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Urology & Nephrology (AREA)
- Veterinary Medicine (AREA)
- Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides application of the PQBP1 in Diagnosis of Ovarian Cancer.The present invention it has been investigated that, PQBP1 high expression in ovarian cancer patients, and promote by the clear PQBP1 of internal and external function test the proliferation and invasion migration of ovarian cancer cell.In addition, research discovery PQBP1 can influence the alternative splicing of endogenous Bcl-x, it is in particular in the expression for promoting suppression apoptosis transcript Bcl-xL, inhibits the expression for promoting apoptosis transcript Bcl-xS, to finally inhibit the apoptosis of ovarian cancer cell.Show that PQBP1 is a kind of splicing factor for participating in oophoroma occurrence and development, can be used as the biomarker and therapy target of oophoroma, the value with good practical application.
Description
Technical field
The invention belongs to biological medicines and technical field of molecular biology, and in particular to PQBP1 is in Diagnosis of Ovarian Cancer
Using.
Background technique
Disclosing the information of the background technology part, it is only intended to increase understanding of the overall background of the invention, without certainty
It is considered as recognizing or implying in any form that information composition has become existing skill well known to persons skilled in the art
Art.
Oophoroma is the common malignant tumour of female sex organ, and case fatality rate occupies always first of gynecologic malignant tumor.It is high
Rank serous ovarian cancer (High-grade Serous Ovarian Cancer, HGSOC) is the highest hypotype of grade malignancy,
The 70%~80% of oophoroma is accounted for, and has the characteristics that incidence of occult, invasive ability be strong, poor prognosis.Most of ovarian cancer patients
Due to lacking specific symptom and methods for screening, discovery Shi Duoyi is diagnosed as advanced stage, often dies of tumor recurrence and drug resistance, evening
5 years survival rates of phase patient are only 20%~30%.Therefore, the molecular mechanism of oophoroma occurrence and development is illustrated, screening is effective
Molecular target is of great significance for the early diagnosis and therapy of oophoroma.
Abnormal alternative splicing plays an important role in malignant tumour occurrence and development, and tumour cell passes through abnormal choosing
The montage of selecting property generates the montage isomery for being conducive to the behaviors such as tumor proliferation, apoptosis, anoxic, angiogenesis, immunologic escape and transfer
Body, and then promote the occurrence and development of tumour.The molecular mechanism with cancer progression of aberrant splicing are closely related in oophoroma.Seminar
It is found by transcript profile and proteome analysis.In signal path relevant to oophoroma occurrence and development, spliceosome access row
In first place, 134 master control splicing factors are further analyzed, discovery there are 33 to raise in oophoroma, prompts abnormal selectivity
Montage plays key effect in oophoroma.
There are the alternatively splicings of many genes transcript in oophoroma, and CD44s high is expressed in ovarian cancer cell, CD44v
Low expression, the EMT access that CD44s mediates TGF β 1 to induce by lowering splicing factor ESRP1, so that ovarian cancer cell be induced to invade
Migration is attacked, stem-like cell feature and drug resistance are then obtained；Osteopontin (OPN) transcript OPNc specific table in oophoroma
It reaches, rather than OPNa or OPNb, human epithelial ovarian carcinoma cells proliferation, migration, invasion, in-vivo tumour is promoted the malignant activities such as to form；Bcl-x
It is a member of apoptogene bcl-2 family, the pre-mRNA alternative splicing of Bcl-x gene generates Bcl-xS and Bcl-xL, this
Two kinds of hypotypes are related with promotion and inhibition apoptosis respectively, and the overexpression of Bcl-xL inhibits apoptosis of tumor cells, promotes transfer and change
Treatment drug resistance is simultaneously related with bad clinical prognosis, and Bcl-xS can induce Apoptosis, make cell to chemotherapy medicament sensitive.
Poly glumine Binding Protein 1, i.e. PQBP1 (polyglutamine binding protein 1, PQBP1)
It is one of the splicing factor for expressing up-regulation in oophoroma of seminar's discovery, is a upper highly conserved intellectual development of evolving
GAP-associated protein GAP, it is relevant " Renpenning syndrome " that mutation will lead to X chromosome.The transcription such as PQBP1 and rna plymerase ii
Factor interaction participates in transcriptional control.In addition to this, PQBP1 and multiple splicing factors interact, and participate in human cell
The alternative splicing of many genes mRNA.The PQBP1 of afunction reduces being associated with for SF3B1 and substrate mRNA, causes to select
Property splice mode occur significant changes.PQBP1 expression in oophoroma raises, but plays in oophoroma occurrence and development
What kind of effect, which aberrant splicing events specifically taken part in, need further to study.
Summary of the invention
In view of the above shortcomings of the prior art, the present invention provides application of the PQBP1 in Diagnosis of Ovarian Cancer.It is sent out through research
It is existing, PQBP1 high expression in ovarian cancer patients, and ovarian cancer cell is promoted by the clear PQBP1 of internal and external function test
Proliferation and invasion migration.In addition, research discovery PQBP1 can influence the alternative splicing of endogenous Bcl-x, it is in particular in
Promote the expression of suppression apoptosis transcript Bcl-xL, inhibits the expression for promoting apoptosis transcript Bcl-xS, to finally inhibit oophoroma
The apoptosis of cell.Show that PQBP1 is a kind of splicing factor for participating in oophoroma occurrence and development, can be used as the biomarker of oophoroma
Object and therapy target.
The present invention is achieved through the following technical solutions:
The first aspect of the invention provides application of the PQBP1 in preparation oophoroma molecular marker.
Further, the molecular marker is used to detect, diagnose or predict the progress of oophoroma.
The progress of the oophoroma includes the apoptosis of the proliferation of ovarian cancer cell, invasion migration and/or ovarian cancer cell.
The second aspect of the invention provides a kind of composition of progress for detecting, diagnosing or predict oophoroma,
Comprising detecting ovarian cancer samples based on high-flux sequence method and/or based on quantifying PCR method and/or based on probing procedure
The substance of middle PQBP1；Or the substance based on PQBP1 albumen in immunologic detection method detection ovarian cancer samples.
