CN110129447B - Application of PQBP1 in diagnosis and treatment of ovarian cancer - Google Patents
Application of PQBP1 in diagnosis and treatment of ovarian cancer Download PDFInfo
- Publication number
- CN110129447B CN110129447B CN201910471028.6A CN201910471028A CN110129447B CN 110129447 B CN110129447 B CN 110129447B CN 201910471028 A CN201910471028 A CN 201910471028A CN 110129447 B CN110129447 B CN 110129447B
- Authority
- CN
- China
- Prior art keywords
- pqbp1
- ovarian cancer
- expression
- bcl
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57449—Specifically defined cancers of ovaries
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4703—Regulators; Modulating activity
- G01N2333/4704—Inhibitors; Supressors
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- Animal Behavior & Ethology (AREA)
- Wood Science & Technology (AREA)
- Oncology (AREA)
- Veterinary Medicine (AREA)
- Genetics & Genomics (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Hospice & Palliative Care (AREA)
- Zoology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- General Chemical & Material Sciences (AREA)
- Cell Biology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides application of PQBP1 in diagnosis and treatment of ovarian cancer. According to the invention, the PQBP1 is found to be highly expressed in ovarian cancer patients, and the in vivo and in vitro functional tests prove that PQBP1 promotes the proliferation and invasion migration of ovarian cancer cells. In addition, researches find that PQBP1 can influence the alternative splicing of endogenous Bcl-x, particularly show that the expression of an apoptosis-inhibiting transcript Bcl-xL is promoted, the expression of a pro-apoptosis transcript Bcl-xS is inhibited, and therefore the apoptosis of ovarian cancer cells is finally inhibited. The PQBP1 is a splicing factor participating in the development of ovarian cancer, can be used as a biomarker and a therapeutic target of ovarian cancer, and has good practical application value.
Description
Technical Field
The invention belongs to the technical field of biological medicine and molecular biology, and particularly relates to application of PQBP1 in diagnosis and treatment of ovarian cancer.
Background
The information in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.
Ovarian cancer is a common malignant tumor of female reproductive organs, and the mortality rate of the ovarian cancer always lies at the top of gynecological malignant tumors. High-grade Serous Ovarian Cancer (HGSOC) is a subtype with the highest degree of malignancy, accounts for 70% -80% of Ovarian Cancer, and has the characteristics of latent morbidity, strong invasive capability, poor prognosis and the like. Most ovarian cancer patients lack specific symptoms and early screening methods, are often diagnosed at an advanced stage, often die of tumor recurrence and drug resistance, and the 5-year survival rate of the advanced stage patients is only 20-30%. Therefore, the molecular mechanism of the occurrence and development of the ovarian cancer is clarified, and effective molecular targets are screened, so that the method has important significance for early diagnosis and treatment of the ovarian cancer.
The abnormal selective splicing plays an important role in the occurrence and development of malignant tumors, and tumor cells generate splicing isomers which are beneficial to the behaviors of tumor proliferation, apoptosis, hypoxia, angiogenesis, immune escape, metastasis and the like through the abnormal selective splicing, so that the occurrence and development of the tumors are promoted. The molecular mechanism of aberrant splicing in ovarian cancer is closely related to cancer progression. The subject group was found by transcriptome and proteomics analysis. Among the signal pathways related to the occurrence and development of ovarian cancer, a spliceosome pathway is arranged at the head, 134 main splicing factors are further analyzed, 33 splicing factors are found to be up-regulated in ovarian cancer, and the fact that abnormal selective splicing plays a key role in ovarian cancer is suggested.
Differential splicing of a plurality of gene transcripts exists in ovarian cancer, CD44s is highly expressed in ovarian cancer cells, CD44v is low expressed, CD44s mediates an TGF beta 1-induced EMT channel through down-regulating a splicing factor ESRP1, so that ovarian cancer cells are induced to invade and migrate, and then stem cell-like characteristics and drug resistance are obtained; osteopontin (OPN) transcript OPNc is specifically expressed in ovarian cancer, but not OPNa or OPNb, and promotes malignant behaviors such as ovarian cancer cell proliferation, migration, invasion, in vivo tumor formation and the like; bcl-x is a member of the Bcl-2 family of apoptotic genes, the pre-mRNA alternative splicing of the Bcl-x gene produces Bcl-xS and Bcl-xL, which are subtypes associated with promotion and inhibition of apoptosis, respectively, overexpression of Bcl-xL inhibits tumor cell apoptosis, promotes metastasis and chemotherapy resistance, and is associated with poor clinical prognosis, while Bcl-xS induces apoptosis, which sensitizes cells to chemotherapeutic drugs.
Disclosure of Invention
In view of the above-mentioned deficiencies of the prior art, the present invention provides the use of PQBP1 in the diagnosis and treatment of ovarian cancer. The research shows that the PQBP1 is highly expressed in ovarian cancer patients, and the in vivo and in vitro functional tests prove that the PQBP1 promotes the proliferation and invasion migration of ovarian cancer cells. In addition, researches find that PQBP1 can influence the alternative splicing of endogenous Bcl-x, particularly show that the expression of an apoptosis-inhibiting transcript Bcl-xL is promoted, the expression of a pro-apoptosis transcript Bcl-xS is inhibited, and therefore the apoptosis of ovarian cancer cells is finally inhibited. The PQBP1 is a splicing factor participating in the development of ovarian cancer, and can be used as a biomarker and a therapeutic target of ovarian cancer.
The invention is realized by the following technical scheme:
in a first aspect of the invention, the application of PQBP1 in preparing ovarian cancer molecular markers is provided.
