CN109929852A

CN109929852A - Hybridized Chinese tuliptree body embryo radicle extends key gene LhHB9 and its application

Info

Publication number: CN109929852A
Application number: CN201910284374.3A
Authority: CN
Inventors: 陈金慧; 陆凤娟; 郝兆东; 陈桢雨; 陈新颖; 翁禹豪; 施季森; 成铁龙; 汪贵斌
Original assignee: Nanjing Forestry University
Current assignee: Nanjing Forestry University
Priority date: 2019-04-09
Filing date: 2019-04-09
Publication date: 2019-06-25
Anticipated expiration: 2039-04-09
Also published as: CN109929852B

Abstract

The invention discloses a kind of hybridized Chinese tuliptree body embryo radicle elongation key gene LhHB9 and its applications.The hybridized Chinese tuliptree body embryo radicle extends the DNA sequence dna of key gene LhHB9 as shown in SEQ ID NO.1.The present invention clones the cDNA sequence of the LhHB9 gene of hybridized Chinese tuliptree, constructs the over-express vector of LhHB9 gene, using hybridized Chinese tuliptree embryo callus subculture as acceptor material, carries out genetic transformation using agrobacterium-mediated transformation.After G418 screens to obtain transgenosis callus, it is detected, primarily determines transgenosis success.It is found by inducing LhHB9 gene transgenic callus body embryo, transgenosis body embryo radicle has apparent elongation, and statistical data is shown, 35S:LhHB9 somatic embryo radicle is most significant compared with compareing CK, illustrate that the elongation of radicle can be promoted by being overexpressed target gene, have good practicability.

Description

Hybridized Chinese tuliptree body embryo radicle extends key gene LhHB9 and its application

Technical field

The invention belongs to gene engineering technology fields, and in particular to a kind of hybridized Chinese tuliptree body embryo radicle elongation key gene LhHB9 and its application.

Background technique

Plant somatic embryo occurs (referred to as " body embryo generation ") to refer to that body cell generates the mistake of new individual in vitro Journey.Steward obtained somatic embryo using carrot suspension system for the first time in 1958.Hereafter, multiple species pass through somatic embryo regeneration Approach obtains intact plant.Body embryo generation is a universal phenomenon in plant, using different organs, tissue plus suitable External condition can largely induce somatic embryo regeneration.Since zygotic embryo is buried among blastular, and there is individual smaller, quantity Less, the features such as inconsistent is developed, therefore is difficult that early stage zygotic embryo deeply and carefully study.And body embryo generating process and conjunction Similar, the property easy to control of artificial operability and environment that body embryo occurs occurs for sub- embryo, so that body embryo generating system becomes research The excellent alternative system that plant early stage zygotic embryo occurs.Many important species, which have passed through body embryo generation technique and realize engineering, educates The industrialization of seedling, this technology are not only able to achieve quick breeding, and be increasingly becoming researchers study development of plants mechanism, Gene expression regulation carries out the rare excellent system of breed improvement, is of great significance in theoretical and application.

Hybridized Chinese tuliptree, which is that China is distinctive, uses material and reproducting tree species, and body embryo occurs to study to receive greatly to pay attention to. Early period, the applicant had been achieved for important progress for the generation research of hybridized Chinese tuliptree somatic embryo.Plant body embryo occurs It is a complexity, fine process, is not only influenced by external condition, also by the regulation of a variety of internal mechanisms, such as gene tune Control, hormone regulating and controlling, signal transduction regulation and miRNA regulation etc..

MiRNA is prevalent in Plant Genome, is the non-coding RNA point that a kind of size is about 21~23 nucleotide Son.It mainly passes through the translation for combining the shearing for mediating said target mrna or inhibiting target molecule complementary with target gene on post-transcriptional level The expression of gene is adjusted, is occurred and polarity, root system development, zygotic embryo body early embryo pattern formation and the side of body to regulate and control Leaf pattern Compel response etc..MiRNAs relevant to body embryo generation mainly have miR156, miR159, miR160, miR161, miR164, MiR165, miR166, miR167, miR168, miR171, miR319, miR390 and miR394^[110]Deng the mistake such as in arabidopsis Expression miR167 can inhibit body embryo to be formed, and show that its negative regulation body embryo occurs.This effect is mainly shown as in embryo callus subculture The change of auxin response and local Auxin transport.

Less about study on regulation of the miRNAs in the generation of hybridized Chinese tuliptree body embryo, rarely seen graceful combination high pass of Lee measures Sequence and the hybridization discovery of miRNA micro-fluid chip participate in the miRNA type of this growth course, and to miR397 and its target gene into Biology pre-test is gone.

Summary of the invention

Goal of the invention: the deficiencies in the prior art are directed to, the object of the present invention is to provide a hybridized Chinese tuliptree bodies Embryo radicle extends key gene LhHB9, meets the use demand of body embryo generation.It is a further object of the present invention to provide a kind of above-mentioned The application of hybridized Chinese tuliptree body embryo radicle elongation key gene LhHB9.

Technical solution: in order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention are as follows:

Hybridized Chinese tuliptree body embryo radicle extends key gene LhHB9, and DNA sequence dna is as shown in SEQ ID NO.1.

The expression albumen of the hybridized Chinese tuliptree body embryo radicle elongation key gene LhHB9, amino acid sequence such as SEQ Shown in ID NO.2.

Expression vector, host strain containing the hybridized Chinese tuliptree body embryo radicle elongation key gene LhHB9.

Application of the hybridized Chinese tuliptree body embryo radicle elongation key gene LhHB9 in body embryo generation.

The hybridized Chinese tuliptree body embryo radicle elongation key gene LhHB9's is promoting answering in the elongation of body embryo radicle With.

The utility model has the advantages that compared with prior art, the present invention clones the cDNA sequence of the LhHB9 gene of hybridized Chinese tuliptree, The over-express vector of building LhHB9 gene is carried out using hybridized Chinese tuliptree embryo callus subculture as acceptor material using agrobacterium-mediated transformation Genetic transformation.After G418 screens to obtain transgenosis callus, it is detected, primarily determines transgenosis success.By right The induction discovery of LhHB9 gene transgenic callus body embryo, transgenosis body embryo radicle have apparent elongation, and statistical data is shown, 35S: LhHB9 somatic embryo radicle is most significant compared with compareing CK, illustrates that the elongation of radicle can be promoted by being overexpressed target gene, be had very Good practicability.

Detailed description of the invention

Fig. 1 is kanamycin-resistant callus tissue screening and proliferation results figure；In figure, note: A: the screening of kanamycin-resistant callus tissue；B: the increasing of kanamycin-resistant callus tissue It grows；

Fig. 2 is the PCR amplification electropherogram of target gene；In figure, M:M15000, band is respectively 15000bp, 10000bp, 7500bp, 5000bp, 2500bp, 1000bp, 250bp；CK+: positive control；CK-: negative control (WT)；

Fig. 3 is hybridized Chinese tuliptree transgenic somatic cell embryo figure；In figure: A: non-transgenic body embryo；B: non-transgenic body embryo is (only The processing of 100mg/L cephalosporin antibiotic is added in induced medium I)；C:35S:LhHB9；

Fig. 4 is transgenosis and non-transgenic body embryo radicle statistical results chart；In figure: A. radicle root long statistical chart, Duncan Method is in the horizontal extremely significant difference of detection of P < 0.01；B:CK；C:35S:LhHB9.

Specific embodiment

The present invention is described further combined with specific embodiments below.

Embodiment 1LhHB9 gene cloning

1, hybridized Chinese tuliptree RNA is extracted

Using hybridized Chinese tuliptree blade as material, RNA, specific steps are extracted are as follows: (1) mortar is sufficiently pre-chilled to liquid using liquid nitrogen Nitrogen addition mortar is not until reboiling；(2) not more than 50mg plant tissue is put into the mortar for fill liquid nitrogen and is fully ground (2- 3 times)；(3) when liquid nitrogen part is volatilized and sample does not melt, 1mL lysate is added, continues to be ground to sample complete with lysate It mixes, is placed on and is melted into homogenate naturally at room temperature；(4) homogenate is transferred in 2mL centrifuge tube with liquid-transfering gun；(5) room temperature, 12000r/min is centrifuged 2 minutes, is drawn supernatant liquid and is moved to new pipe；(6) isometric 24: 1 are added, is vortexed and mixes, 12000r/ Min is centrifuged 2 minutes, is drawn top layer's liquid and is moved to new pipe, records liquid volume；(7) isometric 70% ethyl alcohol is added, overturns mixed Even (30 times), by mixed liquor move to collect column in, 12000r/min be centrifuged 1 minute, abandon filtrate, residual mixed liquor save on ice to All cross column；(8) add 400 μ L Wash Solution, 12000r/min centrifugation 1 minute, abandon filtrate, put back to collecting pipe；(9) it mentions Preceding preparation DNA digestive ferment adds 100 μ L in collecting in column, and 4000r/min is centrifuged 1min；After centrifugation, by filtrate obtained by step (8) Again it is transferred to and collects on column, 25~30 DEG C of standing 15mi n；(10) plus 400 μ LWash Solution are into collection column, 14000r/min is centrifuged 1min, abandons filtrate, puts back to collection column；(11) step (10) are repeated；(12) 14000r/min 2min, it is thorough Column is collected in bottom drying, discards collecting pipe；(13) column will be collected to be placed in new 1.7mL elution pipe (Kit offer)；(14) 50 are added μ L Elution Solution is in collection column；(15) 200~2000rpm are centrifuged 2min, and then 14000r/min is centrifuged 1min；(16) 2000 quantitative detection RNA concentration of Nanodrop is used, detects RNA integrality with 1% agarose gel electrophoresis.

2, reverse transcription obtains cDNA

The RNA of extraction is tried by the HiScript II 1st Strand cDNA Synthesis Kit of Vazyme company Agent box reverse transcription obtains cDNA, and specific reverse transcription system (being used for PCR) primer is as follows:

LhHB9-F:5 '-CTTCTGTTTTGGTGGTTTTCTTGGG-3 '；

LhHB9-R:5 '-GTCCTCTACCTACATTGGCTATCTT-3 '.

Process are as follows: 1) RNA template denaturation, mixed liquor: RNase free ddH₂O adds to 8 μ L, 1 μ LOligo (d T)₂₃VN (50 μM), 1pg-5 μ gTotal RNA.65 DEG C of heating 5min, are immediately placed in and are quenched on ice, and stand 2min on ice.2) Reaction solution: mixed liquor 8 the μ L, 10 μ L2 × RT Mix, 2 μ LHiScript II Enzyme Mix of step 1): cDNA synthesis is used Liquid-transfering gun gently blows and beats mixing.Response procedures: 25 DEG C of 5min, 50 DEG C of 45min, 85 DEG C of 2min.

Using this cDNA as template, subsequent PCR is carried out.

3、PCR

Using above-mentioned cDNA as template, PCR amplification, system are as follows: 2 × PCR buffer are carried out using the KOD FX enzyme of high-fidelity 10 μ L, 2mM dNTPs, 4 0.620 0.620 μ L, Template DNA of μ L, LhHB9-R (10 μM) of μ L, LhHB9-F (10 μM) >= 120 μ L, KOD FX (1.0 U/ μ L) 0.420 μ L, Distilled water supplements 20 μ L.

PCR reaction condition is as follows: 94 DEG C of 2min；98 DEG C of 10s, Tm-5 DEG C of 30s, 68 DEG C of 30s/kbp, 35cycles；4 DEG C of guarantors It deposits.

After reaction, glue detection is run with 1% agarose gel electrophoresis, gel extraction is carried out to purpose band.

4, target fragment gel extraction

It takes a small amount of PCR product after the detection of 2% agarose gel electrophoresis, for example predicts the purpose band of size, do again Glue, gel extraction after electrophoresis, with QIAquick Gel Extraction Kit (50) kit recovery purifying of QIAGEN company P CR amplified production.Specific steps are as follows: cut the gel containing target fragment in the UV lamp, sop up surface liquid simultaneously with paper handkerchief Chopping, calculated for gel weight, the weight is as a gel volume；The buffer QG of 3 times of volumes is added, is dissolved at 50 DEG C, Period is fluxing every 2-3min vortex, until gel is completely melt；The isopropanol of 1 times of volume is added, is mixed by inversion；By previous step Mixed liquor be added in spin column (being placed in 2mL centrifuge tube), 13000rpm 1mi n, abandon filtrate, if mixed liquor is more than 800 μ L multiple can cross column；750 μ LBuffer PE, 13000rpm 1m in are added, abandon filtrate；Sky removes remaining from 2min wash buffer；QIAquick column is placed in clean 1.5mL centrifuge tube, the Buffer of 50 μ L is added to film center EB (10mM TrisCl, pH 8.5) is centrifuged 1min, eluted dna.

5, carrier connects

Using the T-Vector pMD of Takara company^TM19 (Simple) are attached reaction, 10 μ L linked systems and journey Sequence are as follows: 3 μ L ddH₂O, 1 μ LT-Vector pMD^TM19 (Simple), the PCR product of 1 μ L purification and recovery, 5 μ LSol ution I.Reaction condition: 16 DEG C of 30min.

6, the conversion of Escherichia coli

This time converting E. coli competent used is the DH5 α competent cell (CB101) purchased from TIANGEN company, Specific step of converting are as follows: competent cell is taken to melt on ice；2 μ L connection products are taken to be added to 100 μ LDH5 α competent cells In, flick mixing, ice bath 30min；90sec is placed in 42 DEG C of water-baths, is quickly transferred to standing 3m on ice, the process is not Shake centrifuge tube；800 μ LLB culture mediums (antibiotic-free) are added, 37 DEG C, 150rpm 45mi n recovers；4000rpm centrifugation 2min sops up 800 μ L culture medium of upper layer, and remaining bacterium solution is resuspended；Bacterium solution is coated on to the LB solid culture containing corresponding antibiotic On plate, 37 DEG C of inversions are incubated overnight.

7, bacterium solution PCR detection and sequencing

It is fallen in LB liquid medium (containing corresponding antibiotic) from 6 single bacteriums of picking on sifting motion cultivation plate, 37 DEG C, 250rpm 12-16h carries out PCR detection to the bacterium solution for shaking out, and the reaction system and response procedures of bacterium solution PCR is same as above, wherein reaction cycle Number is 35cycles.It is that positive bacterium solution selects the sequencing of 3 Ge Song Jin Sirui Biotechnology Co., Ltd at random by electrophoresis detection.

It obtains gene order and (contains non-coding sequence) as shown in SEQ ID NO.1, be named as LhHB9 gene, expression Albumen is as shown in SEQ ID NO.2.

The verifying of embodiment 2LhHB9 gene function

1, LhHB9 over-express vector constructs

It is PJIT166 that target gene and mutant target gene body transient expression vector, which construct carrier is carrier used,.This time carrier structure Build the method using homologous recombination.Agents useful for same is the Gibson of NEBPremixed liquid, entire assembling flow path are shown in the website NEB Https: //www.neb.com/applications/cloning-and-synthetic-biology/d na-assembly- and-cloning/g ibson-assembly。

(1) PCR generates Insert Fragment

With online website (http://nebuilder.neb.com/) design primer of NEBuilder, primer sequence is such as Under:

PJIT166-LhHB9F:5 '-ggagaggacagcccaagcttATGGCGCTTGCGATGCAC-3 ',

PJIT166-LhHB9R:5 '-gctcaccatggatcctctagaAAGAAAAGACCAGTTCATGAACAAGAA GGC-3′。

With target gene and T-Vector pMD^TMIt is template that correct positive plasmid, which is sequenced, in 19 (Simple), using the Q5 of NEB Enzyme carries out PCR, specific reaction system: 2 × Master of Q5High-Fidelity Mix 25 μ L, 10 μM of Forward Primer 2.5 μ L, 10 μM of 2.5 μ L, Template DNA variable, Nuclease-Free Wa of Reverse Primer Ter supplements 50 μ L.

Response procedures: 98 DEG C of 30s；98 DEG C of 10s, 68 DEG C of 30s, 72 DEG C of 20-30s/kb, 72 DEG C of 2min, 32 circulations；It 4 DEG C, protects It deposits.

Reaction product runs glue, gel extraction by 1% gel electrophoresis, and specific method is shown in same embodiment 1.

(2) linearisation of PJIT166 carrier

Using PJIT166 plasmid as template, double digestion is carried out to it using HindIII and XbaI, digestion system is as follows: DNA 1 μ g, 10 × CutSmart Buffer 5 μ L, HindIII-HF 1 μ L, XbaI 1 μ L, Nuclease-Free be supplemented to 50 μ L, In 37 DEG C of incubation 5-15min.Digestion purifying is carried out using 25:24:1 (phenol: chloroform: isoamyl alcohol) is now matched；If digestion system is less than 300 μ L add TE to mend to 300 μ L；Isometric mixing 25: 24: 1, acutely for several times, 12000rpm is centrifuged 2min for oscillation；Take supernatant extremely In another clean 1.5mL centrifuge tube, step 3 is repeated, records supernatant volume；Isometric 24: 1 are added, acutely vibrate, 12000rpm is centrifuged 2min；It takes supernatant into another clean 1.5mL centrifuge tube, repeats step 5, record supernatant volume；It is added 1/9 volume 3M NaAc, is mixed by inversion；- 20 DEG C of freezing dehydrated alcohols of 2 times of (supernatant NaA c) volumes are added, -20 DEG C at least 30min；12000rpm, 0 DEG C of 30min, supernatant；700 μ L, 70% alcohol washes, 12000rpm, 5min, 4 DEG C, ultra-clean work Platform drying, 20 μ L ddH₂O dissolution.

(3) connection reaction

Using the Gibson of NEB companyPremixed liquid is assembled, and specific system is as follows:

Total Amount of Fragments 0.02-0.5pmols X μ L, Gibson Assembly Master 10 μ L, Deionized H of Mix (2X)₂O10-X μ L, 20 μ L of total volume.

Reaction condition: 50 DEG C of 15min.After reaction, product is converted into DH5 α, chooses single colonie bacterium solution PCR, send survey.

Target gene over-express vector construction method is same as above, and carrier is carrier used is PBI121, and PCR prepares Insert Fragment institute Primer sequence is as follows:

PBI121-LhHB9-F:5 '-ggagagaacacgggggactctagaggatccATGGCGCTTGCGATGCAC- 3′；

PBI121-LhHB9-R:5 '-ttgaacgatcggggaaattcgagctcTCAAAGAAAAGACCAGTTCATGAA CAAGAAGG-3′。

2, genetic transformation

1) foundation of transformation receptor

Acceptor material selects the embryo callus of 15~20d of subculture, and callus at this time grows fine, physiological status It is good, it is used directly for converting.

2) recombinant plasmid transformed Agrobacterium

It is Agrobacterium tumefaciens strain EHA105 strain that the present embodiment, which converts bacterial strain used in target gene positive recombinant plasmid, is adopted It is converted with heat shock method, the specific steps are as follows:

Agrobacterium competence is melted on ice, takes 3 μ L that correct recombinant plasmid is sequenced in 200 μ L competence, flicks It mixes, ice bath 30min；Liquid nitrogen flash freezer 1min, 37 DEG C of thermal shock 3min are immediately placed in 2min on ice；Add 800 μ LLB (antibiotic-free) Fluid nutrient medium, 28 DEG C of 100rpm, 2-4h；4000rpm is centrifuged 2min, removes 800 μ L supernatants, remaining bacterium solution is resuspended, and applies It is distributed on the LB solid medium containing corresponding antibiotic；30-48h is cultivated in 28 DEG C of inversions, until growing single colonie；PCR detection Positive colony, 4 DEG C save backup.

3) prepared by Agrobacterium bacterium solution

1) from positive single colonie of the picking after PCR is detected on the LB culture plate of activation, 10mL is inoculated into containing corresponding anti- In the LB liquid medium of raw element, 28 DEG C, 220r/min shaken cultivation；2) about after 20h, 2mL bacterium solution is drawn, 50mL is inoculated into and contains Have in the LB liquid medium of corresponding antibiotic, 28 DEG C, 220r/min shaken cultivation to OD₆₀₀Value is 0.6-0.8；3) by bacterium solution It is sub-packed in 50mL centrifuge tube, in 5000r/min, 4 DEG C of centrifugation 2min, supernatant is removed, collects thallus；4) hybridized Chinese tuliptree M13 liquid is used Thallus is resuspended in body subculture medium, until OD₆₀₀It is 0.5 or so.

4) it infects and co-cultures

Callus tweezers stone roller is opened, so that it is spread out, is immersed in 10~15min in the bacterium solution prepared, then It is sieved with the steril cell of 150 mesh and filters bacterium solution, then by the callus picking in cell sieve to added with 100 μm of ol/L acetyl fourths On the M13 solid medium of ketone musk, dark culture 2-3d is as co-cultured.

5) bacterium and resistance screening are taken off

It is mainly antibacterial to achieve the effect that by washing bacterium and the suitable cephalosporin of addition after co-cultivation.By embryo callus subculture group Picking is knitted into 100mL triangular flask, is alternately cleaned with the M13 fluid nutrient medium and sterile water of addition cephalosporin, it is general to clean 3-4 times, scavenging period be no more than 10min, cleaned liquid be it is bright, finally with 150 mesh steril cells be sieved through sieve, as far as possible Be filtered dry liquid, will be cultivated on the callus picking to the M13 solid medium added with 300mg/L on sieve, to 20d with Afterwards, it is transferred into added with being cultivated on the M13 solid subculture medium of 200mg/L cephalosporin and 90mg/L G418, delay is sieved Choosing.Equal kanamycin-resistant callus tissues are grown, and are transferred to the new M13 solid squamous subculture added with 100mg/L cephalosporin and 90mg/L G418 Continue screening and culturing on base, until resistance.

Through co-cultivation and resistance screening after, non-transgenic callus mostly become brown, growth it is heavily suppressed, And transgenosis callus grows out (Fig. 1) from the non-transgenic callus of browning group.Finally from the callus for turning target gene Resistant cell line is obtained, the transgenic calli of acquisition is transferred on the screening and culturing medium of new addition G418 antibiotic, The expansion for carrying out the later period is numerous.

6) transgenic calli PCR is detected

Using the method for mediated by agriculture bacillus, successfully by target gene introductive crossing Liriodendron embryo callus, by anti- Property screening all obtain resistant calli, through G418 more times screening after, resistance is still stable.Transgenic calli is expanded Materials, the extraction for genomic DNA after numerous.35S-F is used to the transgenic calli for turning LhHB9: TGAAGATAGTGGAAAAGGAAGGTG (Duan Xulie on 35S promoter) and gene specific downstream primer carry out PCR and test It demonstrate,proves (Fig. 2).As a result band of the same size is amplified in transgenosis callus and positive recombinant plasmid, and in non-transgenic callus With fail to expand purpose band, the success of preliminary identification transgenosis in water.

Figure it is seen that transgenosis callus positive rate is very high after G418 more times screenings.For turning turning for LhHB9 Gene callus randomly selects 3 from above-mentioned authenticated positive cell line, establishes suspension system, broken up by body embryo Culture medium somatic embryos.The genomic DNA of somatic embryo is extracted, and carries out PCR verifying with above-mentioned primer, finally obtained PCR result same as callus.Illustrate that T-DNA does not lose, it is more stable in plant.

7) it is overexpressed the Phenotypic Observation of LhHB9 somatic embryo

The positive transgenosis callus for turning LhHB9 of verifying and non-transgenic callus are established into suspension cell line simultaneously, In induced medium I (3/4MS+2,4-D 2.0mg/L+BA 0.2mg/L+CH 0.5g/L+Vc 5mg/L+ sucrose 30g/L, pH It is sieved after culture (dark, 23 ± 2 DEG C, revolving speed 95r/min) 21d with 400 aim cells sieve on 5.7-5.8), through inducing Medium ii (3/4MS+NAA 0.2mg/L+BA 0.2mg/L+KT 0.5mg/L+CH 0.5g/L+Vc 5mg/L+ sucrose 50g/ L, pH 5.7-5.8) cultivate (dark, 23 ± 2 DEG C, revolving speed 95r/min) two days later, go to body embryo differential medium (3/4MS+ ABA 2.0mg/L+LH 0.2g/L+Vc 5mg/L+Ac 2g/L+ sucrose 40g/L+Agar 2.4g/L, pH 5.7-5.8) it is enterprising The induction of row body embryo (it is dark, it 23 ± 2 DEG C, cultivates 4 weeks, is transferred to 16h (illumination)/8h (dark) and cultivates 2 weeks, rolling bottle).

Phenotypic Observation is carried out to the transgenosis body embryo of culture 45d or so, each three ware of sample repeats, and every ware randomly selects 90 A list embryo carries out counting statistics, is averaged.It carries out morphologic observation under Stereo microscope and takes pictures.

What is overexpressed target gene influences the growth and development of callus without, still grows vigorous.Transgenosis is cured Wound and non-transgenic callus induce body embryo simultaneously, observe their morphological development situation.The result shows that turning the callus group of target gene It knits later period body embryo inducibility and is not affected (Fig. 3).

The somatic embryo of 45d or so is observed, it is found that the radicle of transgenosis body embryo is obviously longer than compareing, under stereomicroscope The length of radicle is measured, each three ware of sample repeats, and every ware randomly selects 90 single embryos.The result shows that the embryo of transgenosis body embryo Root long degree is longer than non-transgenic, and the body embryo radicle length for turning LhHB9 is 3 times (Fig. 4) of control.

Sequence table

<110>Nanjing Forestry University

<120>a kind of hybridized Chinese tuliptree body embryo radicle elongation key gene LhHB9 and its application

<130> 100

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2794

<212> DNA

<213> Liriodendron chinense × tulipifera

<400> 1

cttctgtttt ggtggttttc ttgggttttg aagtgaaatt ggaggtgggt tttgtgattt 60

ttctagaaag ctagcttgtt ttgggaattt gcttggaaca tttggagaaa tggcgcttgc 120

gatgcacaag gattcgtcgg cagcagcagc agcagcagca gcagcagcta agcagttgga 180

tgcaagcaag tatgtgaggt atacgcccga gcaggttgag gcgttggaga gggtgtatat 240

ggagtgcccg aagccgagct cgatgcgtag gcagcagctt ataagagaat gccctatact 300

gtcgaatatc gagccgaagc agatcaaggt ctggtttcag aatcgaagat gccgcgagaa 360

gcagaggaaa gaagcttcac gtctccagac agtaaacagg aagctcactg ccatgaacaa 420

gctgttgatg gaggagaacg accgcctaca gaagcaggtc tcgcagctgg tgtatgagaa 480

tggatacatg cggcagcaac tgcagaatgc atctgtggcg accacggaca caagctgcga 540

gtccgtggtc actagcggtc agcaccaaca aaacccaaca ccacagcatc cgcaaaggga 600

tgctaacaac ccagctgggc tccttgcgat tgcagaggag accctggcag agttcctctc 660

caaggctact ggaactgctg tcgactgggt ccagatgctt gggatgaagc ctggtccgga 720

ttctattgga atcgttgctg tttcccacaa ctgtagtggg gttgcagcac gagcctgcgg 780

tcttgtgagt ttagaaccca caaaggtcgc agaaatcctc aaagatcgtc catcgtggtt 840

ccgtgattgc cgttgcctcg agatagttac tgtgctccct gctgggaatg gagggactat 900

cgagcttatt tacatgcaga catatgcacc tactacattg gcatctgcac gcgacttttg 960

gacgctgaga tacaccacgg gtttagaaga tggcagtctt gtgatctgtg agaggtcact 1020

gactccatca actggtggcc cagctggccc gcctgctcca aactttgtac gagctgaaat 1080

gctccccagt ggttatctga tccgcccatg tgagggtggt ggctcgatca ttcacatcgt 1140

tgatcacgtc gatttagatg catggagtgt ccccgaggtg ctccgcccac tctatgaatc 1200

gtcgaagata ctggcacaga aaatgacaat tgcggcattg cgccacataa ggcaaattgc 1260

tcaagagacc agcggggaaa ttgtatatgg tgggggccgt cagcctgcag tgctacgaac 1320

atttagtcag agattaagca ggggtttcaa tgatgctgta aatggttttg cggatgatgg 1380

gtggtcgttg atgggcaatg atggtatgga ggatgtcact atcgccatta actccacgcc 1440

aaacaagctt tttggttctc atgttaactc aacaatgctc cctacaatgg gaggtggcgt 1500

gctatgtgca aaggcatcca tgctgctcca gaatgtgcca cctgctttgc ttgtccgctt 1560

tctgagggag caccgttctg agtggtccga ctgtggcatt gatgcttatt ctgctgcctc 1620

gctgaaggcc agtccttatg cggtccctgg tgcaagagca ggtggcttcc ccggcagtca 1680

ggtcatttta cctcttgctc ataccgttga acacgaagag atgttggagg ttatcaggct 1740

tgaaggccat gggttcgccc aagatgatgc tattttatca agagacatgt acttgttaca 1800

gctatgcagt ggaattgatg aaaatgcagc aggtgcatgt gcccagcttg tctttgcgcc 1860

gattgatgaa tacttcgccg atgattcccc actactgccg tcgggtttcc gtgtcatacc 1920

attagaccca aaaacagatg ggccggcggc gactcgaaca ctcgaccttg catctgcgct 1980

tgaaggacca ggtggggcac gcccagttgg tgaagccacg acaaacgcat ataatttaag 2040

atctgtgctg acaattgcat tccagtttac atatgagaac cacctccgtg acaatgtggc 2100

ggcgatggcc cgccagtatg ttcgaagcgt tgtggggtcg gtacagaggg tggcaatggc 2160

aatcgcacct tcacgacttg gctcacatgt ggggccaaag ccgccacctg ggacccctga 2220

ggccctcacc ctggcgcggt ggatttgccg gagctacagg ttccatactg gagtggagct 2280

cctcagggct gactctcaag aaggcgattc tgttttgaaa ctgctgtggc accattctga 2340

tgctatcatg tgctgttcat tgaaatctaa tgcatcaccg gtcttcacct ttgcgaacca 2400

agcgggcctt gacatgttgg aaaccacact cattgctcta caggatatca tgcttgacaa 2460

gattctcgat gagggcggcc ggaaggtttt gtgttcagag tttgccaaga ttatgcaaca 2520

gggttttgct tatctgccat ctggagtgtg cgtctcgagc atgggcagac cagtgtcgta 2580

tgagcaagca attgcatgga aggtcctgaa tgaagaggac tcaaatcact gcttggcctt 2640

cttgttcatg aactggtctt ttctttgaac ccatatatat tatatagatt tccctagttt 2700

ggcttgagaa aactttctta aactctcctc tgcccttctc ttattatata tataatgctt 2760

aagttatgaa agatagccaa tgtaggtaga ggac 2794

<210> 2

<211> 852

<212> PRT

<213> Liriodendron chinense × tulipifera

<400> 2

Met Ala Leu Ala Met His Lys Asp Ser Ser Ala Ala Ala Ala Ala Ala

1 5 10 15

Ala Ala Ala Ala Lys Gln Leu Asp Ala Ser Lys Tyr Val Arg Tyr Thr

20 25 30

Pro Glu Gln Val Glu Ala Leu Glu Arg Val Tyr Met Glu Cys Pro Lys

35 40 45

Pro Ser Ser Met Arg Arg Gln Gln Leu Ile Arg Glu Cys Pro Ile Leu

50 55 60

Ser Asn Ile Glu Pro Lys Gln Ile Lys Val Trp Phe Gln Asn Arg Arg

65 70 75 80

Cys Arg Glu Lys Gln Arg Lys Glu Ala Ser Arg Leu Gln Thr Val Asn

85 90 95

Arg Lys Leu Thr Ala Met Asn Lys Leu Leu Met Glu Glu Asn Asp Arg

100 105 110

Leu Gln Lys Gln Val Ser Gln Leu Val Tyr Glu Asn Gly Tyr Met Arg

115 120 125

Gln Gln Leu Gln Asn Ala Ser Val Ala Thr Thr Asp Thr Ser Cys Glu

130 135 140

Ser Val Val Thr Ser Gly Gln His Gln Gln Asn Pro Thr Pro Gln His

145 150 155 160

Pro Gln Arg Asp Ala Asn Asn Pro Ala Gly Leu Leu Ala Ile Ala Glu

165 170 175

Glu Thr Leu Ala Glu Phe Leu Ser Lys Ala Thr Gly Thr Ala Val Asp

180 185 190

Trp Val Gln Met Leu Gly Met Lys Pro Gly Pro Asp Ser Ile Gly Ile

195 200 205

Val Ala Val Ser His Asn Cys Ser Gly Val Ala Ala Arg Ala Cys Gly

210 215 220

Leu Val Ser Leu Glu Pro Thr Lys Val Ala Glu Ile Leu Lys Asp Arg

225 230 235 240

Pro Ser Trp Phe Arg Asp Cys Arg Cys Leu Glu Ile Val Thr Val Leu

245 250 255

Pro Ala Gly Asn Gly Gly Thr Ile Glu Leu Ile Tyr Met Gln Thr Tyr

260 265 270

Ala Pro Thr Thr Leu Ala Ser Ala Arg Asp Phe Trp Thr Leu Arg Tyr

275 280 285

Thr Thr Gly Leu Glu Asp Gly Ser Leu Val Ile Cys Glu Arg Ser Leu

290 295 300

Thr Pro Ser Thr Gly Gly Pro Ala Gly Pro Pro Ala Pro Asn Phe Val

305 310 315 320

Arg Ala Glu Met Leu Pro Ser Gly Tyr Leu Ile Arg Pro Cys Glu Gly

325 330 335

Gly Gly Ser Ile Ile His Ile Val Asp His Val Asp Leu Asp Ala Trp

340 345 350

Ser Val Pro Glu Val Leu Arg Pro Leu Tyr Glu Ser Ser Lys Ile Leu

355 360 365

Ala Gln Lys Met Thr Ile Ala Ala Leu Arg His Ile Arg Gln Ile Ala

370 375 380

Gln Glu Thr Ser Gly Glu Ile Val Tyr Gly Gly Gly Arg Gln Pro Ala

385 390 395 400

Val Leu Arg Thr Phe Ser Gln Arg Leu Ser Arg Gly Phe Asn Asp Ala

405 410 415

Val Asn Gly Phe Ala Asp Asp Gly Trp Ser Leu Met Gly Asn Asp Gly

420 425 430

Met Glu Asp Val Thr Ile Ala Ile Asn Ser Thr Pro Asn Lys Leu Phe

435 440 445

Gly Ser His Val Asn Ser Thr Met Leu Pro Thr Met Gly Gly Gly Val

450 455 460

Leu Cys Ala Lys Ala Ser Met Leu Leu Gln Asn Val Pro Pro Ala Leu

465 470 475 480

Leu Val Arg Phe Leu Arg Glu His Arg Ser Glu Trp Ser Asp Cys Gly

485 490 495

Ile Asp Ala Tyr Ser Ala Ala Ser Leu Lys Ala Ser Pro Tyr Ala Val

500 505 510

Pro Gly Ala Arg Ala Gly Gly Phe Pro Gly Ser Gln Val Ile Leu Pro

515 520 525

Leu Ala His Thr Val Glu His Glu Glu Met Leu Glu Val Ile Arg Leu

530 535 540

Glu Gly His Gly Phe Ala Gln Asp Asp Ala Ile Leu Ser Arg Asp Met

545 550 555 560

Tyr Leu Leu Gln Leu Cys Ser Gly Ile Asp Glu Asn Ala Ala Gly Ala

565 570 575

Cys Ala Gln Leu Val Phe Ala Pro Ile Asp Glu Tyr Phe Ala Asp Asp

580 585 590

Ser Pro Leu Leu Pro Ser Gly Phe Arg Val Ile Pro Leu Asp Pro Lys

595 600 605

Thr Asp Gly Pro Ala Ala Thr Arg Thr Leu Asp Leu Ala Ser Ala Leu

610 615 620

Glu Gly Pro Gly Gly Ala Arg Pro Val Gly Glu Ala Thr Thr Asn Ala

625 630 635 640

Tyr Asn Leu Arg Ser Val Leu Thr Ile Ala Phe Gln Phe Thr Tyr Glu

645 650 655

Asn His Leu Arg Asp Asn Val Ala Ala Met Ala Arg Gln Tyr Val Arg

660 665 670

Ser Val Val Gly Ser Val Gln Arg Val Ala Met Ala Ile Ala Pro Ser

675 680 685

Arg Leu Gly Ser His Val Gly Pro Lys Pro Pro Pro Gly Thr Pro Glu

690 695 700

Ala Leu Thr Leu Ala Arg Trp Ile Cys Arg Ser Tyr Arg Phe His Thr

705 710 715 720

Gly Val Glu Leu Leu Arg Ala Asp Ser Gln Glu Gly Asp Ser Val Leu

725 730 735

Lys Leu Leu Trp His His Ser Asp Ala Ile Met Cys Cys Ser Leu Lys

740 745 750

Ser Asn Ala Ser Pro Val Phe Thr Phe Ala Asn Gln Ala Gly Leu Asp

755 760 765

Met Leu Glu Thr Thr Leu Ile Ala Leu Gln Asp Ile Met Leu Asp Lys

770 775 780

Ile Leu Asp Glu Gly Gly Arg Lys Val Leu Cys Ser Glu Phe Ala Lys

785 790 795 800

Ile Met Gln Gln Gly Phe Ala Tyr Leu Pro Ser Gly Val Cys Val Ser

805 810 815

Ser Met Gly Arg Pro Val Ser Tyr Glu Gln Ala Ile Ala Trp Lys Val

820 825 830

Leu Asn Glu Glu Asp Ser Asn His Cys Leu Ala Phe Leu Phe Met Asn

835 840 845

Trp Ser Phe Leu

850

<210> 3

<211> 25

<212> DNA

<213>LhHB9-F primer sequence (Artificial)

<400> 3

cttctgtttt ggtggttttc ttggg 25

<210> 4

<211> 25

<212> DNA

<213>LhHB9-R primer sequence (Artificial)

<400> 4

gtcctctacc tacattggct atctt 25

<210> 5

<211> 38

<212> DNA

<213>PJIT166-LhHB9 F primer sequence (Artificial)

<400> 5

ggagaggaca gcccaagctt atggcgcttg cgatgcac 38

<210> 6

<211> 51

<212> DNA

<213>PJIT166-LhHB9 R primer sequence (Artificial)

<400> 6

gctcaccatg gatcctctag aaagaaaaga ccagttcatg aacaagaagg c 51

<210> 7

<211> 48

<212> DNA

<213>PBI121-LhHB9-F primer sequence (Artificial)

<400> 7

ggagagaaca cgggggactc tagaggatcc atggcgcttg cgatgcac 48

<210> 8

<211> 58

<212> DNA

<213>PBI121-LhHB9-R primer sequence (Artificial)

<400> 8

ttgaacgatc ggggaaattc gagctctcaa agaaaagacc agttcatgaa caagaagg 58

<210> 9

<211> 24

<212> DNA

<213>35S-F sequence (Artificial)

<400> 9

tgaagatagt ggaaaaggaa ggtg 24

Claims

1. hybridized Chinese tuliptree body embryo radicle extends key gene LhHB9, DNA sequence dna is as shown in SEQ ID NO.1.

2. the expression albumen of hybridized Chinese tuliptree body embryo radicle elongation key gene LhHB9 described in claim 1, amino acid sequence Column are as shown in SEQ ID NO.2.

3. expression vector, host containing hybridized Chinese tuliptree body embryo radicle described in claim 1 elongation key gene LhHB9 Bacterium.

4. application of the hybridized Chinese tuliptree body embryo radicle elongation key gene LhHB9 described in claim 1 in body embryo generation.

5. hybridized Chinese tuliptree body embryo radicle elongation key gene LhHB9's described in claim 1 is promoting the elongation of body embryo radicle In application.