Further, the present invention provides a kind of kit, and the kit includes for detecting, diagnosing or predicting ovary
The composition of the progress of cancer；
The third aspect of the invention provides the substance for being able to suppress PQBP1 expression and/or activity reduction at following (a)-
(c) application at least one:
(a) inhibit the proliferation of ovarian cancer cell, or prepare the product for inhibiting human epithelial ovarian carcinoma cells proliferation；
(b) inhibit the invasion migration of ovarian cancer cell, or product of the preparation for inhibiting ovarian cancer cells invasion to migrate；
(c) promote the apoptosis of ovarian cancer cell, or prepare the product for promoting ovarian cellular apoptosis.
Further, the PQBP1 inhibits oophoroma thin by regulation Bcl-x apoptogene alternative splicing signal path
The apoptosis of born of the same parents；Specifically, the PQBP1 can promote the expression for pressing down apoptosis transcript Bcl-xL, inhibit to promote apoptosis transcript
The expression of Bcl-xS, to inhibit the apoptosis of ovarian cancer cell.
The fourth aspect of the invention, provides a kind of for preventing or treating the pharmaceutical composition of oophoroma, and it includes suppressions
The substance that PQBP1 expression processed and/or activity reduce；
The substance for inhibiting PQBP1 expression and/or activity to reduce, including functional using the microRNA based on RNA
Acquisition technology, and/or slow virus shRNA perturbation technique lower PQBP1 expression and/or inhibit its activity；Preferably PQBP1 antagonism
Agent or inhibitor；Wherein, the PQBP1 antagonist includes the shRNA artificial synthesized according to PQBP1；
In the present invention, " treatment or prevention " refer to being able to suppress the proliferation of ovarian cancer cell, invasion migration and/or promote
Into ovarian cellular apoptosis.
The invention has the advantages that:
1. the present invention provides effective molecular marked compound for the diagnosis of oophoroma, condition assessment and Index for diagnosis: the present invention
By the verifying of a large amount of clinical samples, demonstrated using the methods of qPCR, western blot and immunohistochemical staining
PQBP1 high expression, potentiality with oophoroma molecular marked compound in ovarian cancer patients.
2. the present invention provides new target spot for the diagnosing and treating of oophoroma: the present invention passes through internal and external function test
It specifies PQBP1 and promotes the proliferation and invasion migration of ovarian cancer cell, and inhibit the apoptosis of cell.Above data proves, drops
Low endogenic PQBP1 can inhibit the malignant behaviors such as the growth of tumour, invasion.Based on this, specificity can be designed
PQBP1 inhibitor, thus achieve the purpose that treat oophoroma.
3. the present invention discloses the target spot Bcl-x key apoptotic gene of PQBP1 for the first time, Bcl-x is as apoptosis key gene
It is of great significance in the occurrence and development of oophoroma.It is new effective that the present invention is that the Targeted-control of apoptotic signal access has found
Ground method realizes the activation and inhibition of apoptosis pathway by PQBP1mimics/inhibitor；It is compared to platinum medicine suppression
Apoptosis pathway processed, the method targeting are stronger.
Detailed description of the invention
The Figure of description for constituting a part of the invention is used to provide further understanding of the present invention, and of the invention shows
Examples and descriptions thereof are used to explain the present invention for meaning property, does not constitute improper limitations of the present invention.
Fig. 1 is expression and clinical meaning figure of the PQBP1 in HGSOC in embodiment 1；Wherein, Figure 1A is database analysis
Genetic change of the PQBP1 in oophoroma；Figure 1B is in high-level serous ovarian cancer tissue and normal fimbriae tubae tissue
PQBP1mRNA comparision contents figure；Fig. 1 C is TCGA database analysis PQBP1 and ovarian cancer prognosis relational graph.
Fig. 2 is that slow virus expression system constructs PQBP1 and surely turns over expression figure related to low three kinds of cell line is struck, Tu2AWei
Inefficient figure is struck in qPCR, Western blotting detection；Fig. 2 B is that qPCR, Western blotting detection are overexpressed efficiency
Figure.
Fig. 3 is that PQBP1 promotes human epithelial ovarian carcinoma cells proliferation figure in embodiment 3；Wherein, Fig. 3 A is that PQBP1 promotes oophoroma
Cell Proliferation figure, plate clone enhance the evil of cancer cell experiments have shown that PQBP1 can promote ovarian cancer cell clonality
Property degree；Fig. 3 B is that PQBP1 promotes human epithelial ovarian carcinoma cells proliferation rate diagram, and MTT experiment proves to be overexpressed PQBP1 and control group phase
Than the multiplication rate of ovarian cancer cell is remarkably reinforced, and strikes low PQBP1 and compares with control group, and the proliferation rates of ovarian cancer cell are aobvious
Writing reduces；Fig. 3 C shows PQBP1 to the influence diagram of cycle signalling pathways albumen；Fig. 3 D shows PQBP1 to nude mice by subcutaneous tumor formation energy
The influence diagram of power.
Fig. 4 is that PQBP1 promotes gonad cell to invade transition graph in embodiment 3；Wherein, Fig. 4 A is that PQBP1 can promote ovum
Nest cancer cell invasion migration energy is tried hard to, and Transwell can significantly increase the pernicious journey of cancer cell experiments have shown that being overexpressed PQBP1
Degree, striking low PQBP1 can reduce the grade malignancy of ovarian cancer cell；Fig. 4 B is that PQBP1 can influence EMT pathway associated protein
Expression figure, the expression of the albumen such as Snail, Slug, Vimentin can be promoted by being overexpressed PQBP1, and striking low PQBP1 can reduce
The expression of EMT related pathways albumen and then the invasion transfer ability for promoting ovarian cancer cell.
Fig. 5 is that PQBP1 inhibits ovarian cellular apoptosis correlation figure in embodiment 3；Flow cytometry proves to be overexpressed PQBP1
Ovarian cancer cell line Apoptosis number be significantly lower than control group, the ovarian cancer cell line Apoptosis number for striking low PQBP1 is obvious
Higher than control group；Western blot experiment shows that being overexpressed PQBP1 can reduce the expression of Bax albumen, promote Bcl-2 albumen
Expression；The expression of Bax albumen can be promoted by striking low PQBP1, reduced the expression of Bcl-2 albumen and then inhibited ovarian cancer cell hair
Raw apoptosis.
Fig. 6 is the alternative splicing correlation figure that PQBP1 regulates and controls Bcl-x in embodiment 5；Fig. 6 A is that PQBP1 can influence one
The relevant alternative splicing of serial antiapoptotic factors, including Bcl-x；Fig. 6 B can be seen that PQBP1 can promote to press down apoptosis turn
The expression of this Bcl-xL is recorded, the expression for promoting apoptosis transcript Bcl-xS is inhibited.Fig. 6 C shows that PQBP1 regulates and controls exogenous Bcl-x's
Alternative splicing correlation figure；Gradient is overexpressed PQBP1 and the gradient of suppression apoptosis transcript Bcl-xL is promoted to be overexpressed, and promotes apoptosis
The gradient of transcript Bcl-xS reduces, and separately verifies in 293T and HeLa cell.
Specific embodiment
It is noted that following detailed description is all illustrative, it is intended to provide further instruction to the application.Unless another
It indicates, all technical and scientific terms used herein has usual with the application person of an ordinary skill in the technical field
The identical meanings of understanding.
It should be noted that term used herein above is merely to describe specific embodiment, and be not intended to restricted root
According to the illustrative embodiments of the application.As used herein, unless the context clearly indicates otherwise, otherwise singular
Also it is intended to include plural form, additionally, it should be understood that, when in the present specification using term "comprising" and/or " packet
Include " when, indicate existing characteristics, step, operation, device, component and/or their combination.It should be understood that protection model of the invention
It encloses and is not limited to following specific specific embodiments；It is also understood that term used in the embodiment of the present invention is to retouch
Specific specific embodiment is stated, rather than limiting the scope of protection of the present invention.If not in following detailed description
The experimental method of actual conditions is indicated, it is this usually according to the conventional method and condition of the molecular biology in art technology
Technology and condition have complete explanation in the literature.See, for example, Sambrook et al., described in " molecular cloning: laboratory manual "
Technology and condition, or according to the normal condition proposed by manufacturer.
In the specific embodiment of the present invention, application of the PQBP1 in preparation oophoroma molecular marker is provided.
In still another embodiment of the invention, application of the PQBP1 in preparation oophoroma molecular marker, institute
Marker is stated for detecting, diagnosing or predicting the progress of oophoroma.
The progress of the oophoroma includes the apoptosis of the proliferation of ovarian cancer cell, invasion migration and/or ovarian cancer cell；
In still another embodiment of the invention, the oophoroma is high-level serous ovarian cancer (HGSOC).
In still another embodiment of the invention, a kind of progress for detecting, diagnosing or predict oophoroma is provided
Composition, it includes detect based on high-flux sequence method and/or based on quantifying PCR method and/or based on probing procedure
The substance of PQBP1 in ovarian cancer samples；Or the substance based on PQBP1 albumen in immunologic detection method detection ovarian cancer samples.
In still another embodiment of the invention, using solution hybridization, Northern hybridization, RNA chip, in situ hybridization
Detect PQBP1 in ovarian cancer samples；Using enzyme linked immunosorbent assay (ELISA), colloidal gold detection, protein immunoblotting, protein core
Piece detects PQBP1 albumen in ovarian cancer samples；
In still another embodiment of the invention, the present invention provides a kind of kit, and the kit includes for examining
The composition of the progress of survey, diagnosis or prediction oophoroma；
In still another embodiment of the invention, the primer for detecting PQBP1, the primer packet are contained in the composition
It includes:
PQBP1 upstream primer: 5 '-ACCCTAGCTCATACTCAGACG-3 ' (SEQ ID NO.1)；
PQBP1 downstream primer: 5 '-TCTTGGCCTCATTCCGCTTG-3 ' (SEQ ID NO.2).
In still another embodiment of the invention, provide be able to suppress PQBP1 expression and/or activity reduce substance exist
As follows (a)-(c) it is at least one in application:
(a) inhibit the proliferation of ovarian cancer cell, or prepare the product for inhibiting human epithelial ovarian carcinoma cells proliferation；
(b) inhibit the invasion migration of ovarian cancer cell, or product of the preparation for inhibiting ovarian cancer cells invasion to migrate；
(c) promote the apoptosis of ovarian cancer cell, or prepare the product for promoting ovarian cellular apoptosis.
In still another embodiment of the invention, the PQBP1 passes through regulation Bcl-X apoptogene alternative splicing letter
Number access inhibits the apoptosis of ovarian cancer cell；Specifically, the PQBP1 can promote the expression for pressing down apoptosis transcript Bcl-XL,
The expression for inhibiting rush apoptosis transcript Bcl-XS, to inhibit the apoptosis of ovarian cancer cell.
In still another embodiment of the invention, provide it is a kind of for preventing or treating the pharmaceutical composition of oophoroma,
It includes the substances for inhibiting PQBP1 expression and/or activity to reduce；
The substance for inhibiting PQBP1 expression and/or activity to reduce, including functional using the microRNA based on RNA
Acquisition technology, and/or slow virus shRNA perturbation technique lower PQBP1 expression and/or inhibit its activity；Preferably PQBP1 antagonism
Agent or inhibitor；Wherein, the PQBP1 antagonist includes the shRNA artificial synthesized according to PQBP1；
It is as follows comprising sequence when the shRNA sequent synthesis in still another embodiment of the invention:
Positive oligonucleotides (Forward oligo): 5 '-CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCA
TTCCAGTAGTAAGGGTTTTTG-3'(SEQ ID NO.3)；
Reverse oligonucleotide (Reverse oligo): 5 '-AATTCAAAAACCCTTACTACTGGAATGCAGACTCGAG
TCTGCATTCCAGTAGTAAGGG-3’(SEQ ID NO.4)。
In still another embodiment of the invention, " treatment or prevention " refer to the increasing for being able to suppress ovarian cancer cell
It grows, invade migration and/or promote ovarian cellular apoptosis.