Further, the molecular markers are useful for detecting, diagnosing or prognosing the progression of ovarian cancer.
The progression of ovarian cancer includes proliferation, invasive migration, and/or apoptosis of ovarian cancer cells.
In a second aspect of the present invention, there is provided a composition for detecting, diagnosing or prognosing the progression of ovarian cancer, comprising a substance that detects PQBP1 in an ovarian cancer sample based on a high throughput sequencing method and/or based on a quantitative PCR method and/or based on a probe hybridization method; or a substance for detecting PQBP1 protein in ovarian cancer samples based on an immunodetection method.
Still further, the present invention provides a kit comprising a composition for detecting, diagnosing or prognosing the progression of ovarian cancer;
in a third aspect of the present invention, there is provided a use of a substance capable of inhibiting the expression and/or activity reduction of PQBP1 in at least one of the following (a) to (c):
(a) inhibiting proliferation of ovarian cancer cells, or preparing a product for inhibiting proliferation of ovarian cancer cells;
(b) inhibiting invasion and migration of ovarian cancer cells, or preparing a product for inhibiting invasion and migration of ovarian cancer cells;
(c) promoting apoptosis of ovarian cancer cells, or preparing products for promoting apoptosis of ovarian cancer cells.
Further, the PQBP1 inhibits the apoptosis of ovarian cancer cells by regulating the Bcl-x apoptosis gene alternative splicing signal channel; specifically, the PQBP1 can promote the expression of an apoptosis-inhibiting transcript Bcl-xL and inhibit the expression of a pro-apoptosis transcript Bcl-xS, thereby inhibiting the apoptosis of ovarian cancer cells.
In a fourth aspect of the present invention, there is provided a pharmaceutical composition for preventing or treating ovarian cancer, comprising a substance that inhibits the reduction in the expression and/or activity of PQBP 1;
the substance for inhibiting the expression and/or activity reduction of PQBP1 comprises a substance for down-regulating the expression and/or activity of PQBP1 by adopting an RNA-based microRNA functional acquisition technology and/or a lentivirus shRNA interference technology; preferably a PQBP1 antagonist or inhibitor; wherein the PQBP1 antagonist comprises an shRNA artificially synthesized according to PQBP 1;
in the present invention, "treatment or prevention" refers to the ability to inhibit the proliferation, invasion migration and/or promote apoptosis of ovarian cancer cells.
The invention has the beneficial effects that:
1. the invention provides effective molecular markers for diagnosis, disease condition evaluation and prognosis judgment of ovarian cancer: the invention proves that PQBP1 is highly expressed in ovarian cancer patients and has the potential of ovarian cancer molecular markers by verifying a large number of clinical samples and adopting methods such as qPCR, western blot, immunohistochemical staining and the like.
2. The invention provides a new target for diagnosis and treatment of ovarian cancer: the invention confirms that PQBP1 promotes the proliferation and invasion migration of ovarian cancer cells and inhibits the apoptosis of the cells through in vivo and in vitro functional tests. The above data demonstrate that lowering endogenous PQBP1 can inhibit malignant biological behavior such as tumor growth and invasion. Based on the design, a specific PQBP1 inhibitor can be designed, thereby achieving the purpose of treating ovarian cancer.
3. The invention discloses a target Bcl-x key apoptosis gene of PQBP1 for the first time, and the Bcl-x as the apoptosis key gene has important significance in the occurrence and development of ovarian cancer. The invention finds a new effective method for the targeted regulation and control of the apoptosis signal path, namely, the activation and the inhibition of the apoptosis path are realized through PQBP1 mimics/inhibitor; compared with platinum drugs for inhibiting apoptosis pathway, the method has stronger targeting property.
Drawings
The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.
FIG. 1 is a graph showing the expression and clinical significance of PQBP1 in HGSOC in example 1; wherein FIG. 1A is a database analysis of the genetic alterations of PQBP1 in ovarian cancer; FIG. 1B is a graph comparing the amount of PQBP1mRNA in high grade serous ovarian cancer tissue with normal salpingula tissue; FIG. 1C is a graph of the TCGA database analysis of the relationship of PQBP1 to ovarian cancer prognosis.
FIG. 2 is a correlation diagram of construction of PQBP1 stable overexpression and knockdown three cell lines by a lentivirus expression system, and FIG. 2A is a qPCR and Western blotting detection knockdown efficiency diagram; FIG. 2B is a graph of overexpression efficiency of qPCR and Western blotting detection.
FIG. 3 is a graph of the proliferation of ovarian cancer cells promoted by PQBP1 in example 3; wherein, fig. 3A is a diagram of the proliferation of ovarian cancer cells promoted by PQBP1, and a plate cloning experiment proves that PQBP1 can promote the cloning capacity of ovarian cancer cells and enhance the malignancy degree of the cancer cells; FIG. 3B is a diagram of the proliferation rate of PQBP 1-promoted ovarian cancer cells, and MTT experiments prove that the proliferation rate of ovarian cancer cells is obviously enhanced when compared with a control group by overexpressing PQBP1, and the proliferation rate of ovarian cancer cells is obviously reduced when compared with the control group by knocking down PQBP 1; FIG. 3C is a graph showing the effect of PQBP1 on the periodic signaling pathway protein; FIG. 3D is a graph showing the effect of PQBP1 on subcutaneous tumorigenicity ability in nude mice.
FIG. 4 is a graph of the migration and invasion of ovarian cells promoted by PQBP1 in example 3; fig. 4A shows that PQBP1 can promote invasion and migration of ovarian cancer cells, and a Transwell experiment proves that over-expression of PQBP1 can significantly enhance the malignancy of the cancer cells, and that reduction of PQBP1 can reduce the malignancy of the ovarian cancer cells; fig. 4B is an expression diagram of PQBP1 capable of affecting EMT pathway-related proteins, wherein overexpression of PQBP1 can promote expression of proteins such as Snail, Slug, and Vimentin, and reduction of PQBP1 can reduce expression of EMT-related pathway proteins and further promote invasion and migration ability of ovarian cancer cells.
FIG. 5 is a graph showing the correlation between the inhibition of apoptosis of ovarian cancer cells by PQBP1 in example 3; flow cytometry proves that the apoptosis number of ovarian cancer cell line cells over expressing PQBP1 is obviously lower than that of a control group, and the apoptosis number of ovarian cancer cell line cells with knocked-down PQBP1 is obviously higher than that of the control group; western blot experiments show that the over-expression of PQBP1 can reduce the expression of Bax protein and promote the expression of Bcl-2 protein; the knocking-down PQBP1 can promote the expression of Bax protein, reduce the expression of Bcl-2 protein and further inhibit the apoptosis of ovarian cancer cells.
FIG. 6 is a diagram showing the relationship between PQBP1 regulating the alternative splicing of Bcl-x in example 5; FIG. 6A shows that PQBP1 can affect alternative splicing associated with a range of apoptotic factors, including Bcl-x; FIG. 6B shows that PQBP1 can promote the expression of the apoptosis-inhibiting transcript Bcl-xL and inhibit the expression of the pro-apoptosis transcript Bcl-xS. FIG. 6C is a graph showing the correlation of PQBP1 in the regulation of alternative splicing of exogenous Bcl-x; the gradient overexpression of PQBP1 promotes the gradient overexpression of an apoptosis-inhibiting transcript Bcl-xL and promotes the gradient reduction of a pro-apoptosis transcript Bcl-xS, and the results are respectively verified in 293T cells and HeLa cells.
Detailed Description
It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments according to the present application. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise. It is to be understood that the scope of the invention is not to be limited to the specific embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. The experimental procedures, if specific conditions are not indicated in the following detailed description, are generally in accordance with conventional procedures and conditions of molecular biology within the skill of the art, which are fully explained in the literature. See, e.g., Sambrook et al, "molecular cloning: the techniques and conditions described in the laboratory Manual, or according to the manufacturer's recommendations.
In one embodiment of the invention, the application of PQBP1 in preparing ovarian cancer molecular markers is provided.
In still another embodiment of the present invention, the use of PQBP1 in the preparation of a molecular marker for ovarian cancer for detecting, diagnosing or prognosing the progression of ovarian cancer.
The progression of ovarian cancer comprises proliferation, invasive migration, and/or apoptosis of ovarian cancer cells;
in yet another embodiment of the present invention, the ovarian cancer is high-grade serous ovarian cancer (HGSOC).
In yet another embodiment of the present invention, there is provided a composition for detecting, diagnosing or prognosing the progression of ovarian cancer, comprising a substance that detects PQBP1 in an ovarian cancer sample based on a high throughput sequencing method and/or based on a quantitative PCR method and/or based on a probe hybridization method; or a substance for detecting PQBP1 protein in ovarian cancer samples based on an immunodetection method.
In another embodiment of the invention, the detection of PQBP1 in ovarian cancer samples is performed by liquid phase hybridization, Northern hybridization, RNA chip, in situ hybridization; detecting PQBP1 protein in the ovarian cancer sample by adopting enzyme-linked immunosorbent assay, colloidal gold detection, Western blotting and protein chip;
in yet another embodiment of the present invention, the present invention provides a kit comprising a composition for detecting, diagnosing or prognosing the progression of ovarian cancer;
in another embodiment of the present invention, the composition comprises a primer for detecting PQBP1, wherein the primer comprises:
PQBP1 upstream primer: 5'-ACCCTAGCTCATACTCAGACG-3' (SEQ ID NO. 1);
PQBP1 downstream primer: 5'-TCTTGGCCTCATTCCGCTTG-3' (SEQ ID NO. 2).
In still another embodiment of the present invention, there is provided a use of a substance capable of inhibiting the expression and/or activity reduction of PQBP1 in at least one of the following (a) to (c):
(a) inhibiting proliferation of ovarian cancer cells, or preparing a product for inhibiting proliferation of ovarian cancer cells;
(b) inhibiting invasion and migration of ovarian cancer cells, or preparing a product for inhibiting invasion and migration of ovarian cancer cells;
(c) promoting apoptosis of ovarian cancer cells, or preparing products for promoting apoptosis of ovarian cancer cells.
In yet another embodiment of the present invention, the PQBP1 inhibits apoptosis of ovarian cancer cells by modulating Bcl-X apoptotic gene alternative splicing signaling pathway; specifically, the PQBP1 can promote the expression of an apoptosis-inhibiting transcript Bcl-XL and inhibit the expression of a pro-apoptosis transcript Bcl-XS, thereby inhibiting the apoptosis of ovarian cancer cells.
In still another embodiment of the present invention, there is provided a pharmaceutical composition for preventing or treating ovarian cancer, comprising a substance that inhibits the reduction of the expression and/or activity of PQBP 1;
the substance for inhibiting the expression and/or activity reduction of PQBP1 comprises a substance for down-regulating the expression and/or activity of PQBP1 by adopting an RNA-based microRNA functional acquisition technology and/or a lentivirus shRNA interference technology; preferably a PQBP1 antagonist or inhibitor; wherein the PQBP1 antagonist comprises an shRNA artificially synthesized according to PQBP 1;
in another embodiment of the present invention, the shRNA sequence is synthesized by the following sequence:
forward oligonucleotide (Forward oligo): 5'-CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGGTTTTTG-3' (SEQ ID NO. 3);
reverse oligonucleotide (Reverse oligo): 5'-AATTCAAAAACCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGG-3' (SEQ ID NO. 4).
In yet another embodiment of the present invention, "treating or preventing" refers to inhibiting the proliferation, invasion migration and/or promoting apoptosis of ovarian cancer cells.
In still another embodiment of the present invention, the pharmaceutical composition is a solid oral preparation, a liquid oral preparation or an injection.
In yet another embodiment of the present invention, the pharmaceutical dosage form is injectable implants, emulsions, liposomes, microcapsules, microspheres, nanoparticles, and the like. The dose of the pharmaceutical composition administered may vary depending on the body weight, age and sex, health condition, diet, administration time, administration route, excretion rate and severity of disease of the patient.
The invention is further illustrated by the following examples, which are not to be construed as limiting the invention thereto. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. In addition, molecular biological methods which are not described in detail in the examples are all conventional methods in the field, and specific operations can be referred to molecular biological guidelines or product specifications.
Example 1 definition of the role PQBP1 plays in ovarian cancer
In the early stage of the group, transcriptome and proteomic analysis shows that PQBP1 is highly expressed in HGSOC, samples are further expanded for verification, 16 collected ovarian normal salpingo-umbrella tissues and 29 collected high-grade serous ovarian cancer tissues are used for extracting tissue RNA, and the relative expression level of PQBP1mRNA is detected by qPCR (quantitative polymerase chain reaction), so that the mRNA expression level of PQBP1 in the high-grade serous ovarian tissues is obviously higher than that of the normal salpingo-umbrella tissues (P < 0.05) (FIG. 1B). Analysis of the TCGA database revealed that PQBP1 had gene amplification and high mRNA expression in HGSOC (11%), and further analysis revealed that patients with high expression of PQBP1 had poor prognosis and those with low expression of PQBP1 had good prognosis (fig. 1A and 1C). In conclusion, the PQBP1 is highly expressed in high-grade serous ovarian cancer and is closely related to the prognosis of patients, and PQBP1 shows genetic changes such as partial amplification, up-regulation and point mutation in ovarian cancer. The above results suggest that PQBP1 may play an important role in the development and progression of ovarian cancer.
Example 2 PQBP1 overexpression and knock-out plasmid construction
1. Construction of overexpression plasmids:
PQBP1 overexpression plasmid was purchased from Addgene official website. Firstly, a PQBP1 target gene sequence is constructed on an intermediate vector PCDNA3.1 vector, and then is connected to a lentiviral vector PCMV through a BamH I enzyme cutting site and an XhoI enzyme cutting site.
2. Construction of knocked-down plasmids:
the shRNA sequences corresponding to PQBP1 were retrieved from Sigma official website as follows:
Forward oligo:
5’CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGGTTTTTG3’；
Reverse oligo:
5’AATTCAAAAACCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGG3’；
the sequence was then constructed on the PLKO.1 vector via the cleavage sites Age I and EcoRI. Transient transfection of functional cells 293T with overexpressed and knocked-down plasmids was performed, RNA was harvested after 48h, protein was harvested after 72h, and overexpression and knocking-down of the RNA and protein levels PQBP1 were measured, respectively.
Example 3 biological function of PQBP1 in ovarian cancer cells
The sequence of PQBP1 was ligated into PCMV plasmid (purchased from OriGene, official website), lentivirus packaged, transfected into a2780 and SKOV3 cells, and screened using puromycin. After screening, the content of PQBP1 was determined by western blot and qPCR. After the cell line is successfully constructed, a plate clone experiment is used for forming an experiment to detect the proliferation capacity of the cells, and a Transwell experiment is used for detecting the invasion capacity of the cells.
1. Constructing a stable transfer cell line:
(1) production of viral particles
preparing a transfection complex: diluting 10 μ g of plasmid DNA and 36 μ l of liposome with 1.6ml of serum-free OPTI-MEM medium, respectively, blowing uniformly, and incubating at room temperature for 5 min;
mixing the two, blowing uniformly to avoid generating bubbles, and incubating at room temperature for about 20min to form a DNA-liposome mixture;
adding the DNA-liposome compound into a culture dish with well-paved cells, and placing the culture dish in an incubator;
taking out after 3h of culture, supplementing 5ml of OPTI-MEM culture medium into the culture dish, continuously culturing for about 6h, then replacing 6ml of fresh antibiotic-free DMEM complete culture medium, and putting the culture dish back into the incubator for continuous culture;
after 24h of culture, the supernatant containing the viral particles was collected, stored temporarily at 4 ℃ and 6ml of fresh complete medium was added to the dish;
culturing for 48h, collecting the supernatant again, mixing the two supernatants, centrifuging at 20000rpm and 4 deg.C for 2h to obtain virus particle precipitate;
the viral pellet was resuspended in 500. mu.l of medium and either run the next experiment or stored at-80 ℃.
(2) Infecting host cells
Inoculating the cells to be infected into a 6-well plate according to the density of 3 multiplied by 104 cells/ml, and culturing overnight;
plating the plates the next day, adding 8. mu.g/ml Polybreen (and 50. mu.l concentrated virus particles) per well for infection, shaking the plate (cross shaking) to mix well, placing in an incubator for continuous culture;
after 48h of infection, the supernatant was aspirated off, the medium containing 2. mu.g/ml puromycin was replaced for selection, the cell growth state was observed every 2 days, the medium containing puromycin was replaced every 3-4 days, and cells stably transfected with the desired plasmid were obtained after 2 weeks of continuous selection.
2. Plate cloning: selecting cells in logarithmic growth phase, performing membrane protease digestion, counting the cells, inoculating 400 cells per well into a 6-well plate, culturing for about 10-14 days, fixing with methanol for 15min, and dyeing with crystal violet for 30 min. Observed under the mirror and counted.
3. MTT growth curve: selecting cells in a logarithmic growth phase, carrying out trypsin digestion, counting the cells, inoculating the cells in a 96-well plate after each empty 1000 cells, continuously detecting for 5 days, carrying out MTT treatment, dissolving in DMSO, and detecting the OD value of the cells. Cell growth rate curves were plotted.
4. Subcutaneous neoplasia in nude mice clearly showed a role for PQBP1 in ovarian cancer: 6 BALB/C Nude female mice control and experimental groups each at 4 weeks of age. The control group was injected with HEY-PCMV-NC cells, and the experimental group was injected with HEY-PCMV-PQBP1 cells, 500 ten thousand cells each, diluted in 200. mu.l of PBS, and injected subcutaneously. Mice were sacrificed after 2 weeks of anesthesia, tumor tissues were taken and soaked in 10% formalin solution, embedded in paraffin, and then sectioned, HE stained and immunohistochemically stained to observe the morphology and number of tumor tissue cells.
1. HE dyeing step
Baking slices: baking at 60 deg.C for 30 min.
Dewaxing: xylene I15 min-xylene 15 min-100% alcohol 5 min-95% alcohol 5 min-80% alcohol 5 min-75% alcohol 5min, rinsing 2-3 times in tap water.
Hematoxylin staining for 10min, gently wash the slide with a small stream of water, pay attention to: excessive water flow can wash the tissue away.
Hydrochloric alcohol for 1-2 seconds, ammonia water for 5-10 seconds, and tap water for 2-3 times.
Staining with eosin for 20min, and rinsing in tap water for 2-3 times.
And (3) dehydrating: 75% alcohol 10 s-80% alcohol 10 s-95% alcohol 10 s-100% alcohol 10 s-xylene I3 min-xylene 3 min.
2. Immunohistochemical staining
The dewaxing step was as above.
Antigen retrieval: adding repairing solution (sodium citrate) with one side of the tissue facing upwards, placing in a washing box, heating with microwave and high fire for 40s, and pausing for 30 s when boiling occurs. At this point 15 cycles of cooking were entered. 12 seconds open +48 seconds close, cooling to room temperature (30min-60 min); incubating 3% hydrogen peroxide in a wet box at 37 ℃ for 15-20min, and washing with PBS for 3 times and 3 min; serum blocking: adding reagent A (blue liquid) dropwise and incubating at 37 ℃ for 25-30 min; adding a primary antibody: room temperature for 2 hours, add reagent B: incubating at 37 ℃ for 15-20min, and washing with PBS for 3 times and 3min by shaking; adding a reagent B: incubate at 37 ℃ for 10-15min, and shake wash with PBS 3 times for 3 min.
Adding color development liquid DAB, dyeing with hematoxylin, and soaking in hydrochloric acid alcohol for 2 seconds-in ammonia water for 7-10 seconds; dehydration was performed (same procedure as above).
Compared with a control group, the experiment group over-expressing PQBP1 can obviously enhance the tumorigenicity capacity of the nude mice, the tumorigenicity rate and the tumorigenicity size are obviously higher than those of the control group, and the experiment result has statistical significance. PQBP1 is an oncogene, can promote the proliferation, invasion and migration of ovarian cancer cells, inhibit the apoptosis of ovarian cancer cells and obviously promote the tumorigenicity of nude mice.
4. Transwell: Matrigel: DMEM 10:1, 50 μ l per well of the mixture, after gel fixation, 200 μ l of cell and serum-free DMEM suspension (a 278020 ten thousand/well, SKOV 310 ten thousand/well) was added to the upper chamber, DMEM containing 10% FBS was added to the lower chamber, after 48 hours of culture, methanol was fixed, and counting was performed under the microscope after crystal violet staining.
5. Detecting apoptosis by a flow cytometer: the well-grown stable cell line was inoculated one day in advance into a 6cm dish, treated with 30% hydrogen peroxide for 1h, harvested, washed once with 1 XPBS, resuspended in 100. mu.l of 1 Xannexin V Binding Solution, 5. mu. lPI and FITC dye were added, and after 15min, the number of apoptotic cells was detected by flow cytometry.
In order to deeply research the role of PQBP1 in the development process of ovarian cancer, a PQBP1 overexpression and underexpression stable cell line is constructed by using a lentivirus expression system. The expression level of PQBP1 is detected by qPCR verification and Western blotting, and the cell line is successfully constructed (FIG. 2 Aadd 2B). The plate cloning experiment proves that PQBP1 can promote the cloning formation ability of ovarian cancer cells, promote the proliferation of the ovarian cancer cells and enhance the malignancy degree of the cancer cells, as shown in figure 3A. MTT experiments prove that the proliferation rate of the ovarian cancer cells is promoted by PQBP1, compared with a control group, the proliferation rate of the ovarian cancer cells is obviously enhanced by over-expressing PQBP1, and compared with the control group, the proliferation rate of the ovarian cancer cells is obviously reduced by knocking down PQBP1, as shown in figure 3B. Western blotting experiments show that PQBP1 influences the expression of G1 phase arrest related proteins, over-expression of PQBP1 can promote the expression of cyclin D1 and cyclin E proteins, reduce the expression of P53, P27 and P21 proteins to further inhibit the proliferation of ovarian cancer cells, reduce the expression of PQBP1 can reduce the expression of proteins such as cyclin D1 and cyclin E, and increase the expression of proteins such as P53 and P21, as shown in figure 3C. We transfected the constructed ovarian cancer overexpressing PQBP1 stable HEY cell line (5X 10 per group)6Individual cells) were inoculated subcutaneously at the axilla of the upper limb of nude mice, and one week of nude mice had tumors. The over-expression of PQBP1 is found to obviously enhance the subcutaneous tumorigenicity ability of nude mice, the tumorigenicity speed is high,the volume and weight of tumor bodies were significantly higher than those of the control group (. times.p < 0.001), and the data of both groups were statistically significant, as shown in fig. 3D.
Transwell experiments prove that the number of cells passing through Matrigel gel is obviously greater in the experiment group overexpressing PQBP1 than in the control group (P < 0.001), and the number of cells passing through Matrigel gel is obviously lower in the experiment group knocking down PQBP1 than in the control group (P < 0.001), so that PQBP1 can promote invasion and migration of ovarian cancer cells and obviously enhance the malignancy degree of the cancer cells, as shown in FIG. 4A. Western blotting experiments detect the expression of an EMT channel related protein Marker, and results show that the over-expression of PQBP1 can promote the expression of interstitial expression related markers such as N-Cadherin, beta-Catenin, Vimentin, Claudin-1 and other proteins, and simultaneously reduce the expression of epithelial expression related markers such as E-Cadherin, ZO-1 and other proteins, and reduce PQBP1, otherwise, as shown in figure 4B.
The ovarian cancer cells are treated by using hydrogen peroxide with a certain concentration as an apoptosis inducer, and the proportion of the apoptotic cells is detected by using flow cytometry. The total proportion of the cells with the knockdown PQBP1 in early apoptosis and late apoptosis in SKOV3 and A2780 cells is obviously increased compared with a control group (P < 0.001). The total proportion of early apoptotic and late apoptotic cells in the experimental group overexpressing PQBP1 in the HEY cell line was significantly lower than that in the control group (P < 0.001), as shown in FIG. 5A. Western blotting experiment detects the expression of apoptosis-related protein, and the expression of Bax and Bcl-2 protein is promoted by knocking down PQBP1, which is consistent with the result of flow cytometry and is shown in figure 5B.
Example 4 Bcl-x minigene plasmid construction
The first part sequence of the Bcl-x minigene sequence is the first half part of exon 1 and intron 2; the Bcl-x minigene second part sequence is the second half of intron 2 and exon 3. The Bcl-x minigene sequence is constructed on pcDNA3.1 vector. Bcl-x minigene plasmid relates to the primer design as follows:
example 5 definition of the regulation relationship of PQBP1 to Bcl-x
Primers for endogenous Bcl-xL and Bcl-xS transcripts were designed to examine the effect of over-expression or knock-down of PQBP1 on the alternative splicing of endogenous Bcl-x. Endogenous Bcl-x expression was detected in stably overexpressing or knocking down PQBP1 cell lines. The PQBP1 is found to affect the alternative splicing of endogenous Bcl-x, promote the expression of apoptosis inhibiting transcript Bcl-xL and inhibit the expression of apoptosis promoting transcript Bcl-xS.
Then, the influence of PQBP1 on exogenous Bcl-x minigene alternative splicing is further detected, 293T, HeLa cells are transiently transfected, PQBP1 is subjected to gradient overexpression, the expression of Bcl-xL apoptosis inhibiting transcripts is increased along with the gradient, and the expression gradient of Bcl-xS apoptosis promoting transcripts is reduced, as shown in FIG. 6C.
Transient transfection step:
1. cell plating: cells with good status were generally passaged twice and plated for transfection. Trypsinization-medium resuspension of cells-cell count, different cell densities depending on cell size, and transfection purpose. When plasmids are transfected, the cell density is preferably controlled to be 60% -80%.
2. Preparing a transfection complex: taking a six-hole plate as an example
The DNA transfection method comprises the following steps: mu.g of DNA, 4. mu.l of jet
And 200 μ 1jet PRIME Buffer into 1.5m1EP tubes, vortexed for 10s, and incubated at room temperature for 10 min. The presence of bubbles is avoided.
3. The transfection mixture was added to a 6-well plate inoculated with cells of appropriate density, 2m1 per well of culture medium, 200. mu.1 of the above mixture was added, mixed gently and mixed in a cross, and placed in a cell incubator.
4. Whether to remove the culture medium containing the transfection reagent is determined according to the cell state and the requirements of subsequent experiments (whether to add medicine). In general, RNA was extracted 48h after transfection and protein was extracted 72h after transfection.
Agarose gel electrophoresis step:
(1) a1% agarose solution (100m1TAE +1g agarose powder) was prepared, melted by microwave heating, and mixed well.
(2) Pouring into a glue pouring plate, inserting teeth, and cooling and solidifying for use.
(3) PCR products were mixed with nucleic acid loading buffer and added to the gel wells, noting the addition of EB replacement in loading buffer and DNA marker.
(4) Agarose electrophoresis was performed at 140V for 30 min.
(5) And observing the target fragment under ultraviolet rays to determine whether the target fragment has a miscellaneous band, and photographing to obtain an image.
FIG. 6A shows that PQBP1 can affect alternative splicing of multiple apoptotic factors, from which Bcl-x genes were screened. It can be seen that PQBP1 can promote the expression of apoptosis-inhibiting transcript Bcl-xL and inhibit the expression of pro-apoptosis transcript Bcl-xS. FIG. 6B shows that PQBP1 can affect alternative splicing of endogenous Bcl-x of ovarian cancer cell lines, and that knocking down PQBP1 can inhibit expression of apoptotic transcript Bcl-xL and promote expression of pro-apoptotic transcript Bcl-xS. Western blot experiments prove that PQBP1 can also influence the expression of Bcl-xL protein. FIG. 6C shows that PQBP1 can affect alternative splicing of exogenous Bcl-x, and gradient over-expression of PQBP1, can gradient enhance Bcl-xL expression, and gradient decrease Bcl-xS expression, as demonstrated in 293T cells and Hela cell lines, respectively.
It should be noted that the above examples are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the examples given, those skilled in the art can modify the technical solution of the present invention as needed or equivalent substitutions without departing from the spirit and scope of the technical solution of the present invention.
SEQUENCE LISTING
<110> Shandong university
Application of <120> PQBP1 in diagnosis and treatment of ovarian cancer
<130>
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 1
accctagctc atactcagac g 21
<210> 2
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 2
tcttggcctc attccgcttg 20
<210> 3
<211> 58
<212> DNA
<213> Artificial Synthesis
<400> 3
ccggccctta ctactggaat gcagactcga gtctgcattc cagtagtaag ggtttttg 58
<210> 4
<211> 58
<212> DNA
<213> Artificial Synthesis
<400> 4
aattcaaaaa cccttactac tggaatgcag actcgagtct gcattccagt agtaaggg 58
<210> 5
<211> 30
<212> DNA
<213> Artificial Synthesis
<400> 5
accagaattc ggaggaggaa gcaagcgagg 30
<210> 6
<211> 32
<212> DNA
<213> Artificial Synthesis
<400> 6
attactcgag gtaacccagc ctgtccaagg tc 32
<210> 7
<211> 31
<212> DNA
<213> Artificial Synthesis
<400> 7
attactcgag gaccctcaga ggcacagctt c 31
<210> 8
<211> 34
<212> DNA
<213> Artificial Synthesis
<400> 8
accatctaga tttccgactg aagagtgagc ccag 34
Claims (5)
1. The application of shRNA for inhibiting the expression of PQBP1 in preparing products for inhibiting the proliferation of ovarian cancer cells: the shRNA sequence comprises the following components in a synthesis process:
forward oligonucleotide: 5'-CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGGTTTTTG-3', SEQ ID NO. 3;
reverse oligonucleotide: 5'-AATTCAAAAACCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGG-3', SEQ ID NO. 4.
2. The use of claim 1, wherein said PQBP1 is capable of affecting alternative splicing of endogenous Bcl-x.
3. Use of an shRNA that inhibits the expression of PQBP1 in the preparation of a pharmaceutical composition for the prevention or treatment of ovarian cancer, said shRNA sequence when synthesized comprising:
forward oligonucleotide: 5'-CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGGTTTTTG-3', SEQ ID NO. 3;
reverse oligonucleotide: 5'-AATTCAAAAACCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGG-3', SEQ ID NO. 4.
4. The use of claim 3, wherein the pharmaceutical composition is a solid oral formulation, a liquid oral formulation or an injection.
5. Use according to claim 3 or 4, wherein the pharmaceutical dosage form is injectable implants, emulsions, liposomes, microcapsules, microspheres, nanoparticles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910471028.6A CN110129447B (en) | 2019-05-31 | 2019-05-31 | Application of PQBP1 in diagnosis and treatment of ovarian cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910471028.6A CN110129447B (en) | 2019-05-31 | 2019-05-31 | Application of PQBP1 in diagnosis and treatment of ovarian cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110129447A CN110129447A (en) | 2019-08-16 |
| CN110129447B true CN110129447B (en) | 2021-02-12 |
Family
ID=67583497
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910471028.6A Active CN110129447B (en) | 2019-05-31 | 2019-05-31 | Application of PQBP1 in diagnosis and treatment of ovarian cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110129447B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110511930B (en) * | 2019-06-11 | 2023-01-10 | 河北医科大学 | Sal-miR-58 and application thereof in inhibition of vascular inflammatory reaction and aneurysm formation |
| CN111534592A (en) * | 2020-05-12 | 2020-08-14 | 重庆大学附属肿瘤医院 | Method for researching function and mechanism of m6A reader YTHDF1 in ovarian carcinogenesis |
| CN113025720B (en) * | 2021-04-28 | 2022-12-27 | 深圳市人民医院 | Marker for detecting diffuse large B cell lymphoma of primary breast as well as kit and application thereof |
| CN113913523B (en) * | 2021-11-22 | 2023-04-11 | 山东大学 | Application of BUD31 as ovarian cancer prevention, diagnosis or prognosis marker |
| CN114480657A (en) * | 2022-03-10 | 2022-05-13 | 中国医科大学附属盛京医院 | Marker of ovarian cancer and application thereof |
| CN115198017B (en) * | 2022-07-11 | 2023-03-31 | 中山大学附属第五医院 | Application of macrophage subgroup based on high-expression PLIN2 in diagnosis and treatment of ovarian cancer ascites |
| CN116103403B (en) * | 2023-01-18 | 2023-08-11 | 山东大学 | Biomarker for diagnosis and prognosis of ovarian cancer and application thereof |
-
2019
- 2019-05-31 CN CN201910471028.6A patent/CN110129447B/en active Active
Non-Patent Citations (6)
| Title |
|---|
| Homo sapiens polyglutamine binding protein 1 (PQBP1)，transcript variant 1，mRNA，NCBI Reference Sequence: NM_005710.2，1147bp mRNA linear;Shannon JL等;《NCBI genbank》;20190217;1-4 * |
| LI Yan-hong等.Microarray expression analysis of epithelial ovarian cancer with distinct Differentiation.《Journal of Medical Colleges of PLA》.2007,第22卷(第6期),373-375. * |
| Microarray expression analysis of epithelial ovarian cancer with distinct Differentiation;LI Yan-hong等;《Journal of Medical Colleges of PLA》;20071231;第22卷(第6期);373-375 * |
| Polyglutamine binding protein 1 (PQBP1) inhibits innate immune responses to cytosolic DNA;Jessica L. Shannon等;《Molecular Immunology》;20181231;第99卷;182-190 * |
| PQBP1 Is a Proximal Sensor of the cGAS-Dependent Innate Response to HIV-1;Sunnie M. Yoh等;《Cell》;20150604;第161卷(第6期);1293-1305，补充图S1-S6，补充实验第1-13页 * |
| WW domain-binding protein 2: an adaptor protein closely linked to the development of breast cancer;Shuai Chen等;《Molecular Cancer》;20171231;第16卷;第128篇，1-9 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110129447A (en) | 2019-08-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110129447B (en) | Application of PQBP1 in diagnosis and treatment of ovarian cancer | |
| Chen et al. | RETRACTED: LINC01234/MicroRNA-31-5p/MAGEA3 Axis Mediates the Proliferation and Chemoresistance of Hepatocellular Carcinoma Cells | |
| Wen et al. | Long noncoding RNA GAS5, which acts as a tumor suppressor via microRNA 21, regulates cisplatin resistance expression in cervical cancer | |
| Shi et al. | Circular RNA ANAPC7 inhibits tumor growth and muscle wasting via PHLPP2–AKT–TGF-β signaling Axis in pancreatic cancer | |
| Jiang et al. | MiR-125b promotes proliferation and migration of type II endometrial carcinoma cells through targeting TP53INP1 tumor suppressor in vitro and in vivo | |
| Liang et al. | Silencing of CEMIP suppresses Wnt/β-catenin/Snail signaling transduction and inhibits EMT program of colorectal cancer cells | |
| Zhang et al. | MicroRNA‐657 promotes tumorigenesis in hepatocellular carcinoma by targeting transducin‐like enhancer protein 1 through nuclear factor kappa B pathways | |
| Qu et al. | Long noncoding RNA SOX2OT contributes to gastric cancer progression by sponging miR-194-5p from AKT2 | |
| Zhao et al. | LncRNA SNHG3 promotes hepatocellular tumorigenesis by targeting miR-326 | |
| Zhou et al. | TRIM44 is indispensable for glioma cell proliferation and cell cycle progression through AKT/p21/p27 signaling pathway | |
| Zhang et al. | MiR-181d-5p targets KLF6 to improve ischemia/reperfusion-induced AKI through effects on renal function, apoptosis, and inflammation | |
| Wu et al. | Oncogene FOXK1 enhances invasion of colorectal carcinoma by inducing epithelial-mesenchymal transition | |
| Qi et al. | Targeting the Wnt-regulatory protein CTNNBIP1 by microRNA-214 enhances the stemness and self-renewal of cancer stem-like cells in lung adenocarcinomas | |
| Zhu et al. | TRAF6 promotes the progression and growth of colorectal cancer through nuclear shuttle regulation NF-kB/c-jun signaling pathway | |
| Ge et al. | AntagomiR-27a targets FOXO3a in glioblastoma and suppresses U87 cell growth in vitro and in vivo | |
| Xiang et al. | Hepatocyte nuclear factor 4 alpha promotes the invasion, metastasis and angiogenesis of neuroblastoma cells via targeting matrix metalloproteinase 14 | |
| Wan et al. | NF45 overexpression is associated with poor prognosis and enhanced cell proliferation of pancreatic ductal adenocarcinoma | |
| Gao et al. | RETRACTED ARTICLE: Long noncoding RNA MAGI1-IT1 promoted invasion and metastasis of epithelial ovarian cancer via the miR-200a/ZEB axis | |
| Luo et al. | TC21 promotes cell motility and metastasis by regulating the expression of E-cadherin and N-cadherin in hepatocellular carcinoma | |
| Chen et al. | ZFP36 binds with PRC1 to inhibit tumor growth and increase 5-Fu chemosensitivity of hepatocellular carcinoma | |
| Cui et al. | MicroRNA-623 Inhibits Epithelial–Mesenchymal Transition to Attenuate Glioma Proliferation by Targeting TRIM44 | |
| US20170145419A1 (en) | Methods and compositions for the treatment of cancer | |
| Yang et al. | MicroRNA‑4712‑5p promotes proliferation of the vulvar squamous cell carcinoma cell line A431 by targeting PTEN through the AKT/cyclin D1 signaling pathways | |
| Li et al. | LINC00271 inhibits epithelial-mesenchymal transition of papillary thyroid cancer cells by downregulating trefoil factor 3 expression | |
| Guan et al. | LncRNA HIF1A-AS2 modulated by HPV16 E6 regulates apoptosis of cervical cancer cells via P53/caspase9/caspase3 axis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |