CN110540994A

CN110540994A - Gene LhWOX5 for growth of main root of hybrid liriodendron tulipifera as well as expression protein and application thereof

Info

Publication number: CN110540994A
Application number: CN201910885883.1A
Authority: CN
Inventors: 陈金慧; 王丹丹; 石睿智; 王子琪; 朱礼明; 翁禹豪; 施季森; 陆叶
Original assignee: Nanjing Forestry University
Current assignee: Nanjing Forestry University
Priority date: 2019-09-18
Filing date: 2019-09-18
Publication date: 2019-12-06
Anticipated expiration: 2039-09-18
Also published as: CN110540994B

Abstract

The invention discloses a major root growth key gene LhWOX5 gene of hybrid liriodendron tulipifera, and an expression protein and application thereof. The nucleotide sequence of the major root growth key gene LhWOX5 gene of the hybrid liriodendron is shown as SEQ ID NO.1, and the amino acid sequence of the expression protein is shown as SEQ ID NO. 2. The application quantitatively analyzes the expression of the LhWOX5 gene in different tissue parts of the hybridized liriodendron by fluorescent quantitative PCR, and the result shows that the LhWOX5 has higher expression level in stem tips, buds and roots, such as parts with active growth. After a vector is constructed by using the LhWOX5 gene, the LhWOX5 gene is overexpressed in the hybrid liriodendron by an agrobacterium transformation method, and the result shows that the main root of a plant overexpressing the LhWOX5 gene is obviously shortened in the hybrid liriodendron, so that the LhWOX5 gene has important application in the growth of the main root of the hybrid liriodendron.

Description

Gene LhWOX5 for growth of main root of hybrid liriodendron tulipifera as well as expression protein and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a major root growth key gene LhWOX5 gene of a hybrid liriodendron tulipifera, and an expression protein and application thereof.

Background

The liriodendron is unique in China, and is bright and beautiful because the leaf shape is like a Chinese jacket, also called a Chinese jacket, and the flower is like tulip. It has strong resistance to diseases and pests, and is not only fast in growth but also drought-resistant. The leaves are golden yellow in autumn and the fallen leaves are very beautiful. Is a non-pollution and environment-friendly species for street trees and garden ornamental trees. In the aspect of medicinal activity, the liriodendron has obvious antitumor activity. In addition, the liriodendron has resistance to toxic gases such as sulfur dioxide and the like, and can be planted as a purifying plant in areas with serious air pollution.

The hybrid Liriodendron (Liriodendron sino-americanum) is obtained by selecting Chinese lushan mountain Liriodendron as female parent and hybridizing with Liriodendron tulipifera in 1963 by a famous professor in forest breeders. The hybrid liriodendron exhibits obvious hybrid advantages, such as straight trunk, peculiar leaf shape, large and beautiful flower, fast growth, good material quality and the like, so that the hybrid liriodendron is not only an afforestation tree species worthy of popularization, but also an important material tree species. In addition, with the rapid popularization of hybrid liriodendron and the increasing growth of cultivation area in recent years, the demand for high-quality seedlings has increased greatly.

Based on the important functions of the WOX gene family and the characteristics of obvious difference in the distribution of the WOX gene family on plant groups with different evolutionary positions. Further, due to the current dispute on the evolution of Liriodendron tulipifera, it is thought to be at the base of dicotyledonous plants, but it was classified at the base of angiosperm in the 2016 APG classification system. The WOX family is an important transcription factor family, and the research on the family has certain complementary significance to the identification of the liriodendron in the evolutionary position. On the other hand, the study on the WOX gene family of the liriodendron has important significance for understanding the growth and development mechanism of the liriodendron, and two old trees with high practical value of the liriodendron can be better understood and utilized. No study reports the function of the WOX5 gene in the hybrid liriodendron.

Disclosure of Invention

The invention aims to solve the technical problem of providing a key gene LhWOX5 for the growth of the main root of the hybrid liriodendron tulipifera, and meets the use requirement. The invention also aims to provide an expression protein of the major root growth key gene LhWOX5 of the hybrid liriodendron tulipifera. The invention also aims to solve the technical problem of providing the application of the major root growth key gene LhWOX5 of the hybrid liriodendron.

In order to solve the technical problems, the invention adopts the technical scheme that:

The nucleotide sequence of the major root growth key gene LhWOX5 gene of the hybrid liriodendron is shown in SEQ ID NO. 1.

The amino acid sequence of the expression protein of the major root growth key gene LhWOX5 of the hybrid liriodendron tulipifera is shown as SEQ ID NO. 2.

The application of the major root growth key gene LhWOX5 gene of hybrid liriodendron tulipifera in the growth of liriodendron tulipifera.

The application is to promote the growth of the main root of the hybrid liriodendron.

The carrier containing the major root growth key gene LhWOX5 gene of the hybrid liriodendron.

The host bacterium containing the major root growth key gene LhWOX5 gene of the hybrid liriodendron.

The vector is applied to expression of major root growth key gene LhWOX5 protein of hybrid liriodendron.

the host bacterium is applied to the expression of the major root growth key gene LhWOX5 protein of the hybrid liriodendron.

The application of the major root growth key gene LhWOX5 gene of the hybrid liriodendron in plant growth.

The application of the major root growth key gene LhWOX5 gene of the hybrid liriodendron in the differentiation of the stabbing plant stem cells.

Has the advantages that: compared with the prior art, the method disclosed by the application carries out quantitative analysis on the expression of the LhWOX5 gene in different tissue parts of the hybrid liriodendron by fluorescent quantitative PCR, and the result shows that the LhWOX5 has higher expression level in stem tips, buds and roots, such as active parts. After the LhWOX5 gene is used for constructing a vector, the main root of a plant over-expressing the LhWOX5 gene in the hybrid liriodendron is obviously shortened by an agrobacterium transformation method, and the LhWOX5 gene has important application in the growth of the main root of the hybrid liriodendron.

Drawings

FIG. 1 is an electrophoretogram of the plasmid pBI121-LhWOX5 E.coli;

FIG. 2 is a PCR electrophoretogram of a single colony of Agrobacterium tumefaciens pBI121-LhWOX 5;

FIG. 3 is a graph showing the results of expression levels of LhWOX5 gene at different sites; the materials corresponding to the left and the right are as follows: leaves; a stem; a root; a stem tip; sprouting; flower petals; stamens; pistil;

FIG. 4 is a diagram of transgenic calli; wherein the lower diagram is an enlarged diagram of the picture in the upper diagram frame;

FIG. 5 is a diagram of the PCR validation results of transgenic calli;

FIG. 6 is a diagram of the status of a flat somatic embryo; in the figure, 121 represents the over-expression of LhWOX5 with a scale bar of 0.2 um;

FIG. 7 is a plot of root length of transgenic plants; control (CK) on the left and LhWOX5 gene overexpression on the right;

FIG. 8 is a graph of statistics of LhWOX5 gene overexpression root length.

Detailed Description

The present invention will be further described with reference to the following specific examples.

Example 1 cloning of LhWOX5 Gene of hybrid Liriodendron tulipifera, vector construction and transformation screening

Based on transcriptome data, designing specific primers, extracting RNA of lateral buds of the trema tulipifera, inverting to obtain cDNA, carrying out PCR to obtain a specific strip, cutting gel, recovering, and connecting with a 19T-Vector pMDTM19(Simple) cloning Vector. Subsequently, the LhWOX5 gene on the cloning vector was sequenced and aligned with the transcriptional group of hybrid tulip tree and the genomic database of tulip tree, after confirmation, specific primers were designed and ligated to the expression vector pBI121 (for overexpression) via Gibson ligation, and escherichia coli (e.coli) DH5 α and agrobacterium EHA105 were transformed. The material used in this example was lateral bud of hybrid liriodendron tulipifera in campus of Nanjing forestry university, and was immediately frozen in liquid nitrogen for further use after collection. The main process is as follows:

1. Total RNA extraction

1) Extracting RNA of lateral buds of the hybridized liriodendron tulipifera: using the reagent kit for extracting total RNA from Norgen plants, all solid articles such as tips and centrifuge tubes are soaked in 0.1% DEPC water, and sterilized in autoclave at 121 deg.C for 40 min. The extraction procedure was consistent with the description.

2) RNA integrity detection: the band size and brightness were observed by electrophoresis on a 1% agarose gel. The complete RNA has three bands of 28rSRNA, 18rSRNA and 5rSRNA, the brightness of 28rSRNA is twice that of 18rSRNA, the third band can not be seen, and the result meets the use requirement.

3) and (3) RNA purity detection: detected with Nonodrop 2000. The RNA with higher purity has OD260/OD280 value of 1.8-2.0 and OD260/OD230 value of 2.0, and the result shows that the extracted RNA has higher purity.

2. cDNA Synthesis

Using the total RNA of the hybrid liriodendron as a template, first strand cDNA was synthesized by reverse transcription using Invitrogen's reverse transcription kit. The template is the RNA extracted as above, and the system is as follows: mu.L 10mM dNTP Mix, 1. mu.L Primer Oligo (dT), 1ug Total RNA, RNase free ddH2O to 10. mu.L. Lightly blow and beat the mixture by a pipette gun and mix the mixture evenly. Keeping the temperature at 65 ℃ for 5min, and rapidly cooling on ice for 1-2 min. The template RNA/primer denaturing solution was pooled at the bottom of the centrifuge tube by low speed centrifugation for several seconds. Adding the following reverse transcription reaction liquid into the centrifuge tube in sequence: mu.L of RNA/primer denaturing solution, 2. mu.L of 10 XTT Buffer, 4. mu.L of 25mM MgCl2, 2. mu.L of 0.1M DTT, 1. mu.L of RNaseOUT (40U/. mu.L), 1. mu.L of SuperScript III RT. Keeping the temperature at 50 ℃ for 5min, and keeping the temperature at 85 ℃ for 5 min. Centrifugation was carried out at 4000rpm for 1min, and 1. mu.L of RNase H was added to each reaction at 37 ℃ for 20min, followed by obtaining a cDNA solution.

3. Design and cloning of target Gene

1) Designing a primer: according to the existing transcription group data of the hybrid liriodendron, BLAST is used for searching and comparing, corresponding primers are designed by using Primer 5.0 according to the comparison result, Oligo7.0 is used for analyzing the primers, and finally the primers are determined as follows:

LhW5F：5’-GAAGATCCGATCATAGAAACAGAG-3’；

LhW5R：5’-CTCAGATTGGAATCGTATCCG-3’。

2) PCR amplification reaction

The first strand cDNA is used as a template, and Platinum Taq high fidelity DNA polymerase of Invitrogen company is used for PCR to improve the specificity and accuracy of the amplification reaction. PCR amplification System: mu.L 10 XPCR Buffer, 0.4. mu.L 10mM dNTPs, 1.2. mu.L MgSO4(25mM), 1. mu.L Forward Primer, 1. mu.L Reverse Primer, 2. mu.L cDNA, 0.1. mu.L Platinum Taq, ddH2O to 20. mu.L. And (3) PCR reaction conditions: 4min at 94 ℃; 30Cycles at 94 ℃ for 30s, 57 ℃ for 30s, 72 ℃ for 45 s; 10min at 72 ℃; storing at 4 ℃.

3) Recovery, vector ligation and sequencing of target genes

And (3) recovering the target fragment: the PCR product was electrophoresed on 1% agarose gel, and purified and recovered using DNA gel recovery kit from AXYGEN, the procedure of which was identical to the kit instructions.

And (3) connecting the target fragment with a cloning vector: the ligation reaction is carried out by adopting a pMD19-T Vector (D102A) Vector of TaKaRa company, and the reaction system is as follows: mu.L of Ligation Buffer, 0.5. mu.L of pMD19-T Vector, 2. mu.L of PCR purified product (50 ng). Blowing and stirring uniformly by using a liquid transfer gun, centrifuging at low speed, and connecting in a water bath kettle at 16 ℃ overnight.

Ligation product transformation and sequencing: LB (+ Amp) solid medium was prepared. The JM109 competent cells were removed from-80 ℃ and thawed on ice. Add 5. mu.L of ligation product, mix gently, and place on ice bath for 30 min. The mixture was heat-shocked at 42 ℃ for 90s and then immediately placed on ice for 2 min. 800. mu.E of LB liquid medium (without Amp) was added, and the mixture was cultured at 37 ℃ for 1 hour with shaking at 180 rpm. Centrifuge at 4000rpm for 3min, discard 800. mu.L of supernatant, and resuspend the pellet in the remaining LB. Spreading the re-suspension solution of the last step on the solid culture medium, and performing inverted culture at 37 ℃ for 12-16 h.

Screening positive clones and identifying bacteria liquid by PCR: white monoclonal colonies on LB plates were picked and inoculated into 750. mu.L of LB liquid medium containing Amp antibiotics. The cells were cultured overnight at 220rpm at 37 ℃.

The PCR system of the bacterial liquid is as follows: mu.L of 10 XPCR Buffer, 0.4. mu.L of 10mM dNTPs, 1.2. mu.L of MgSO4(25mM), 1. mu. L M13F, 1. mu. L M13R, 1. mu.L of bacterial suspension, 0.1. mu.L of rTaq, ddH2O to make up to 20. mu.L.

And (3) PCR reaction conditions: 5min at 94 ℃; 30Cycles at 94 ℃ for 30s, 57 ℃ for 30s, and 72 ℃ for 1 min; 10min at 72 ℃; storing at 4 ℃.

After the reaction is finished, 5 mu L of PCR product is taken for agarose gel electrophoresis detection, the bacteria liquid with correct band after verification is subjected to sequencing by Yingjun company, and universal primers M13 and M13R are used for sequencing; the sequence is as follows:

Performing bioinformatics analysis according to the sequencing result, and determining that the ORF sequence of the target gene is shown as SEQ ID NO.1 and named as LhWOX5 gene; the coded amino acid sequence is shown in SEQ ID NO. 2.

4) LhWOX5 gene connection expression vector

Based on the sequencing results for 19T-simple, suitable primers were designed using Oligo7.0 and NEB μ Lider Assembly Tool (http:// nebulilder. NEB. com /), and the sequences of the primers were as follows:

The LhWOX5 gene on 19T-simple is used as a template, a pair of primers LhW5F and LhW5R are adopted, and high-fidelity enzyme Q5 of NEB company is used for PCR amplification, so that the specificity and the accuracy of the amplification are improved.

PCR amplification System: 25 μ L Q5 UltraFidelity 2xMaster Mix, 2.5 μ L10 uM Primer #1, 2.5 μ L10 uM Primer #2, 1ng-1ug μ L Template DNA, ddH2O to 50 μ L.

PCR reaction procedure: 30s at 98 ℃; 30s at 98 ℃, 30s at 57 ℃, 30s at 72 ℃ and 30Cyc1 es; 2min at 72 ℃; storing at 4 ℃.

Recovering and purifying target genes: the PCR product was subjected to Gel detection to confirm the band size, and a DNA Gel recovery Kit (QIAquick Gel Extraction Kit, ID: 28704) from QIAGEN was used in accordance with the instructions of the Kit.

The target gene plus overlap: the LhWOX5 gene recovered by cutting gel is used as a template, a pair of primers LhW5F-OL and LhW5R-OL are adopted, and Q5 high-fidelity enzyme of NEB company is used for PCR amplification, so that the specificity and the accuracy of the amplification are improved. The PCR amplification system is the same as above. PCR reaction procedure: 30s at 98 ℃; 98 ℃ for 10s, 62 ℃ for 30s, 72 ℃ for 30s, 30 Cycles; 2min at 72 ℃; storing at 4 ℃. The overlap gene is added, and the fragment is recovered and purified, the steps are the same as above.

carrying out Q5 enzyme amplification (overlap) on a 19T-simple (LhWOX5) target gene segment, wherein the segment size is 622bp, primers are LhW5F-OL and LhW5R-OL, gel detection is carried out after PCR result recovery, and a gel graph shows that the size of the obtained segment basically accords with expectation, and the experiment can be continued.

5) Expression vector acquisition and pretreatment

Obtaining an expression vector: a DHA alpha (pBI121 empty vector) bacterial solution stored at-80 ℃ was streaked by an inoculating needle onto an LB plate containing kanamycin (50mg/L), and was cultured overnight at 37 ℃ in an inverted state. And then carrying out small shaking, large shaking and plasmid extraction on the bacterial liquid.

Pretreatment (enzyme digestion) of the expression vector: selecting two restriction enzyme sites of XbaI and SacI according to the multiple cloning sites on the pBI121 vector, carrying out double restriction on pBI121 in an idle load manner, wherein the restriction enzyme system comprises: mu.L of XbaI, 1. mu.L of SacI, 10. mu.L of plasmid, 5. mu.L of 10 xClutrsmart, ddH2O to 50. mu.L. Incubate at 37 ℃ for 4 hours.

6) Expression vector recovery

And (3) carrying out electrophoresis on the enzyme digestion reaction product in 1% agarose gel, and carrying out gel cutting recovery on the enzyme digestion empty load by using a DNA gel recovery kit of QIAGEN company, wherein the steps are consistent with the kit specification.

7) Ligation of purified fragments to expression vectors

The target gene (overlap) and pBI121 recovered after the digestion reaction were unloaded and ligated with Gibson reagent from NEB as follows: 0.01pmols Linear Vector, 0.2pmols PCR Fragment, 5. mu.l Gibson Assembly Master Mix (2X), ddH2O to 20. mu.L. PCR reaction procedure: 60min at 50 ℃.

8) Transformation and screening of ligation products

And (3) transforming the connection product into escherichia coli: the product of the no-load ligation of the gene of interest with pBI121 was transferred into competent cells of E.coli DHAa (purchased from TIANGEN, ID: CB101) in a procedure consistent with the instructions.

9) Screening of recombinant plasmids and sequencing of positive clones: a single colony growing on the plate was picked up with a white pipette tip with a forceps, and the tip was placed in 800. mu.L of LB liquid medium containing kanamycin, shaken at 37 ℃ and 250rpm for 12-16 h. Thereafter, PCR verification of the bacterial suspension was performed. The PCR amplification system and reaction procedure were as above. And after the PCR reaction is finished, carrying out agarose gel electrophoresis detection, verifying to obtain a bacterial liquid sample with a correct band size, and sending the bacterial liquid sample to a Kinsley company for sequencing. Primers used for sequencing were LhW5F, LhW 5R.

4. Recombinant plasmid transformed agrobacterium

And E, performing plasmid extraction on the Escherichia coli with correct sequencing result, transferring the extracted recombinant plasmid into an Agrobacterium tumefaciens competent cell EHA105, screening positive strains by using antibiotics kanamycin (50mg/L) and gentamicin (100mg/L) and kanamycin and streptomycin (30mg/L) respectively, and further verifying the strains by bacterial liquid PCR.

Coli, and performing gel quality detection on the extracted plasmid, wherein the result is shown in fig. 1. The control was performed with 3 pBI121 empty plasmids (14758), and two pBI121-LhWOX5(13434bp) fragments were considered as different states of the plasmid, and the results were consistent with the expectations.

Recombinants transforming EHA 105: EHA105 competence was self-made in the laboratory and stored in an ultra-low temperature freezer at-80 ℃. The conversion steps are as follows: (1) thawing competent cells in an ice bath, adding at least 100ng of expression vector plasmid, gently mixing uniformly, and carrying out ice bath for 20-30 min; (2) quickly freezing for 1min by using liquid nitrogen, thermally shocking for 3min at 37 ℃, and quickly placing on ice for 1-2 min; (3) adding 800 μ L LB culture medium without antibiotics, resuscitating at 28 deg.C and 200rpm for 3.5 h; (4) centrifuging at 4000rpm for 3min, and sucking part of supernatant; (5) uniformly mixing the residual bacteria liquid, and smearing the bacteria liquid on a solid LB culture medium added with 50mg/L kanamycin; (6) and (4) carrying out inverted culture at 28 ℃ for 36-48 h.

Transforming the extracted E.coli plasmid into agrobacterium EHA105, verifying the positive of the transformed single colony by PCR, carrying out gel detection on the PCR product, and obtaining results shown in figure 2, wherein the four single colonies respectively picked are all positive.

Example 2 expression analysis of LhWOX5 Gene

In this example, the expression of the cloned LhWOX5 gene in the hybrid liriodendron tulipifera was analyzed based on real-time fluorescent quantitative PCR technology, and the materials used include the root, stem, leaf and stem tip of somatic embryo seedling, and bud, petal, stamen and pistil of big tree. The materials are used for extracting RNA and carrying out reverse transcription to obtain cDNA, and the expression conditions of the LhWOX5 gene in different tissue parts are analyzed by a real-time fluorescent quantitative PCR technology.

1. Materials: petals, stamens, pistils and tender buds of the hybrid Chinese tulip trees collected in the late ten-day flowering period of 4 months; root, stem, leaf, stem tip of somatic plantlets (leaf removed, top 1cm), three biological replicates per type of sample.

2. Method of producing a composite material

1) Total RNA extraction: using a general plant Total RNA extraction kit (centrifugal column type, ID: RP3301) from Bioteke, all solid articles such as tips, centrifuge tubes, etc. were soaked in 0.1% DEPC water and sterilized at 121 ℃ in an autoclave for 40 min. The extraction procedure was consistent with the description.

2) Total RNA integrity and purity were measured as in example 1, and the results showed that 28S and 18S were distinct, and 28S brightness was twice that of 18S, and Nonodrop 2000 measured OD260/OD280 of 2.07 and OD260/OD230 of 2.03, indicating that RNA extraction quality was better.

3) And (3) cDNA synthesis: the reverse Kit (HiScript 1st Strand cDNA Synthesis Kit, ID: R211-02) of Novozan was used, and the template was the above-mentioned extracted RNA, system: 1pg-1ug Total RNA, 1. mu.L Random hexamers (50 ng/. mu.L), 1. mu.L Oligo (dT)23VN (50. mu.M), 2. mu.L HiScriptII Enzyme Mix, 10. mu.L 2 XT Mix, RNase free ddH2O to 20. mu.L. Gently pipetting and mixing. The first cDNA strand was synthesized by PCR as follows: 5min at 25 ℃; 15min at 50 ℃; at 85 ℃ for 2 min. Subpackaging, storing at-20 deg.C for a long time at-80 deg.C to avoid repeated freeze thawing.

4) LhWOX5 gene tissue expression real-time fluorescence quantitative PCR

Real-time fluorescent quantitative PCR (qRT-PCR) reagents Novozam reagent (AceQ qPCR SYBR Green Master Mix (without ROX), D: Q121-02) was used. Each sample was reacted in triplicate on a LightCycler 480ii (roche) machine and the data extraction analysis was performed using LightCycler 480 software.

designing a primer: according to the requirements of qRT-PCR primers, primers of the LhWOX5 gene are designed. Screening of internal reference primers and analysis of the melting curve were performed using LightCycler 480II (Roche), and 18S rRNA was selected as the internal reference gene in the hybrid Liriodendron tulipifera, because the 18S rRNA was most consistent in expression level with different sites at each time, the primers were as follows:

Primer name	Primer sequence (5 '-3')
		18SrRNA-F	ATTTCTGCCCTATCAACTTTCG
18SrRNA-R	TTGTTATTTATTGTCACTACCTCCC
		qLhW5F	AACACAAGCTCATATCTCTAC
qLhW5R	TCACAAATAACTCAGCCGCA

Reaction system: according to the kit specification, the real-time fluorescent quantitative PCR reaction system is as follows: mu.L of AceQ qPCR SYBR Green Master Mix (Without ROX), 0.4. mu.L of Primer1 (10. mu.M), 0.4. mu.L of Primer 2 (10. mu.M), ddH2O to make up to 20. mu.L. The reaction program is set by SYBR Green I96-II standard, wherein the main process steps are as follows: 95 ℃ for 10s, 60 ℃ for 10s, 72 ℃ for 10s, 40 Cycles.

And (3) after the specificity of the primer is verified according to the dissolution curve, adjusting the concentration of the template to ensure that the difference between the Ct value of the template and the Ct value of the internal reference is less than 2. Leaf control is taken as reference and is marked as 1, and the expression of other tissues is taken as reference. As a result (FIG. 3), it was found that the LhWOX5 gene was expressed in different tissue sites of the hybrid liriodendron tulipifera, but the expression level was different, and that the LhWOX5 gene was expressed in the highest level in the shoot site, and then in the shoot apex and root sites.

Example 3 transfer of LhWOX5 Gene to obtain a hybrid Liriodendron

In this example, the constructed vector was transferred into callus by agrobacterium infection, and then the plant was induced for gene function analysis, and the callus used was the embryonic callus of hybrid liriodendron tulipifera induced in this laboratory. The agrobacterium transfected into the tulip tree callus is EHA 105. After obtaining seedlings of liriodendron tulipifera overexpressing the LhWOX5 gene, phenotype analysis and data statistics are carried out on the transgenic plants so as to research the function of the LhWOX5 gene.

1. Culture medium formula

M13 subculture medium: 3/4MS + Vc5mg/L +2, 4-D2 mg/L + BA0.2mg/L + CH0.5g/L + sucrose 30g/L + jerusalem artichoke 2.3 g/L;

Z36 medium: 3/4MS + Vc5mg/L + NAA0.2mg/L + KT0.5mg/L + BA0.2mg/L + CH0.5g/L + sucrose 50g/L + jerusalem artichoke 2.3 g/L;

Z14 medium: 3/4MS + Vc5mg/L + ABA2mg/L + Ac2g/L + CH0.2g/L + sucrose 40g/L + jerusalem artichoke 2.3 g/L;

Selecting a seedling culture medium: 3/4MS + Vc5mg/L + sucrose 30g/L + agar 7 g/L.

2. Transgenosis

1) Material pretreatment: if a subculture cycle is about 20 days, callus is harvested about 15 days after subculture, and cultured on medium containing AS (acetosyringone, 100umol/L) for 4-6 days.

2) Preparing bacterial liquid: (1) shaking the bacterial liquid greatly: 2mL LB (K + S + AS) and 20. mu.L of the inoculum were added to a10 mL centrifuge tube and shaken at 220rpm and 28 ℃ for 12-16h (the concentrations of K and S used were AS described above). (2) Expanding and culturing bacterial liquid: 50mL LB (K + S + AS) and 2mL of a small-shaking bacterium solution are added into a 250mL centrifuge tube, the mixture is shaken at 220rpm and 28 ℃ for 4 to 6 hours, and the OD value is detected to be 0.8 to 1.0. (3) Pretreating before infection of bacterial liquid: transferring 40mL of the bacterial liquid to a 50mL centrifuge tube, centrifuging at 5000rpm for 10min by using a centrifuge, discarding the supernatant, adding a proper amount of M13 liquid culture medium, and suspending until the final OD600 of the suspended bacterial liquid is 0.8. Resuspension formula: the OD value measured × 40mL is equal to the volume of 0.8 × M13 liquid medium.

3) Infection and co-culture: taking three dishes of left and right calluses in a clean bench, adding a proper amount of resuspended bacterial liquid into a triangular flask with the volume of 100mL, infecting for 10-15min, sieving with a 400-mesh sieve, filtering to dry the bacterial liquid, clamping filter paper with tweezers to suck the dry bacterial liquid, transferring the calluses to a solid M13 culture medium (+ AS), and culturing for 36-48 h.

4) And (3) bacteria removal: co-cultured calli were placed in 100mL Erlenmeyer flasks and washed alternately with liquid M13(+/-cef) until the callus wash was clear, and the calli were harvested with 400 mesh sieve and cultured on solid M13(+ cef). The bacteria removal time is not more than 10min, and the cef concentration is 200-300 mg/L.

5) Screening: after one subculture cycle, the infected calli were screened on solid M13(+ cef) plus G418(90 mg/L).

6) Callus PCR positive verification: one callus of the initial subculture is taken as a strain, and after the subculture reaches a sufficient number, one callus of each strain is taken to extract DNA for positive verification. Callus DNA was extracted using a novel plant genomic DNA extraction kit (centrifugal column type, ID: DP320) from TIANGEN, the extraction procedure was in accordance with the instructions, and 20. mu.L of mercaptoethanol per sample was added only during the sample grinding. The extracted DNA was positively detected by using Takara rTaq.

transfected calli were obtained according to the above method as shown in FIG. 4. Relative to CK, transgenic calli were slightly brownish in color, which should be the result of cephalosporin and G418 selection, and after several subcultures, the calli were gradually improved.

According to the above method, PCR positive detection was performed on transgenic callus lines, and the results are shown in FIG. 5. The primer for the calli overexpressing LhWOX5 was 35S-F & LhW5R, and the size of the resulting band was as expected.

3. Obtaining transgenic plants

The transgenic plant is obtained by adopting a liquid suspension culture method. The method comprises the following steps:

Liquid culture: (1) a250 mL triangular flask is selected, about 3 dishes of callus are clamped by forceps and placed on the wall of the triangular flask, and the cells are scattered and the area is about 5 square centimeters by slight flattening. (2) 45mL of M13 liquid medium was measured in a measuring cylinder, and the calli on the wall of the Erlenmeyer flask were rinsed off. (3) Culturing for one week on a shaker at 23 deg.C and 95rpm, and checking cell state at regular time to avoid browning.

Subculturing: (1) taking out the suspension cells cultured on the shaking table for one week, placing the suspension cells on a shaking instrument at 100-150 rpm, keeping the shaking state of the cells, and shaking the triangular flask when subculture needs to be carried out; (2) the cells in suspension in the flask were transferred to 50 mL. Standing in a measuring cylinder until the supernatant is clear and the cells are settled; (3) removing supernatant, and subculturing into two parts if the cell volume is about 10 mL; (4) 5mL of cells were poured into a new sterilized Erlenmeyer flask, 45mL of M13 liquid medium was measured with a clean graduated cylinder, and the Erlenmeyer flask was placed back on the shaker and cultured for about one week.

Sieving: (1) taking out the suspension system after the subculture, pouring the suspension cells in the triangular flask into a sieve of 150+400 meshes, and waiting for the liquid to flow out; (2) when no obvious liquid exists in the 400mu sieve, measuring 50mL of Z36, and pouring single cells on the 400-mesh sieve into a new triangular flask; (3) the triangular flask is cultured on a shaking table to wait for spreading.

Paving a flat plate: plating was performed on the third day after sieving. (1) Spreading a piece of filter paper on cotton flowers by using tweezers, sucking 1.5-2 mL of screened single cells by using a pipette according to the concentration of the single cells, uniformly spreading the single cells on the filter paper, taking another pair of tweezers after the filter paper is dried, and putting the filter paper on a Z14 (G41810 mg/L) solid culture medium; (2) the remaining single cells were plated in the same manner, taking care that the tweezers that picked up dry filter paper and the tweezers that picked up wet filter paper were not mixed. The triangular flask still needs to be shaken from time to time during the period; (3) dark culture at 23 deg.c for about one month, illumination culture for one week, and transferring the seedling with two cotyledons to seedling selecting culture medium.

According to the above method, suspension cell culture was performed, and 20 days after plating, the resulting Liriodendron embryos showed differences in somatic embryo status as shown in FIG. 6.

4. Transgenic plant positive verification and phenotype observation statistics

The seedlings cultured for one month under the illumination are numbered according to strains, DNA is extracted for PCR positive identification, the primer is 35S-F & LhW5R, and the result shows that the transgenic plants have higher positive rate. 3 strains of seedlings with over-expressed genes are selected for measuring the root length of the seedlings, more than 30 plants are ensured to be totally obtained, and the statistical results are shown in a figure 7 and a figure 8, which show that the main roots of three strains of over-expressed LhWOX5 genes are obviously shortened.

according to the statistical results, the seedling stage of the hybrid liriodendron tulipifera belongs to the early growth stage, the cell differentiation rate of the plant over expressing the LhWOX5 gene is slowed down due to cell reprogramming, the root length is inhibited, and the main root of the plant is obviously shortened.

Sequence listing

<110> Nanjing university of forestry

<120> major root growth key gene LhWOX5 gene of hybrid liriodendron tulipifera, expression protein and application thereof

<130> 100

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 474

<212> DNA

<213> Liriodendron sino-americanum

<400> 1

atggacgaag gaatgtcagg tgtatgcatc aagggtggga aatgcggtgg tggtgggggc 60

cgctggaatc caacggcaga acaggttaaa attctgacgg atctgtttag atccggcctt 120

cgaactccca cgacggatca gattcagtgc atctcgactc acctcagctc ttacggtcag 180

atcgagagta agaacgtctt ctactggttc cagaatcaca aagctagaga ccgccagaag 240

cgccgcagga tctcagccgt ccaaacacaa gctcatatct ctactaaaca ttgtacggat 300

ggtcgcgggg agagagggat tgaaacgctg cagctgtttc ctttgcgttc gtacgaggga 360

tcggacggtg tggagaaggt gagattggtg aggaacgaac ggatggagat ggcgttgttg 420

gctgatgttg ggaaagacta tccaccgttg gatctgcggc tgagttattt gtga 474

<210> 2

<211> 157

<212> PRT

<213> Liriodendron sino-americanum

<400> 2

Met Asp Glu Gly Met Ser Gly Val Cys Ile Lys Gly Gly Lys Cys Gly

1 5 10 15

Gly Gly Gly Gly Arg Trp Asn Pro Thr Ala Glu Gln Val Lys Ile Leu

20 25 30

Thr Asp Leu Phe Arg Ser Gly Leu Arg Thr Pro Thr Thr Asp Gln Ile

35 40 45

Gln Cys Ile Ser Thr His Leu Ser Ser Tyr Gly Gln Ile Glu Ser Lys

50 55 60

Asn Val Phe Tyr Trp Phe Gln Asn His Lys Ala Arg Asp Arg Gln Lys

65 70 75 80

Arg Arg Arg Ile Ser Ala Val Gln Thr Gln Ala His Ile Ser Thr Lys

85 90 95

His Cys Thr Asp Gly Arg Gly Glu Arg Gly Ile Glu Thr Leu Gln Leu

100 105 110

Phe Pro Leu Arg Ser Tyr Glu Gly Ser Asp Gly Val Glu Lys Val Arg

115 120 125

Leu Val Arg Asn Glu Arg Met Glu Met Ala Leu Leu Ala Asp Val Gly

130 135 140

Lys Asp Tyr Pro Pro Leu Asp Leu Arg Leu Ser Tyr Leu

145 150 155

<210> 3

<211> 24

<212> DNA

<213> LhW5F sequence (Artificial)

<400> 3

gaagatccga tcatagaaac agag 24

<210> 4

<211> 21

<212> DNA

<213> LhW5R sequence (Artificial)

<400> 4

ctcagattgg aatcgtatcc g 21

<210> 5

<211> 24

<212> DNA

<213> M13F sequence (Artificial)

<400> 5

cgccagggtt ttcccagtca cgac 24

<210> 6

<211> 24

<212> DNA

<213> M13R sequence (Artificial)

<400> 6

gagcggataa caatttcaca cagg 24

<210> 7

<211> 24

<212> DNA

<213> 35S-F sequence (Artificial)

<400> 7

tgaagatagt ggaaaaggaa ggtg 24

<210> 8

<211> 50

<212> DNA

<213> LhW5F-OL sequence (Artificial)

<400> 8

tcatttggag agaacacggg ggactctaga gaagatccga tcatagaaac 50

<210> 9

<211> 45

<212> DNA

<213> LhW5R-OL sequence (Artificial)

<400> 9

ttgaacgatc ggggaaattc gagctcctca gattggaatc gtatc 45

<210> 10

<211> 22

<212> DNA

<213> 18SrRNA-F sequence (Artificial)

<400> 10

atttctgccc tatcaacttt cg 22

<210> 11

<211> 25

<212> DNA

<213> 18SrRNA-R(Artificial)

<400> 11

ttgttattta ttgtcactac ctccc 25

<210> 12

<211> 21

<212> DNA

<213> qLhW5F(Artificial)

<400> 12

aacacaagct catatctcta c 21

<210> 13

<211> 20

<212> DNA

<213> qLhW5R sequence (Artificial)

<400> 13

tcacaaataa ctcagccgca 20

Claims

1. The nucleotide sequence of the major root growth key gene LhWOX5 gene of the hybrid liriodendron is shown in SEQ ID NO. 1.

2. the expression protein of major root growth key gene LhWOX5 of claim 1, wherein the amino acid sequence of the expression protein is shown in SEQ ID NO. 2.

3. The use of the major root growth key gene LhWOX5 of claim 1 in the growth of Liriodendron tulipifera.

4. the use according to claim 3, for promoting the growth of the main root of hybrid Liriodendron tulipifera.

5. A vector containing the major root growth key gene LhWOX5 of the hybrid liriodendron tulipifera as claimed in claim 1.

6. A host bacterium containing the gene LhWOX5 essential for the growth of the main root of hybrid liriodendron tulipifera as claimed in claim 1.

7. The use of the vector of claim 5 for expressing the major root growth key gene LhWOX5 protein of hybrid Liriodendron tulipifera.

8. the use of the host bacterium of claim 6 for expressing the major root growth key gene LhWOX5 protein of hybrid Liriodendron tulipifera.