In still another embodiment of the invention, described pharmaceutical composition is solid orally ingestible, liquid oral medicine
Or injection.
In still another embodiment of the invention, pharmaceutical dosage form be injectable implants, emulsion, liposome, microcapsules,
Microspheres agent, nanoparticle etc..Pharmaceutical composition applied dose can according to patient's weight, age and gender, health status, diet,
Administration time, administration method, excretion rate and disease severity and change.
Explanation is further explained to the present invention by the following examples, but is not construed as limiting the invention.It should be understood that
These examples are only for illustrating the present invention and are not intended to limit the scope of the present invention.In addition, unspecified in embodiment
Molecular biology method is the method for this field routine, and concrete operations can be referring to molecular biosciences guide or product description.
PQBP1 institute role in the clear oophoroma of embodiment 1
Seminar's early period finds PQBP1 high expression in HGSOC by transcript profile and proteome analysis, we are into one
Step enlarged sample is verified, and 16, the normal fimbriae tubae tissue of the ovary of collection, high-level serous ovarian cancer tissue are utilized
Totally 29, tissue RNA is extracted, qPCR detects the relative expression quantity of PQBP1mRNA, finds PQBP1 in high-level serosity ovary
Mrna expression amount is apparently higher than normal fimbriae tubae tissue (P < 0.05) (Figure 1B) in tissue.The discovery of TCGA database analysis
For PQBP1 there are gene magnification and mRNA high expression (11%) in HGSOC, further analysis finds the highly expressed patient of PQBP1
Poor prognosis, patient's good prognosis (Figure 1A and 1C) of PQBP1 low expression.In conclusion PQBP1 is in high-level serosity ovary
High expression in cancer, and it is closely related with patient's prognosis, and there is part amplification, up-regulation and point mutation etc. in oophoroma in PQBP1
It is genetically changed.Result above prompt PQBP1 may play a significant role during the occurrence and development of oophoroma.
2 PQBP1 of embodiment is overexpressed and strikes low plasmid construction
1. being overexpressed plasmid construction:
From the official website Addgene, purchase PQBP1 is overexpressed plasmid.PQBP1 objective gene sequence is building up to intermediate load first
On body PCDNA3.1 carrier, then it is connected on slow virus carrier PCMV by I restriction enzyme site of BamH and I restriction enzyme site of Xho.
2. striking low plasmid construction:
It is as follows from the corresponding shRNA sequence of the official website Sigma retrieval PQBP1:
Forward oligo:
5'CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGGTTTTTG3'；
Reverse oligo:
5'AATTCAAAAACCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGG3'；
Then the sequence is building up on PLKO.1 carrier by restriction enzyme site Age I and EcoR I.It will be overexpressed and strike and is low
Plasmid transiently transfects functioning cell 293T, and RNA is received after 48h, receives albumen after 72h, detects RNA and protein level respectively
The overexpression of PQBP1 and strike low situation.
The biological function that 3 PQBP1 of embodiment is played in ovarian cancer cell
The sequence of PQBP1 is connected on PCMV plasmid (official website OriGene is commercially available), is transfected after slow virus packaging
A2780 and SKOV3 cell, is screened using puromycin.Containing with western blot and qPCR detection PQBP1 after screening
Amount.Cell line tests the proliferative capacity to form experiment detection cell and Transwell experiment with plate clone after constructing successfully
Detect the invasive ability of cell.
1, surely turn cell line building:
(1) generation of virion
Take Phoenix amphotropic cell in good condition, collected by trypsinisation cell and after counting according to 3 ×
106 cell/ware density are inoculated in 100mm Tissue Culture Dish, and the cell culture fluid before transfection cannot contain antibiotic, put
Enter overnight incubation in cell incubator, observation carries out plasmid transfection when cell density reaches 70%-80%；
It prepares transfection composite: diluting the Plasmid DNA and 36 of 10 μ g respectively with the OPTI-MEM culture medium of 1.6ml serum-free
The liposome of μ l blows even rear incubation at room temperature 5min；
The two is mixed, blow even and avoids generating bubble, incubation at room temperature 20min or so is to form the mixing of DNA- liposome
Object；
Above-mentioned DNA- liposome complex is added in the culture dish for complete cell and is placed in incubator；
Taken out after culture 3h, 5ml OPTI-MEM culture medium added into culture dish, continue to cultivate 6h or so change later with
The DMEM complete medium of 6ml fresh antibiotic-free, puts back to and continues to cultivate in incubator；
The supernatant containing virion is collected in culture afterwards for 24 hours, is temporarily stored into 4 DEG C, and the fresh complete training of 6ml is added into ware
Support base；
Supernatant is collected after culture 48h again and mixes the supernatant collected twice, 20000rpm, 4 DEG C of centrifugation 2h are obtained
Virion precipitating；
Viral pellet is resuspended with 500 μ l culture mediums, carry out next step experiment or is stored in -80 DEG C.
(2) host cell is infected
It will be inoculated into 6 orifice plates to infection cell according to 3 × 104 cell/ml density, overnight incubation；
Bed board second day, every hole was added that (and the virion of 50 μ l concentration is infected containing 8 μ g/ml Polybreen.It shakes
Dynamic culture plate (cross rolling) makes its mixing.It is put into and continues to cultivate in incubator；
It after infecting 48h, inhales and abandons supernatant, culture medium of the replacement containing 2 μ g/ml puromycins is screened, and is observed every 2 days
Stable turn can be obtained once containing the culture solution of puromycin in cell growth state, replacement in every 3-4 days after persistently screening 2 weeks
Contaminate the cell of purpose plasmid.
2, plate clone: choosing logarithmic growth phase cell, membrane proteolytic enzyme digestion, and cell count, 400 cell per wells connect
Kind is cultivated about 10-14 days in 6 orifice plates, methanol fixed 15min, violet staining 30min.Under the microscope and counted.
3, MTT growth curve: selection logarithmic growth phase cell, trypsin digestion, cell count, 1000 cells are every
Sky is inoculated in 96 orifice plates, continuous detection 5 days, MTT processing, and the OD value of cell is surveyed in DMSO dissolution.Draw cell growth rate
Curve.
4, the clear PQBP1 of nude mice by subcutaneous tumor formation is acted in oophoroma: the control of 4 week old BALB/C Nude female mices and experiment
Group each 6.Control group injects HEY-PCMV-NC cell, and experimental group injects HEY-PCMV-PQBP1 cell, every injection 5,000,000
Cell, cell are diluted in 200 μ lPBS, are injected in subcutaneously.Mouse is put to death in anesthesia after 2 weeks, and tumor tissues is taken to be soaked in
In 10% formalin solution, then rear paraffin embedding is sliced, and HE dyeing and immunohistochemical staining are to observe tumour
Histiocytic form and number.
1, HE staining procedure
Roasting piece: 60 degree of roasting piece 30min.
Dewaxing: dimethylbenzene I15min --- dimethylbenzene 15min --- 100% alcohol 5min --- 100% alcohol
--- 95% alcohol 5min --- 80% alcohol 5min --- 75% alcohol 5min is rinsed 2-3 times in tap water 5min.
Haematoxylin dyeing 10min gently rinses slide with weep, it is to note that water flow is excessive to wash away tissue.
It hydrochloride alcohol 1-2 seconds, ammonium hydroxide 5-10 seconds, is rinsed 2-3 times in tap water.
Eosin stains 20min is rinsed 2-3 times in tap water.
Dehydration: 75% alcohol 10s --- 80% alcohol 10s --- 95% alcohol 10s --- 100% alcohol 10s ---
100% alcohol 10s --- dimethylbenzene I3min --- dimethylbenzene 3min.
2, immunohistochemical staining
Hydrodewaxing step is same as above.
Antigen retrieval: being added reparation liquid (sodium citrate) attached organized one side and upward, be placed in sink, the high fire of microwave
40s is heated, boiling to appear suspends 30 seconds.Enter the boiling of 15 circulations at this time.Open+48 seconds 12 seconds close, are cooled to
Room temperature (30min-60min)；3% hydrogen peroxide, 37 degree of incubation 15-20min, PBS shaking table wash 3 * 3min in wet box；Serum envelope
It closes: reagent A (blue liquid) 37 degree of incubation 25-30min is added dropwise；Add primary antibody: room temperature 2 hours, reagent adding B:37 degree was incubated for 15-
20min, PBS shaking table wash 3 * 3min；Reagent adding B:37 degree is incubated for 10-15min, and PBS shaking table washes 3 * 3min.
Add developing solution DAB, haematoxylin dyeing impregnates 2 seconds in hydrochloride alcohol --- 7-10 seconds in ammonium hydroxide；It is dehydrated (step
Ibid).
It is compared with control group, experimental group is overexpressed the one-tenth knurl ability that nude mice can be remarkably reinforced in PQBP1, no matter in tumor formation speed
In rate and tumor formation size, it is all apparently higher than control group, experimental result has statistical significance.PQBP1 is an oncogene, can
Proliferation, the invasion migration for promoting ovarian cancer cell, inhibit ovarian cellular apoptosis, can be obviously promoted the one-tenth knurl ability of nude mice.
4, Transwell:Matrigel:DMEM=10:1,50 μ l are added in the every hole of the mixed liquor, after being gelled admittedly, upper chamber
200 μ l cells and serum-free DMEM suspension (the 200000/hole A2780, the 100000/hole SKOV3) are added, lower room, which is added, contains 10%
The DMEM of FBS, after culture 48 hours, methanol is fixed, and is counted under the microscope after violet staining.
5, flow cytomery apoptosis: mentioning the previous day surely turns growth conditions are good cell line and is inoculated in 6cm ware,
With 30% hydrogen peroxide treatment 1h, cell is received, is washed one time with 1 × PBS, with 100 μ l1 × Annexin V Binding
Cell is resuspended in Solution, and 5 μ lPI and FITC dyestuffs, after 15 minutes, flow cytomery apoptosis cell are added.
For effect of further investigation PQBP1 during oophoroma occurrence and development, we utilize slow virus expression system structure
It has built PQBP1 and has been overexpressed and surely turned cell line with low expression.QPCR verifying and Western blotting detection PQBP1 express water
Flat, cell line constructs successfully (Fig. 2A and 2B).Plate clone is experiments have shown that PQBP1 can promote ovarian cancer cell Clone formation
Ability promotes human epithelial ovarian carcinoma cells proliferation, enhances the grade malignancy of cancer cell, such as Fig. 3 A.MTT experiment proves that PQBP1 promotes ovary
The multiplication rate of cancer cell is overexpressed PQBP1 and compares with control group, and the multiplication rate of ovarian cancer cell is remarkably reinforced, and strikes low
PQBP1 is compared with control group, and human epithelial ovarian carcinoma cells proliferation rate is substantially reduced, such as Fig. 3 B.Western blotting experiment display
PQBP1 influences the expression for the G1 phase stagnating GAP-associated protein GAP, and the table of CyclinD1, CyclinE albumen can be promoted by being overexpressed PQBP1
Reach, reduce the expression of P53, P27, P21 albumen and then inhibit human epithelial ovarian carcinoma cells proliferation, reduce PQBP1 can reduce CyclinD1,
The expression of the albumen such as CyclinE increases the expression of the albumen such as P53, P21, such as Fig. 3 C.The oophoroma built is overexpressed by we
PQBP1 surely turns (every group 5 × 10 of HEY cell line6A cell) it inoculates at nude mice upper limb armpit, nude mice tumor formation in one week.It was found that
Nude mice by subcutaneous one-tenth knurl ability can be remarkably reinforced by being overexpressed PQBP1, fast at efflux velocity, and the volume and weight of knurl is apparently higher than pair
According to group (* * * P < 0.001), two groups of data have statistical significance, such as Fig. 3 D.
Transwell is experiments have shown that the cell number for being overexpressed PQBP1 experimental group cell across Matrigel glue is significantly more than
Control group (P < 0.001) strikes low PQBP1 experimental group cell across the cell number of Matrigel glue significantly lower than control group (P
< 0.001), show that PQBP1 can promote the invasion of ovarian cancer cell to migrate, significantly increase the grade malignancy of cancer cell, such as schemes
4A.Western blotting tests the expression for having detected EMT pathway associated protein Marker, the results show that being overexpressed PQBP1
It can promote the table of the albumen such as interstitial expression correlation marker N-Cadherin, β-Catenin, Vimentin, Claudin-1
Reach, while also reducing the expression that epithelium expresses the albumen such as relevant marker E-Cadherin, ZO-1, strike low PQBP1 conversely,
Such as Fig. 4 B.
We handle ovarian cancer cell as inducer of apoptosis using certain density hydrogen peroxide, utilize flow cytometry
Have detected the ratio of apoptotic cell.The cell toatl proportion of low PQBP1 early apoptosis and late apoptic is struck in SKOV3, A2780 cell
The control group that compares is significantly raised (P < 0.001).PQBP1 experimental group early apoptosis is overexpressed in HEY cell line and advanced stage withers
Cell toatl proportion is died significantly lower than control group (P < 0.001), such as Fig. 5 A.Western blotting experiment detection apoptosis is related
The expression that low PQBP1 promotes Bax, reduces Bcl-2 albumen is struck in the expression of albumen, consistent with flow cytometry results, sees Fig. 5 B.
4 Bcl-x minigene plasmid construction of embodiment
The Bcl-x minigene sequence first part sequence of building is the first half of exons 1 and introne 2；Bcl-
X minigene second part sequence is 2 latter half of introne and exon 3.Bcl-x minigene sequence construct is arrived
On pcDNA3.1 carrier.The design of primers that Bcl-x minigene plasmid is related to is as follows:
Regulation relationship of the clear PQBP1 of embodiment 5 to Bcl-x
The primer of endogenous Bcl-xL and Bcl-xS transcript is designed, detection is overexpressed or strikes low PQBP1 to endogenous
The influence of Bcl-x alternative splicing.It is surely turning over expression or is striking the feelings for detecting endogenous Bcl-x in low PQBP1 cell line and expressing
Condition.It was found that PQBP1 can influence the alternative splicing of endogenous Bcl-x, the expression for pressing down apoptosis transcript Bcl-xL can be promoted,
Inhibit the expression of rush apoptosis transcript Bcl-xS.
Then the further influence of detection PQBP1 exogenous Bcl-x minigene alternative splicing, transiently transfects
293T, HeLa cell, gradient are overexpressed PQBP1, and gradient increases therewith for the expression of discovery Bcl-xL suppression apoptosis transcript, Bcl-xS
The expression gradient for promoting apoptosis transcript reduces, such as Fig. 6 C.
Transiently transfect step:
1. plating cells: generally taking passage twice, cell in good condition is transfected into bed board.Pancreatin digests-cultivate base weight
Outstanding cell-ECM counts, and according to the size of cell, and the difference of transfection purpose, is inoculated with different cell densities.Transfect matter
When grain, cell density is preferably controlled in 60%-80%.
2. preparing transfection composite: by taking six orifice plates as an example
DNA transfection method: by 2 μ g DNA, 4 μ l jetIt is added with 200 μ 1jet PRIME Buffer
In 1.5m1EP pipe, be vortexed concussion 10s, is incubated at room temperature 10min.Avoid that there are bubbles.
3. above-mentioned transfection cocktail is added in the 6 orifice plates for being inoculated with proper density cell, every hole culture medium 2m1,
The above-mentioned mixed liquor of 200 μ 1 is added, gently cross is put into cell incubator after mixing.decagram Commissioning
4. deciding whether to remove containing transfection agents according to cell state and subsequent experimental needs (whether needing dosing)
Culture medium.Under normal circumstances, 48h receives cell extraction RNA after transfection, and 72h collects cell extraction protein.
Agarose gel electrophoresis step:
(1) agarose solution (100m1TAE+1g agar Icing Sugar) for preparing 1% after microwave heating is melted, mixes.
(2) it pours into encapsulating plate, insertion tooth, cooled and solidified rear can be used.decagram Commissioning
(3) PCR product is mixed with nucleic acid sample-loading buffer, and is added in glue hole, is paid attention in sample-loading buffer and DNA
EB substitute is added in marker.decagram Commissioning
(4) 140V, 30min carry out agarose electrophoresis.decagram Commissioning
(5) target fragment is observed under ultraviolet light, if having miscellaneous band, and take pictures and obtain image.
Fig. 6 A shows that PQBP1 can influence the alternative splicing of multiple antiapoptotic factors, therefrom screens Bcl-x gene.It can
To find out that PQBP1 can promote the expression for pressing down apoptosis transcript Bcl-xL, inhibit the expression for promoting apoptosis transcript Bcl-xS.Fig. 6 B
Display PQBP1 can influence the alternative splicing of ovarian cancer cell line endogenous Bcl-x, strike low PQBP1 and be able to suppress suppression apoptosis
The expression of transcript Bcl-xL promotes the expression of apoptosis transcript Bcl-xS.By Western blot experiments have shown that PQBP1
Also the expression of Bcl-xL albumen can be influenced.Fig. 6 C shows that PQBP1 can influence the alternative splicing of exogenous Bcl-x, gradient
It is overexpressed PQBP1, is capable of the expression of grad enhancement Bcl-xL, gradient reduces the expression of Bcl-xS, thin in 293T cell and Hela
It is separately verified in born of the same parents system.
It should be noted that above example is only used to illustrate the technical scheme of the present invention rather than is limited.Although ginseng
It is described the invention in detail according to given example, but those skilled in the art can be as needed to this hair
Bright technical solution is modified or replaced equivalently, without departing from the spirit and scope of the technical solution of the present invention.
SEQUENCE LISTING
<110>Shandong University
<120>application of the PQBP1 in Diagnosis of Ovarian Cancer
<130>
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213>artificial synthesized
<400> 1
accctagctc atactcagac g 21
<210> 2
<211> 20
<212> DNA
<213>artificial synthesized
<400> 2
tcttggcctc attccgcttg 20
<210> 3
<211> 58
<212> DNA
<213>artificial synthesized
<400> 3
ccggccctta ctactggaat gcagactcga gtctgcattc cagtagtaag ggtttttg 58
<210> 4
<211> 58
<212> DNA
<213>artificial synthesized
<400> 4
aattcaaaaa cccttactac tggaatgcag actcgagtct gcattccagt agtaaggg 58
<210> 5
<211> 30
<212> DNA
<213>artificial synthesized
<400> 5
accagaattc ggaggaggaa gcaagcgagg 30
<210> 6
<211> 32
<212> DNA
<213>artificial synthesized
<400> 6
attactcgag gtaacccagc ctgtccaagg tc 32
<210> 7
<211> 31
<212> DNA
<213>artificial synthesized
<400> 7
attactcgag gaccctcaga ggcacagctt c 31
<210> 8
<211> 34
<212> DNA
<213>artificial synthesized
<400> 8
accatctaga tttccgactg aagagtgagc ccag 34
Claims (10)
- Application of the 1.PQBP1 in preparation oophoroma molecular marker；The marker is for detecting, diagnosing or predicting oophoroma Progress.
- 2. application as described in claim 1, which is characterized in that the progress of the oophoroma includes the proliferation of ovarian cancer cell, invades Attack the apoptosis of migration and/or ovarian cancer cell；Preferably, the oophoroma is high-level serous ovarian cancer (HGSOC).
- 3. a kind of composition of the progress for detecting, diagnosing or predict oophoroma, which is characterized in that comprising being measured based on high pass Sequence method and/or the object that PQBP1 gene in ovarian cancer samples is detected based on quantifying PCR method and/or based on probing procedure Matter；Or the substance based on PQBP1 albumen in immunologic detection method detection ovarian cancer samples.
- 4. composition as claimed in claim 3, which is characterized in that using solution hybridization, Northern hybridization, RNA chip and/or In situ hybridization detects PQBP1 in ovarian cancer samples；Using enzyme linked immunosorbent assay (ELISA), colloidal gold detection, protein immunoblotting And/or PQBP1 albumen in protein-chip detection ovarian cancer samples.
- 5. a kind of kit, which is characterized in that the kit includes that claim 3 or 4 are described for detecting, diagnosing or predicting The composition of the progress of oophoroma；Preferably, the primer containing detection PQBP1 gene in the composition, the primer include:PQBP1 upstream primer: 5 '-ACCCTAGCTCATACTCAGACG-3 ' (SEQ ID NO.1)；PQBP1 downstream primer: 5 '-TCTTGGCCTCATTCCGCTTG-3 ' (SEQ ID NO.2).
- 6. application of the substance for inhibiting PQBP1 expression and/or activity to reduce in following (a)-(c) is at least one:(a) inhibit the proliferation of ovarian cancer cell, or prepare the product for inhibiting human epithelial ovarian carcinoma cells proliferation；(b) inhibit the invasion migration of ovarian cancer cell, or product of the preparation for inhibiting ovarian cancer cells invasion to migrate；(c) promote the apoptosis of ovarian cancer cell, or prepare the product for promoting ovarian cellular apoptosis；Preferably, the PQBP1 inhibits withering for ovarian cancer cell by regulation Bcl-x apoptogene alternative splicing signal path It dies.
- 7. a kind of for preventing or treating the pharmaceutical composition of oophoroma, which is characterized in that comprising inhibit PQBP1 expression and/or The substance that activity reduces；Preferably, the substance for inhibiting PQBP1 expression and/or activity to reduce, including using the microRNA function based on RNA Property obtain technology, and/or slow virus shRNA perturbation technique and lower PQBP1 expression and/or inhibit its active substance.
- 8. pharmaceutical composition as claimed in claim 7, which is characterized in that described that PQBP1 expression and/or activity is inhibited to reduce Substance includes PQBP1 antagonist or inhibitor；Wherein, the PQBP1 antagonist includes the shRNA artificial synthesized according to PQBP1；Preferably, as follows comprising sequence when the shRNA sequent synthesis:Positive oligonucleotides: 5 '-CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGGTTTT TG-3'(SEQ ID NO.3)；Reverse oligonucleotide: 5 '-AATTCAAAAACCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAG GG-3’(SEQ ID NO.4)。
- 9. pharmaceutical composition as claimed in claim 8, which is characterized in that described pharmaceutical composition is solid orally ingestible, liquid Oral preparation or injection.
- 10. such as claim 8 or 9 described pharmaceutical compositions, which is characterized in that pharmaceutical dosage form is injectable implants, emulsion, rouge Plastid, microcapsules, microspheres agent, nanoparticle.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910471028.6A CN110129447B (en) | 2019-05-31 | 2019-05-31 | Application of PQBP1 in diagnosis and treatment of ovarian cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910471028.6A CN110129447B (en) | 2019-05-31 | 2019-05-31 | Application of PQBP1 in diagnosis and treatment of ovarian cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110129447A true CN110129447A (en) | 2019-08-16 |
| CN110129447B CN110129447B (en) | 2021-02-12 |
Family
ID=67583497
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910471028.6A Active CN110129447B (en) | 2019-05-31 | 2019-05-31 | Application of PQBP1 in diagnosis and treatment of ovarian cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110129447B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110511930A (en) * | 2019-06-11 | 2019-11-29 | 河北医科大学 | Sal-miR-58 and its purposes in the reaction of inhibition vasculitic and Aneurysmformation |
| CN111534592A (en) * | 2020-05-12 | 2020-08-14 | 重庆大学附属肿瘤医院 | Method for researching function and mechanism of m6A reader YTHDF1 in ovarian carcinogenesis |
| CN113025720A (en) * | 2021-04-28 | 2021-06-25 | 深圳市人民医院 | Marker for detecting primary mammary diffuse large B cell lymphoma as well as kit and application thereof |
| CN113913523A (en) * | 2021-11-22 | 2022-01-11 | 山东大学 | Application of BUD31 as ovarian cancer prevention, diagnosis or prognosis marker |
| CN114480657A (en) * | 2022-03-10 | 2022-05-13 | 中国医科大学附属盛京医院 | Marker of ovarian cancer and application thereof |
| CN115198017A (en) * | 2022-07-11 | 2022-10-18 | 中山大学附属第五医院 | Application of macrophage subgroup based on high-expression PLIN2 in diagnosis and treatment of ovarian cancer ascites |
| CN116103403A (en) * | 2023-01-18 | 2023-05-12 | 山东大学 | Biomarker for diagnosis and prognosis of ovarian cancer and application thereof |
-
2019
- 2019-05-31 CN CN201910471028.6A patent/CN110129447B/en active Active
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110511930A (en) * | 2019-06-11 | 2019-11-29 | 河北医科大学 | Sal-miR-58 and its purposes in the reaction of inhibition vasculitic and Aneurysmformation |
| CN110511930B (en) * | 2019-06-11 | 2023-01-10 | 河北医科大学 | Sal-miR-58 and application thereof in inhibition of vascular inflammatory reaction and aneurysm formation |
| CN111534592A (en) * | 2020-05-12 | 2020-08-14 | 重庆大学附属肿瘤医院 | Method for researching function and mechanism of m6A reader YTHDF1 in ovarian carcinogenesis |
| CN113025720A (en) * | 2021-04-28 | 2021-06-25 | 深圳市人民医院 | Marker for detecting primary mammary diffuse large B cell lymphoma as well as kit and application thereof |
| CN113025720B (en) * | 2021-04-28 | 2022-12-27 | 深圳市人民医院 | Marker for detecting diffuse large B cell lymphoma of primary breast as well as kit and application thereof |
| CN113913523A (en) * | 2021-11-22 | 2022-01-11 | 山东大学 | Application of BUD31 as ovarian cancer prevention, diagnosis or prognosis marker |
| CN114480657A (en) * | 2022-03-10 | 2022-05-13 | 中国医科大学附属盛京医院 | Marker of ovarian cancer and application thereof |
| CN115198017A (en) * | 2022-07-11 | 2022-10-18 | 中山大学附属第五医院 | Application of macrophage subgroup based on high-expression PLIN2 in diagnosis and treatment of ovarian cancer ascites |
| CN115198017B (en) * | 2022-07-11 | 2023-03-31 | 中山大学附属第五医院 | Application of macrophage subgroup based on high-expression PLIN2 in diagnosis and treatment of ovarian cancer ascites |
| CN116103403A (en) * | 2023-01-18 | 2023-05-12 | 山东大学 | Biomarker for diagnosis and prognosis of ovarian cancer and application thereof |
| CN116103403B (en) * | 2023-01-18 | 2023-08-11 | 山东大学 | Biomarker for diagnosis and prognosis of ovarian cancer and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110129447B (en) | 2021-02-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110129447A (en) | Application of the PQBP1 in Diagnosis of Ovarian Cancer | |
| Fang et al. | MicroRNA‐29b suppresses tumor angiogenesis, invasion, and metastasis by regulating matrix metalloproteinase 2 expression | |
| Xiong et al. | Effects of microRNA‐29 on apoptosis, tumorigenicity, and prognosis of hepatocellular carcinoma | |
| Zhang et al. | MicroRNA‐657 promotes tumorigenesis in hepatocellular carcinoma by targeting transducin‐like enhancer protein 1 through nuclear factor kappa B pathways | |
| Liu et al. | Overexpression of miR-142-3p improves mitochondrial function in cardiac hypertrophy | |
| Wang et al. | Role of miR-193a-5p in the proliferation and apoptosis of hepatocellular carcinoma. | |
| Wang et al. | Down‐regulation of long non‐coding RNA HOTAIR inhibits invasion and migration of oesophageal cancer cells via up‐regulation of microRNA‐204 | |
| Liu et al. | miR-1-3p suppresses the epithelial-mesenchymal transition property in renal cell cancer by downregulating Fibronectin 1 | |
| Deng et al. | Hsa_circ_0088233 alleviates proliferation, migration, and invasion of prostate cancer by targeting hsa-miR-185-3p | |
| Su et al. | Long non‐coding RNA highly up‐regulated in liver cancer promotes epithelial‐to‐mesenchymal transition process in oral squamous cell carcinoma | |
| Dong et al. | Long non-coding RNA TPTEP1 exerts inhibitory effects on hepatocellular carcinoma by impairing microRNA-454-3p-mediated DLG5 downregulation | |
| Bao et al. | Hsa_circ_NOTCH3 regulates ZNF146 through sponge adsorption of miR-875-5p to promote tumorigenesis of hepatocellular carcinoma | |
| Liu et al. | miR-1293 suppresses tumor malignancy by targeting hydrocyanic oxidase 2: therapeutic potential of a miR-1293/hydrocyanic oxidase 2 axis in renal cell carcinoma | |
| Liu et al. | TUG1 long non‐coding RNA enlists the USF1 transcription factor to overexpress ROMO1 leading to hepatocellular carcinoma growth and metastasis | |
| CN103920164B (en) | MiR-424-5p is suppressing the application in secondary liver cancer | |
| Bao et al. | MicroRNA-30 mediates cell invasion and metastasis in breast cancer | |
| Yang et al. | MicroRNA‑4712‑5p promotes proliferation of the vulvar squamous cell carcinoma cell line A431 by targeting PTEN through the AKT/cyclin D1 signaling pathways | |
| CN113913523B (en) | Application of BUD31 as ovarian cancer prevention, diagnosis or prognosis marker | |
| CN103800919B (en) | TUFT1 application in preparing diagnosing cancer of liver and treatment preparation | |
| CN105505936B (en) | A kind of anti-bone and flesh tumor metastasis biological agent and its application | |
| CN108165631A (en) | A kind of biomarker SYT12 of osteosarcoma and its application | |
| CN107739758A (en) | A kind of RDH10 genes are used for the application for preparing TWEAK NF κ B signal path blocking agents | |
| CN110396544B (en) | Application of CUL7 in glioma diagnosis, treatment and prognosis | |
| Zhai et al. | RP5-1120P11. 3 promotes hepatocellular carcinoma development via the miR-196b-5p–WIPF2 axis | |
| Zhang et al. | miR‐657 Targets SRCIN1 via the Slug Pathway to Promote NSCLC Tumor Growth and EMT Induction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |