CN110592106A

CN110592106A - Molecular marker Lb14-3-3c gene and application thereof

Info

Publication number: CN110592106A
Application number: CN201911052263.6A
Authority: CN
Inventors: 郑蕊; 岳思君; 杨立明; 王丽娟; 石晶; 姚新灵; 陈任; 张兴; 冯嘉馨
Original assignee: Ningxia University
Current assignee: Ningxia University
Priority date: 2019-10-31
Filing date: 2019-10-31
Publication date: 2019-12-20

Abstract

The invention relates to a molecular marker Lb14-3-3c gene and application thereof, wherein the invention firstly loads an exogenous gene Lb14-3-3c into a plant expression vector containing a strong promoter CaMV35s, transforms the plant overexpression vector of the gene into potatoes, obtains 5 transgenic plants through phenotype observation and PCR positive identification, finds that the transgenic plants are superior to wild plants in growth vigor, the content of starch of the wild plants and the transgenic plants in seedling stage is not greatly different, and the content of starch of leaves of the transgenic potatoes in potato bearing stage and mature stage is higher than that of the wild plants and has obvious difference.

Description

Molecular marker Lb14-3-3c gene and application thereof

Technical Field

The invention belongs to the field of plant growth regulation and relates to a molecular marker Lb14-3-3c gene and application thereof.

Background

Ningxia wolfberry fruit (Lycium barbarum L) is one kind of Chinese traditional Chinese medicine material and important economic crop, and has the functions of regulating immunity, moistening lung, improving eyesight, etc. and its leaf, fruit and root contain protein, amino acid and trace elements essential for human body. The medlar is a commonly used traditional Chinese medicine for tonifying the liver and the kidney, and modern medical research proves that the medlar contains nutrient components such as carotene, vitamin A, vitamin C, vitamin B1, calcium, phosphorus, iron, zinc, manganese and the like, has the effect of promoting the hematopoietic function, and also has the effects of resisting aging, mutation, tumor, fatty liver, blood sugar and the like. In order to promote growth and improve yield, the usage amount of pesticides and chemical fertilizers in the planting process of the medlar is high, so that the production cost is increased, the environmental pollution is caused, and hidden troubles are brought to the quality safety of medlar products. Therefore, the cultivation of high-yield and high-quality Chinese wolfberry varieties plays an important role in improving the income of the national people in China and promoting the sustainable development of agriculture and related industries. The anther is an important component of plant reproductive organs, the normal development of the anther is the condition necessary for successfully forming seeds and fruits by the plant so as to complete the reproduction, and the research on the development mechanism of the flower organs and the anther of the medlar has important significance for improving the quality and the yield of the medlar.

Disclosure of Invention

The technical problem to be solved is as follows: the invention provides a molecular marker Lb14-3-3c gene and application thereof, wherein the gene can be used for improving the content of potato starch.

The technical scheme is as follows: the sequence of the medlar Lb14-3-3c gene is shown in SEQ ID NO. 1.

The sequence of the protein translated from the Lb14-3-3c gene of Chinese wolfberry is shown in SEQ ID NO. 2.

Application of the wolfberry Lb14-3-3c gene in preparing products for improving potato starch content.

Has the advantages that: according to the invention, the exogenous gene Lb14-3-3c is loaded into a plant expression vector containing a strong promoter CaMV35s for the first time, the plant overexpression vector of the gene is converted into the potato, 5 transgenic plants are obtained through phenotype observation and PCR positive identification, the growth vigor of the transgenic plants is found to be superior to that of wild plants, the starch content of the wild plants and the starch content of the transgenic plants in the seedling stage are not greatly different, the starch content of leaves of the transgenic potatoes in the nodulation stage and the mature stage is higher than that of the wild plants, and the difference is obvious.

Drawings

FIG. 1 is a drawing ofLb14-3-3cThe PCR amplification scheme of the gene is shown in the specification, wherein M is DNA molecular weight DL2000, and 1 is a PCR product;

FIG. 2 is a three-level structural diagram of predicted Lb14-3-3c protein;

FIG. 3 is a diagram showing the identification of the ligation direction of the over-expression recombinant plasmid Lb14-3-3c-pMD18-T and the target fragment; a, overexpression of Lb14-3-3C-pMD18-T plasmid, B, PCR identification and C, single enzyme digestion identification; m: DNA molecular weight DL2000, 1: Lb14-3-3c-F/Lb14-3-3c-R, 2: M13-F/M13-R, 3: M13-R/Lb14-3-3c-R, 4: M13-F/Lb14-3-3c-R, 5:Ecor Ӏ Single enzyme cleavage

FIG. 4 is a diagram showing the identification of the ligation direction of the expression-inhibiting recombinant plasmid Lb14-3-3c-pMD18-T and the target fragment; a, inhibiting and expressing a recombinant plasmid Lb14-3-3C-pMD18-T, B, carrying out PCR identification, and C, carrying out enzyme digestion identification; m is DNA molecular weight DL 2000; lb14-3-3c-F/Lb14-3-3 c-R; 2, M13-F/M13-R; M13-R/Lb14-3-3 c-R; M13-F/Lb14-3-3 c-R; 5:Ecor1 single enzyme digestion;

FIG. 5 shows PCR positive detection and restriction enzyme identification of overexpression monoclonal pCambia1305.1-35s-Lb14-3-3 c; PCR identification, enzyme digestion identification, M: DL2000 DNA molecular weight standard, M1: DL15000 DNA molecular weight standard, 1-4: colony PCR identification, 5:Ecor Ӏ single-restriction recombinant plasmid, 6:BamH Ӏ，SalӀ double-digested recombinant plasmid, 7:Ecor Ӏ monoenzymeCutting plasmid, 8:BamH Ӏ，SalӀ double digestion plasmid;

FIG. 6 is the PCR positive detection and enzyme digestion identification chart of the suppression expression monoclonal pCambia130.1-35s-Lb14-3-3 c; PCR identification, enzyme digestion identification, M: DL2000 DNA molecular weight standard, M1: DL15000 DNA molecular weight standard, and colony PCR of 1-3; 4:Ecor Ӏ single restriction plasmid, 5:BamH Ӏ，SalӀ double-digested plasmid, 6:Ecor Ӏ single-restriction recombinant plasmid, 7:BamH Ӏ，SalӀ double digestion of recombinant plasmid;

FIG. 7 is a schematic diagram of Agrobacterium-mediated transformation of potato; a is explant, B is callus, C is adventitious bud;

FIG. 8 is a schematic representation of a transgenic potato plant; a and C are wild type, B and D are transgenic plants;

FIG. 9 is a PCR identification map of transgenic potato; m is DNA molecular weight standard DL2000, CK + is positive control, CK-is negative control, 5 is non-transformed plant, 1-4,6 is positive transformed plant;

FIG. 10 is a graph comparing the starch content of transgenic potatoes. *: compared with wild plants, the transgenic plants have obvious difference (P is less than or equal to 0.01).

Detailed Description

The present invention will be described in further detail with reference to the accompanying drawings and examples. The following examples are intended to illustrate the invention only and are not intended to limit the scope of the invention. The experimental procedures, for which specific conditions are not indicated in the examples, are generally carried out according to conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations.

Example 1

1 materials and methods

1.1 materials

Ningxia matrimony vine Ningqi No.1 was collected from Ningxia Yunxingji Co Ltd in 6 months of 2017. Collecting roots, stems, leaves, flowers, Chinese olive, red fruit of Chinese wolfberry and flower buds (stamen primordium period, sporogenesis period, microspore mother cell period, tetrad period, mononuclear pollen period, dinuclear pollen period and pollen maturation period) in different development periods respectively, peeling off anthers on dry ice by measuring longitudinal and transverse diameters, observing forms and an anther tabletting method of the flower buds in different development periods, filling the flower buds in a centrifugal tube, quickly freezing by liquid nitrogen, and placing the flower buds in a refrigerator at the temperature of minus 80 ℃ for later use.

The aseptic purple-flower white seedling of potato variety is stored in the laboratory, and in an ultraclean bench, the aseptic bottle seedling is cut into 1 ~ 2 cm stem segments, two ends of which are provided with leaf axils, and the stem segments are inserted into a potato MS basic culture medium, and the stem segments are cultured for about 30 days under the conditions that the temperature is 24 +/-2 ℃ and the illumination intensity is 1000 ~ 3000 Lx, so that the aseptic potato seedling can be obtained.

1.2 Lb14-3-3cIsolation of genes

Taking out fructus Lycii anther stored in-80 deg.C ultra-low temperature refrigerator for use at each period, immediately quick freezing in liquid nitrogen, grinding into powder, extracting anther total RNA with plant total RNA extraction kit (Beijing Gilbert biotechnology, Inc.), referring to kit description, and determining RNA concentration and purity with ultramicro spectrophotometer. PrimeScript was obtained by Takara^TMThe first strand cDNA is synthesized by RT Master Mix reverse transcription kit, and the whole operation is carried out on ice box to prevent RNA degradation. The reverse transcription system is as follows: RNA 1-2. mu.g, 5 XPrimeScript^TMRT Master Mix 2. mu.L, add ddH₂O made the total volume 10. mu.L. The PCR reaction program is: storing at 85 deg.C for 30s and 4 deg.C, synthesizing cDNA, and storing at-20 deg.C for use.

Primers were designed using primer5.1 software, with the primer sequences: lb14-3-3 c-F: atggcgtctccacgcgagga, respectively; lb14-3-3 c-R: ttcattattatctggtttg are provided. Primers were synthesized by Shanghai Biometrics Ltd. PCR amplification is carried out by taking medlar anther cDNA prepared and stored at the temperature of 20 ℃ below zero as a template. The reaction system was 25. mu.L of 2 XMasterMix, 2. mu.L of forward primer (primer concentration 10. mu. mol/L), 2. mu.L of reverse primer (primer concentration 10. mu. mol/L), 2. mu.L of LcDNA and 19. mu.L of ddH₂And O. The amplification conditions were: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 1min, annealing at 48 ℃ for 1min, extension at 72 ℃ for 1min, 35 cycles; 72 ℃ for 10 min, cutting the gel, recovering the product, connecting the product to a pGEM-T Easy vector (Takara), and sending the positive plasmid bacterial liquid to a pGEM-T Easy vectorMarine bioengineering sequencing.

1.3 bioinformatics analysis

The basic properties of the protein were analyzed and predicted by using the BioXM2.6 software, NCBI-BlastP and ExPASy (http:// www.expasy.org) on-line software, the secondary structure of the protein was analyzed by using the SOPMA software, the tertiary structure was predicted by using the SWISS-MODEL on-line software, and the protein was analyzed and predicted by using the DNMAN 8 softwareLb14-3-3cThe protein coded by the gene is subjected to multiple sequence alignment, and an evolutionary tree is constructed by using an adjacent method of MEGA5.1 software.

1.4 spatio-temporal expression analysis

Designing medlar by using Primer5.1 softwareLb14-3-3cFluorescent quantitative PCR upstream and downstream primers (Lb14-3-3c-F ': tccgaactaaccgtcgaaga; Lb14-3-3 c-R': tgatgccacgtgttcttcat) for constitutive expression of gene by medlarActinIs an internal reference, and the primer sequence is as follows: Lvacin-F: gaccttcaatgttcccgctatg, Lbacin-R: gccatcaccagagtccaacac, real-time fluorescent quantitative PCR is performed. After the reaction, the change curve and dissolution curve of the fluorescence were analyzed, using 2^{－△△Ｃｔ}The method analyzes relative expression amount, and each sample is repeated for 3 times.

1.5 construction of plant expression vectors

PCR amplification was performed using the correctly sequenced Lb14-3-3c-pGEM-T Easy Vector plasmid as template, and the total volume of the reaction system was 50. mu.L, including 25. mu.L of 2 XMaster Mix, 2. mu.L of forward primer (primer concentration 10. mu. mol/L), 2. mu.L of reverse primer (primer concentration 10. mu. mol/L), 2. mu.L of cDNA and 19. mu.L of ddH₂And O. The amplification conditions were: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 1min, annealing at 48 ℃ for 1min, extension at 72 ℃ for 1min, 35 cycles; and (3) at 72 ℃ for 10 min, purifying and recovering the target fragment, connecting the target fragment to pMD18-T Vector to transform escherichia coli DH5 alpha, coating the obtained product on a plate containing 50 mg/ml ampicillin, growing overnight, picking out a monoclonal, and carrying out monoclonal PCR positive identification by using a gene full-length primer.

Using the recombinant monoclonal antibody with positive identification result as a template, and adopting general primers M13 (F: tgtaaaacgacggccagt; R: caggaaacagctatgacc) andLb14-3-3cupstream and downstream primers of genes, and bindingEcoDetermining the connection direction of the target fragment by single enzyme digestion of R Ӏ. After the connection direction of the target fragment of the recombinant vector is determined, the target fragment is usedBamH Ӏ andBamh Ӏ double enzyme digestion Lb14-3-3c-pMD18-T recombinant vector, reverse Lb14-3-3c-pMD18-T recombinant vector and plant expression vector pCambia1305.1-35s, target fragment is recovered, Lb14-3-3c-pMD18-T recombinant vector and plant expression vector pCambia1305.1-35s, reverse Lb 14-3-c-pMD 18-T recombinant vector and plant expression vector pCambia1305.1-35s are connected by T4 ligase overnight, and Escherichia coli DH 5a is transformed respectively. Coating the strain on a plate containing 50 mg/mL kanamycin, growing overnight, selecting positive monoclone after resistance screening and colony PCR identification, shaking bacteria, extracting recombinant plasmid for double enzyme digestion identification, transferring the recombinant plasmid into agrobacterium tumefaciens GV3101 by a liquid nitrogen freeze-thaw method, and carrying out PCR detection to obtain positive clone.

1.6 Agrobacterium-mediated transformation of Potato

Selecting 4 ~ 5 good-growing-condition potatoes (potato)Solanum tuberosum) And (3) cutting potato stem sections under the aseptic condition of the sterile purple-white seedlings, placing the potato stem sections on an MS pre-culture medium flat plate, completely sealing the potato stem sections, and culturing the potato stem sections for 2 days under the illumination condition. The agrobacterium liquid of the plant over-expression vector pCambia1305.1-35s-Lb14-3-3c is cultured to logarithmic phase, the pre-cultured potato stem segment is infected, after the infection is finished, the stem segment is placed in a co-culture medium and is cultured for 2 d in the dark under the condition of 22 ℃, so that the liquid can fully enter the stem segment, and the infection efficiency is improved.

Then, the explants which are co-cultured are rinsed by sterile water, and are blotted by filter paper, the explants are transferred to an induced callus culture medium containing kanamycin, the culture lasts for about 15 days, obvious callus grows out at two ends of a stem, the callus is transferred to a bud differentiation culture medium containing kanamycin, adventitious buds of 3 ~ 4 cm grow out after about 30 days, the adventitious buds are transferred to a rooting culture medium for rooting culture, and the whole process takes uninfected potato stem segments as a control.

1.7 phenotypic Observation and molecular identification of Positive plants

After hardening off, soil culture is carried out on potato plants, the growth conditions of the plants are observed in time, when the stem sections of the plants are thick and the number of leaves is large, the leaves are picked, and the whole plants are extracted after quick freezing by liquid nitrogenGenome, wild-type genomic DNA as negative control, CaMV35 s-F: 5'-gagcagcttgccaacatg-3', Lb14-3-3 c-R: 5'-ttcattattatctggtttg-3' is upstream and downstream primers, and PCR positive identification is carried out after leaf genome is diluted by 50 times. The total volume of the PCR reaction system was 25. mu.L, and contained 2 XMaster Mix 12.5. mu.L, 1. mu.L each of the upstream and downstream primers (10. mu. mol/L), 1. mu.L of the DNA template, and dd H₂O9.5. mu.L. The amplification conditions were: pre-denaturation at 94 ℃ for 3 min, denaturation at 94 ℃ for 1min, annealing at 50 ℃ for 1min, extension at 72 ℃ for 10 min, and 35 cycles.

1.8 transgenic Potato starch assay

Removing negative plants, continuously culturing the soil-cultured seedlings of the positive transgenic potatoes and wild plants, respectively collecting leaves in a seedling stage (25 d), a potato bearing stage (35 d) and a mature stage (60 d), determining the content of starch, and repeating the experiment for 3 times by using the wild potatoes in the same period as a control in the whole process. Refer to the kit instructions of Beijing Soilebao Co.

2 results and analysis

2.1 Lb14-3-3cCloning of genes

Using mixed cDNA of 7 periods (stamen primordium period, sporogenesis period, microsporocyte period, tetrad period, mononuclear pollen period, dinuclear pollen period and pollen maturation period) of Ningqi No.1 Chinese wolfberry anther as template, adopting RT-PCR method to separate gene fragment of Lb14-3-3 protein, and its name isLb14-3-3cThe fragment was ligated to pGEM-T Easy vector and transformed into E.coli DH 5. alpha. and the positive plasmid was sequenced, which indicated that the fragment was 777bp long (FIG. 1).

2.2 bioinformatic analysis of Lb14-3-3c protein

2.2.1 Lb14-3-3c protein physicochemical Properties and Structure prediction

As shown by analysis using the bioxm2.6 software,Lb14-3-3cthe ORF total length of the gene is 777bp, and can code 260 amino acids. The ExPASy website predicts that,Lb14-3-3cthe theoretical molecular weight of the encoded protein is 64.14 kD, the isoelectric point is 4.95, and the secondary structure of the encoded protein consists of 175 alpha-helices, 4 beta-turns and 62 random coils. Is used inThe line software SWISS-MODEL predicts the tertiary structure of Lb14-3-3c protein, obtaining its symmetrical three-dimensional structure composed mainly of alpha-helices (fig. 2).

2.3 construction of plant recombinant expression vectors

2.3.1 identification of the orientation of the ligation of an overexpression vector to an inhibition expression vectorLb14-3-3cThe recombinant plasmid is used as a template, the upstream and downstream primer sites of M13 are combined with single enzyme digestion to judge the connection direction of the recombinant monoclonal vector, and if M13-F/M13-R, M13-R/Lb14-3-3c-R and M13-R/Lb14-3-3c-R are used as primers, the PCR result is positive; M13-F/Lb14-3-3c-R is used as a primer, the PCR result is negative,Ecor Ӏ single enzyme cuts the recombinant plasmid to obtain a 500 bp specific band, and the target fragment is connected in the forward direction (figure 3). If the M13-F/M13-R, M13-R/Lb14-3-3c-R and M13-F/Lb14-3-3c-R PCRs are positive, the M13-R/Lb14-3-3c-R PCRs are negative,Ecor Ӏ single enzyme cuts the recombinant plasmid to obtain a specific band of 250 bp, and the target fragment is reversely connected (figure 4). During PCR, two non-specific electrophoretic bands, one of which may be primer dimer, may appear due to the low annealing temperature (FIG. 4B).

2.3.2 validation of plant recombinant expression vectors

After the ligation direction of Lb14-3-3c-pMD18-T recombinant plasmid was determined, the plasmid was usedBam H Ӏ andSalӀ the double restriction enzymes pCambia1305.1-35s, over-expression recombinant plasmid Lb14-3-3c-pMD18-T and suppression expression recombinant plasmid Lb14-3-3c-pMD18-T were separately digested to have the same cohesive ends. And (3) recovering the target fragment, performing overnight ligation by using T4 ligase, transforming Escherichia coli DH5 alpha, selecting a monoclonal, and performing PCR positive detection by using the monoclonal as a template to obtain a 777bp target band (FIGS. 5A and 6A). Extracting successfully constructed recombinant plasmid, transforming agrobacterium GV3101, selecting single clone, using it as template to make PCR detection, further using restriction enzymes Bam H Ӏ and Sal Ӏ to make double enzyme digestion of recombinant plasmid whose PCR result is positive to obtain a 777bp specific band (fig. 5B and fig. 6B), the size of inserted fragment is identical to that of cloned fragment, indicating that the successfully constructed recombinant plasmid is successfully constructedLb14- 3-3cPlant over-expression vector pCambia1305.1-35s-Lb14-3-3c and plant suppression expression vector of geneThe construct pCambia1305.1-35s-Lb14-3-3c, verified for the next step by transformation of model plants and Lycium barbarumLb14-3-3cThe function of the gene provides the basis for research.

2.4 Agrobacterium-mediated transformation of Potato

The potato stem segment infected by the agrobacterium tumefaciens transformation method (figure 7A) is placed on an MS culture medium containing 50 mug/mL kanamycin to induce callus, callus grows out about 15 days (figure 7B), adventitious buds are differentiated about 30 days (figure 7C), when the adventitious buds grow to about 3 ~ 4 cm, the adventitious buds are slightly cut off and inserted into a rooting culture medium containing kanamycin to carry out rooting culture, and the wild type potato is used as a control in the whole process.

2.5 phenotype observation and Positive identification of transgenic plants

After the adventitious buds are transplanted into a rooting culture medium, plants gradually take roots (figure 8A, B), when aseptic seedlings grow to a bottle cap, hardening seedlings, transplanting the bottle seedlings into soil to be cultured (figure 8C, D) after the hardening seedlings are finished, taking leaves of the plants when the stem sections of the plants are thick and the number of the leaves is large, extracting the whole genome DNA of the leaves, and carrying out PCR positive identification (figure 9), wherein the whole process takes wild potato plants as a control. As can be seen from the figure, in the bottle seedling period, the growth vigor of the transgenic potato seedlings is not greatly different from that of the wild type seedlings, and in the later growth period, the transgenic plants grow faster and the plant height is obviously higher than that of the wild type plants. After PCR positive identification, 5 positive transgenic plants and 1 negative plant are obtained, the negative plants are removed, and the positive plants and wild plants are continuously cultured.

2.6 transgenic Potato starch assay

Randomly selecting 3 transgenic positive plants, respectively measuring the starch content of the transformed plant at each period by using the starch content of the wild type potato plant at the seedling stage, the potato bearing stage and the mature stage as a reference, wherein the figure shows that (figure 10), except the seedling stage, the starch content of the leaves of the 3 transformed plants at the potato bearing stage and the mature stage is remarkably higher than that of the leaves of the wild type plants and is about 6 ~ 7, which shows thatLb14-3-3cThe gene may positively regulate starch accumulation.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> Ningxia university

<120> molecular marker Lb14-3-3c gene and application thereof

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 777

<212> DNA

<213> Lycium barbarum Lb14-3-3c Gene (Lycium barbarum L.)

<400> 1

atggcgtctc cacgcgagga aaacgtgtac atggcgaaac ttgccgagca agccgaacgt 60

tacgaagaaa tggtagattt catggaaaaa gtcgttactt tcgccgacag cgaaacctcc 120

gaactaaccg tcgaagaacg taaccttctt tccgtagcct acaaaaacgt gatcggagca 180

cgtcgtgctt catggagaat aatctcatca attgaacaaa aagaggaaag ccgtggtaat 240

gaagaacacg tggcatcaat aagggaatac agatctaaga ttgaaactga attaacatcg 300

atctgtaatg gcattcttaa gttacttgat tctaaactta ttggatcagc tgctactggt 360

gattctaaag ttttttattt gaaaatgaaa ggagattatc atcgttattt agctgagttt 420

aaaactggtg ctgagagaaa agaagctgcc gagaatactc tctctgctta caaagctgct 480

caggatattg ctaatgctga ccttgcgcct acacatccaa tccgattggg tcttgctctt 540

aatttctctg tgttttacta cgagatattg aattctcctg atcgtgcttg taatcttgcc 600

aaacaggcct ttgatgaggc aattgcggag ctggacacat tgggtgaaga atcctacaag 660

gatagcactc tgatcatgca gctttttcgc gataacctca ctttatggac ctttgatatg 720

caggatgatg gaactgatga gatcaaagaa gcagcaccca aaccagataa taatgaa 777

<210> 2

<211> 260

<212> PRT

<213> protein translated from LbL 14-3-3c gene of Lycium barbarum (Lycium barbarum L.)

<400> 2

Met Ala Ser Pro Arg Glu Glu Asn Val Tyr Met Ala Lys Leu Ala Glu

1 5 10 15

Gln Ala Glu Arg Tyr Glu Glu Met Val Asp Phe Met Glu Lys Val Val

20 25 30

Thr Phe Ala Asp Gly Ala Glu Glu Leu Glu Leu Thr Val Glu Glu Arg

35 40 45

Asn Leu Leu Ser Val Ala Tyr Lys Asn Val Ile Gly Ala Arg Arg Ala

50 55 60

Ser Trp Arg Ile Ile Ser Ser Ile Glu Gln Lys Glu Glu Ser Arg Gly

65 70 75 80

Asn Glu Glu His Val Ala Ser Ile Arg Glu Tyr Arg Ser Lys Ile Glu

85 90 95

Thr Glu Leu Thr Ser Ile Cys Asn Gly Ile Leu Lys Leu Leu Asp Ser

100 105 110

Lys Leu Ile Gly Ser Ala Ala Thr Gly Asp Ser Lys Val Phe Tyr Leu

115 120 125

Lys Met Lys Gly Asp Tyr His Arg Tyr Leu Ala Glu Phe Lys Thr Gly

130 135 140

Ala Glu Arg Lys Glu Ala Ala Glu Asn Thr Leu Ser Ala Tyr Lys Ala

145 150 155 160

Ala Gln Asp Ile Ala Asn Ala Asp Leu Ala Pro Thr His Pro Ile Arg

165 170 175

Leu Gly Leu Ala Leu Asn Phe Ser Val Phe Tyr Tyr Glu Ile Leu Asn

180 185 190

Ser Pro Asp Arg Ala Cys Asn Leu Ala Lys Gln Ala Phe Asp Glu Ala

195 200 205

Ile Ala Glu Leu Asp Thr Leu Gly Glu Glu Ser Tyr Lys Asp Ser Thr

210 215 220

Leu Ile Met Gln Leu Phe Arg Asp Asn Leu Thr Leu Trp Thr Phe Asp

225 230 235 240

Met Gln Asp Asp Gly Thr Asp Glu Ile Lys Glu Ala Ala Pro Lys Pro

245 250 255

Asp Asn Asn Glu

260

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggcgtctc cacgcgagga 20

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttcattatta tctggtttg 19

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tccgaactaa ccgtcgaaga 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgatgccacg tgttcttcat 20

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gaccttcaat gttcccgcta tg 22

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gccatcacca gagtccaaca c 21

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgtaaaacga cggccagt 18

<210> 10

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

caggaaacag ctatgacc 18

<210> 11

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gagcagcttg ccaacatg 18

Claims

1. The wolfberry Lb14-3-3c gene is characterized by having a sequence shown in SEQ ID NO. 1.

2. The protein translated by the medlar Lb14-3-3c gene is characterized by having a sequence shown in SEQ ID NO. 2.

3. Application of the wolfberry Lb14-3-3c gene in preparing products for improving potato starch content.