CN109929852B - Liriodendron hybrid somatic embryo radicle elongation key gene LhHB9 and application thereof - Google Patents

Abstract

The invention discloses a key gene LhHB9 for elongation of somatic embryo radicle of hybrid liriodendron tulipifera and application thereof. The DNA sequence of the key gene LhHB9 for elongation of somatic embryo radicle of the hybrid liriodendron tulipifera is shown in SEQ ID NO. 1. The cDNA sequence of the LhHB9 gene of the hybrid liriodendron tulipifera is cloned, an over-expression vector of the LhHB9 gene is constructed, the embryonic callus of the hybrid liriodendron tulipifera is taken as a receptor material, and genetic transformation is carried out by adopting an agrobacterium-mediated method. After the transgenic callus is obtained by G418 screening, the transgenic callus is detected, and the success of the transgene is preliminarily determined. The LhHB9 gene transgenic callus embryo induction shows that the transgenic somatic embryo radicle has obvious elongation, and the statistical data shows that 35S: the LhHB9 somatic embryo radicle is most obvious compared with a control CK, which indicates that the overexpression of the target gene can promote the elongation of the radicle and has good practicability.

Description

Liriodendron hybrid somatic embryo radicle elongation key gene LhHB9 and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a key gene LhHB9 for elongation of somatic embryo radicle of hybrid liriodendron tulipifera and application thereof.

Background

Plant somatic embryogenesis (simply "somatic embryogenesis") refers to the process by which somatic cells produce new individuals under ex vivo conditions. Steward in 1958 used the carrot suspension line for the first time to obtain somatic embryos. Thereafter, various species obtain whole plants through a somatic embryo regeneration pathway. Somatic embryogenesis is a common phenomenon in plants, and most of the somatic embryos can be induced to regenerate by utilizing different organs and tissues and proper external conditions. Since zygotic embryos are deeply buried in embryo sacs and have the characteristics of small individuals, small quantity, inconsistent development and the like, it is difficult to deeply and carefully study early zygotic embryos. The process of somatic embryogenesis is similar to that of zygotic embryogenesis, and the human operability and the environmental controllability of somatic embryogenesis enable a somatic embryogenesis system to become a good alternative system for researching early zygotic embryogenesis of plants. Many important trees have already realized the industrialization of the engineering seedling raising through the somatic embryogenesis technology, and this technology not only can realize rapid propagation, but also has gradually become an excellent system that researchers research the plant development mechanism, gene expression regulation and control, and carry out variety improvement, and has great significance in theory and application.

The hybrid liriodendron is a special material and afforestation tree species in China, and the research on somatic embryogenesis is greatly emphasized. The applicant has made significant progress in somatic embryogenesis studies in hybrid liriodendron tulipifera at the early stage. Plant somatic embryogenesis is a complex and delicate process, not only influenced by external conditions, but also regulated by various internal mechanisms, such as gene regulation, hormone regulation, signal transduction regulation, miRNA regulation, and the like.

miRNA is a non-coding RNA molecule with the size of about 21-23 nucleotides, and is universally present in plant genomes. The gene expression is regulated mainly by complementarily combining with a target gene to mediate shearing of target mRNA or inhibit translation of target molecules on the post-transcriptional level, so that the leaf morphogenesis, polarity, root development, zygotic embryo early embryo mode formation, stress response and the like are regulated. miRNAs related to somatic embryogenesis mainly comprise miR156, miR159, miR160, miR161, miR164, miR165, miR166, miR167, miR168, miR171, miR319, miR390 and miR394^[110]And the like, if miR167 is over-expressed in Arabidopsis, the somatic embryogenesis can be inhibited, which indicates that the somatic embryogenesis is negatively regulated. This effect is mainly manifested by alterations in auxin response and local auxin transport in the embryogenic healing wound.

The miRNAs are rarely regulated and researched in somatic embryogenesis of hybrid tulip trees, only the Litting is combined with high-throughput sequencing and miRNA microfluidic chip hybridization to find the miRNA species participating in the development process, and biological initial detection is carried out on the miR397 and target genes thereof.

Disclosure of Invention

The purpose of the invention is as follows: aiming at the defects in the prior art, the invention aims to provide a key gene LhHB9 for somatic embryo root elongation of a hybrid liriodendron body embryo, and meets the use requirement of somatic embryogenesis. The invention also aims to provide application of the key gene LhHB9 for somatic embryo radicle elongation of the hybrid liriodendron tulipifera.

The technical scheme is as follows: in order to achieve the purpose of the invention, the invention adopts the technical scheme that:

the DNA sequence of the key gene LhHB9 for somatic embryo root elongation of the hybrid liriodendron tulipifera is shown in SEQ ID NO. 1.

The amino acid sequence of the expression protein of the key gene LhHB9 for the somatic embryo radicle elongation of the hybrid liriodendron tulipifera is shown in SEQ ID NO. 2.

An expression vector and a host bacterium containing the key gene LhHB9 for elongation of somatic embryo radicle of the hybrid liriodendron tulipifera.

The application of the key gene LhHB9 for somatic embryo root elongation of the hybrid liriodendron in somatic embryogenesis.

The application of the key gene LhHB9 for somatic embryo radicle elongation of the hybrid liriodendron tulipifera in promoting somatic embryo radicle elongation.

Has the advantages that: compared with the prior art, the cDNA sequence of the LhHB9 gene of the hybrid liriodendron is cloned, an overexpression vector of the LhHB9 gene is constructed, the embryonic callus of the hybrid liriodendron is used as a receptor material, and genetic transformation is carried out by adopting an agrobacterium mediation method. After the transgenic callus is obtained by G418 screening, the transgenic callus is detected, and the success of the transgene is preliminarily determined. The LhHB9 gene transgenic callus embryo induction shows that the transgenic somatic embryo radicle has obvious elongation, and the statistical data shows that 35S: the LhHB9 somatic embryo radicle is most obvious compared with a control CK, which indicates that the overexpression of the target gene can promote the elongation of the radicle and has good practicability.

Drawings

FIG. 1 is a graph showing the results of selection and proliferation of resistant calli; in the figure, note: a: screening resistant calluses; b: proliferation of resistant callus;

FIG. 2 is a PCR amplification electrophoretogram of a gene of interest; in the figure, M: m15000, the bands are 15000bp, 10000bp, 7500bp, 5000bp, 2500bp, 1000bp and 250bp respectively; CK +: a positive control; CK-: negative control (WT);

FIG. 3 is a somatic embryo diagram of transgenic Liriodendron hybrids; in the figure: a: a non-transgenic somatic embryo; b: non-transgenic somatic embryos (treated with 100mg/L cephalosporin antibiotic only in induction medium I); c: 35S: LhHB 9;

FIG. 4 is a graph of transgenic versus non-transgenic somatic radicle statistics; in the figure: A. the root length statistical chart of radicle, Duncan method detects the most significant difference at the level that P is less than 0.01; b: CK; c: 35S: LhHB 9.

Detailed Description

The present invention will be further described with reference to the following specific examples.

Example 1 cloning of the LhHB9 Gene

1. Extraction of RNA from hybridized liriodendron

Taking hybrid liriodendron leaves as a material, extracting RNA, and specifically comprising the following steps: (1) fully pre-cooling the mortar by using liquid nitrogen until the liquid nitrogen is added into the mortar and does not boil any more; (2) placing plant tissue not more than 50mg into a mortar containing liquid nitrogen, and fully grinding (2-3 times); (3) when the liquid nitrogen is partially volatilized and the sample is not dissolved, adding 1mL of cracking liquid, continuously grinding until the sample and the cracking liquid are completely mixed, and naturally melting at room temperature to form homogenate; (4) transferring the homogenate to a 2mL centrifuge tube with a pipette; (5) centrifuging at 12000r/min for 2min at room temperature, sucking the upper liquid and transferring to a new tube; (6) adding the mixture in an equal volume of 24: 1, uniformly mixing the mixture in a vortex mode, centrifuging the mixture at 12000r/min for 2 minutes, sucking the uppermost layer of liquid, moving the liquid to a new tube, and recording the volume of the liquid; (7) adding 70% ethanol with the same volume, mixing (30 times), transferring the mixture into a collecting column, centrifuging at 12000r/min for 1min, removing the filtrate, and storing the rest mixture on ice until all the mixture passes through the column; (8) adding 400 mu L of Wash Solution, centrifuging for 1 minute at 12000r/min, removing the filtrate, and putting back to the collecting pipe; (9) preparing DNA digestive enzyme in advance, adding 100 mu L into a collecting column, and centrifuging for 1min at 4000 r/min; after centrifugation, transferring the filtrate obtained in the step (8) to a collecting column again, and standing for 15min at 25-30 ℃; (10) adding 400 mu of LWash Solution into a collecting column, centrifuging for 1min at 14000r/min, discarding the filtrate, and recovering the collecting column; (11) repeating the step (10); (12)14000r/min 2min, completely spin-drying the collecting column, and discarding the collecting pipe; (13) the collection column was placed in a new 1.7mL elution tube (provided by Kit); (14) add 50. mu.L of Elution Solution to the collection column; (15) centrifuging at 200-2000 rpm for 2min, and centrifuging at 14000r/min for 1 min; (16) RNA concentration was quantified using a Nanodrop 2000, and RNA integrity was checked by electrophoresis on a 1% agarose gel.

2. Reverse transcription to obtain cDNA

The extracted RNA was subjected to reverse transcription using HiScript II 1st Strand cDNA Synthesis Kit (Vazyme) to obtain cDNA, and the specific reverse transcription system (for PCR) primers were as follows:

LhHB9-F：5′-CTTCTGTTTTGGTGGTTTTCTTGGG-3′；

LhHB9-R：5′-GTCCTCTACCTACATTGGCTATCTT-3′。

the process is as follows: 1) RNA template denaturation, mixed solution: RNase free ddH₂O supplementation to 8. mu.L, 1. mu. LOlogo (d T)₂₃VN (50. mu.M), 1 pg-5. mu.g of Total RNA. Heating at 65 deg.C for 5min, rapidly cooling on ice, and standing on ice for 2 min. 2) cDNA Synthesis, reaction solution: 8. mu.L of the mixture of step 1), 10. mu.L of 2 XTRT Mix, 2. mu.L of LHiScript II Enzyme Mix: lightly blow and beat the mixture by a pipette gun and mix the mixture evenly. Reaction procedure: 5min at 25 ℃, 45min at 50 ℃ and 2min at 85 ℃.

Using this cDNA as a template, the subsequent PCR was performed.

3、PCR

The cDNA is taken as a template, and the high-fidelity KOD FX enzyme is adopted for PCR amplification, and the system is as follows: 2 XPCR buffer 10. mu.L, 2mM dNTPs 4. mu.L, LhHB9-F (10. mu.M) 0.620. mu.L, LhHB9-R (10. mu.M) 0.620. mu.L, Template DNA 120. mu.L or more, KOD FX (1.0U/. mu.L) 0.420. mu.L, Distilled water 20. mu.L.

The PCR reaction conditions were as follows: 94 ℃ for 2 min; 10s at 98 ℃, 30s at Tm-5 ℃, 30s/kbp at 68 ℃ and 35 cycles; storing at 4 ℃.

After the reaction is finished, detecting by using 1% agarose gel electrophoresis gel running, and cutting and recovering the target band.

4. Cutting and recovering the target fragment

A small amount of PCR products were detected by 2% agarose Gel electrophoresis, and if the size of the target band was predicted, the PCR products were re-sized, cut and recovered after electrophoresis, and the P CR amplification products were recovered and purified by using QIAquick Gel Extraction Kit (50) from QIAGEN. The method comprises the following specific steps: cutting the gel containing the target fragment under an ultraviolet lamp, sucking off surface liquid with a paper towel and cutting up, and calculating the weight of the gel, wherein the weight is used as the volume of the gel; adding 3 times volume of buffer QG, dissolving at 50 ℃, and performing vortex fluxing every 2-3min until the gel is completely melted; adding isopropanol with the volume of 1 time, and reversing and uniformly mixing; adding the mixed solution in the last step into spin column (placed in a 2mL centrifuge tube), performing 1min at 13000rpm, discarding the filtrate, and performing column chromatography for multiple times if the mixed solution is more than 800 mu L; adding 750 mu LBuffer PE at 13000rpm 1m in, and removing the filtrate; separating for 2min, and removing the residual wash buffer; QIAquick column was placed in a clean 1.5mL centrifuge tube, 50. mu.L of Buffer EB (10mM Tris. Cl, pH 8.5) was added to the center of the membrane, and the membrane was centrifuged for 1min to elute the DNA.

5. Carrier attachment

T-Vector pMD from Takara was used^TM19(Simple) ligation reactions were performed, 10. mu.L ligation system and procedure: 3 μ L ddH₂O，1μLT-Vector pMD^TM19(Simple), 1. mu.L of purified recovered PCR product, 5. mu.L of Sol solution I. Reaction conditions are as follows: 30min at 16 ℃.

6. Transformation of E.coli

Coli competent cells (CB101) from DH 5. alpha. of TIANGEN were used for this transformation, and the specific transformation procedure was as follows: thawing the competent cells on ice; adding 2 mu L of the ligation product into 100 mu LDH5 alpha competent cells, gently flicking and uniformly mixing, and carrying out ice bath for 30 min; standing in 42 deg.C water bath for 90sec, rapidly transferring to ice, and standing for 3m in without shaking the centrifuge tube; adding 800 μ LLB culture medium (without antibiotic), and resuscitating at 37 deg.C and 150rpm at 45 min; centrifuging at 4000rpm for 2min, sucking off 800 μ L of culture medium at the upper layer, and resuspending the rest bacteria liquid; the bacterial liquid is coated on an LB solid culture plate containing corresponding antibiotics, inverted at 37 ℃ and cultured overnight.

7. PCR detection and sequencing of bacterial liquid

6 single colonies are picked from the screening culture plate and placed in an LB liquid culture medium (containing corresponding antibiotics) at 37 ℃ and 250rpm for 12-16h, the shaken bacterial liquid is subjected to PCR detection, the PCR reaction system and the PCR reaction program of the bacterial liquid are the same as those in the above, and the reaction cycle number is 35 cycles. The bacteria liquid with positive electrophoresis detection is randomly selected from 3 bacteria liquids sent to Kingscoi Biotech limited company for sequencing.

The obtained gene sequence is shown in SEQ ID NO.1 (containing non-coding sequence), is named as LhHB9 gene, and the expressed protein is shown in SEQ ID NO. 2.

Example 2 functional verification of the LhHB9 Gene

1. LhHB9 overexpression vector construction

The basic vector used for constructing the transient expression vector of the target gene and the target gene mutant is PJIT 166. This vector construction employs a method of homologous recombination. The reagent used is Gibson of NEB

The whole assembly process of the premix is shown in the website https of NEB: // www.neb.com/applications/cloning-and-synthetic-biology/dna-assembly-and-cloning/g ibson-assembly.

(1) PCR Generation of inserts

Primers were designed using the NEBuilder online website (http:// NEBuilder. neb. com /), and the sequences of the primers were as follows:

PJIT166-LhHB9F：5′-ggagaggacagcccaagcttATGGCGCTTGCGATGCAC-3′，

PJIT166-LhHB9R：5′-gctcaccatggatcctctagaAAGAAAAGACCAGTTCATGAACAAGAA GGC-3′。

with the target Gene and T-Vector pMD^TM19(Simple) sequencing correct positive plasmid as a template, performing PCR by using Q5 enzyme of NEB, and adopting a specific reaction system: q5High-Fidelity 2 × Master Mix 25 μ L, 10 μ M Forward Primer 2.5 μ L, 10 μ M Reverse Primer 2.5 μ L, Template DNA variable, nucleic-Free Water supplemented 50 μ L.

Reaction procedure: 30s at 98 ℃; 10s at 98 ℃, 30s at 68 ℃, 20-30s/kb at 72 ℃, 2min at 72 ℃ and 32 cycles; and preserving at 4 ℃.

The reaction product was run through 1% gel electrophoresis and recovered by cutting, the procedure was as in example 1.

(2) Linearization of PJIT166 vectors

The plasmid PJIT166 is used as a template, and HindIII and XbaI are used for double enzyme digestion, and the enzyme digestion system is as follows: DNA 1. mu.g, 10 × CutSmart Buffer 5. mu.L, HindIII-HF 1. mu.L, XbaI 1. mu.L, nucleic-Free to 50. mu.L, incubated at 37 ℃ for 5-15 min. Using the ready mix 25: 24: 1 (phenol: chloroform: isoamyl alcohol) is subjected to enzyme digestion and purification; if the enzyme digestion system is less than 300 mu L, adding TE to supplement 300 mu L; mixing at equal volume of 25: 24: 1, shaking vigorously for several times, and centrifuging at 12000rpm for 2 min; taking the supernatant to another clean 1.5mL centrifuge tube, repeating the step 3, and recording the volume of the supernatant; adding an equal volume of 24: 1, oscillating vigorously, and centrifuging at 12000rpm for 2 min; taking the supernatant to another clean 1.5mL centrifuge tube, repeating the step 5, and recording the volume of the supernatant; adding 1/9 volumes of 3M NaAc, and reversing and mixing evenly; adding 2 times (supernatant and NaA c) volume of frozen absolute ethanol at-20 deg.C, and cooling at-20 deg.C for at least 30 min; 12000rpm, 0 ℃ for 30min,pouring the supernatant; cleaning with 700 μ L70% ethanol at 12000rpm for 5min at 4 deg.C, drying with 20 μ L ddH₂And dissolving the O.

(3) Ligation reaction

Gibson by NEB corporation

Assembling the premixed liquid, wherein the specific system is as follows:

Total Amount of Fragments 0.02-0.5pmols XμL，Gibson Assembly Master Mix(2X)10μL，Deionized H₂O10-X μ L, total volume 20 μ L.

Reaction conditions are as follows: 15min at 50 ℃. After the reaction is finished, the product is transformed into DH5 alpha, and a single colony liquid PCR is selected and sent for detection.

The construction method of the target gene overexpression vector is the same as the above, the used basic vector is PBI121, and the primer sequence for preparing the insert fragment by PCR is as follows:

PBI121-LhHB9-F：5′-ggagagaacacgggggactctagaggatccATGGCGCTTGCGATGCAC-3′；

PBI121-LhHB9-R：5′-ttgaacgatcggggaaattcgagctcTCAAAGAAAAGACCAGTTCATGAACAAGAAGG-3′。

2. genetic transformation

1) Establishment of transformation receptors

The receptor material is embryonic callus of 15-20 days of subculture, and the callus at the moment grows well and has good physiological state and can be directly used for transformation.

2) Recombinant plasmid transformed agrobacterium

The strain used for transforming the target gene positive recombinant plasmid is an agrobacterium tumefaciens strain EHA105, and the transformation is carried out by adopting a heat shock method, and the specific steps are as follows:

thawing agrobacterium tumefaciens competence on ice, taking 3 mu L of recombinant plasmid with correct sequencing in 200 mu L of competence, flicking and uniformly mixing, and carrying out ice bath for 30 min; quickly freezing with liquid nitrogen for 1min, thermally shocking at 37 deg.C for 3min, and rapidly placing on ice for 2 min; adding 800 μ LLB (without antibiotics) liquid culture medium, at 28 deg.C 100rpm for 2-4 h; centrifuging at 4000rpm for 2min, removing 800 μ L of supernatant, resuspending the remaining bacterial liquid, and coating on LB solid culture medium containing corresponding antibiotics; performing inverted culture at 28 ℃ for 30-48h until a single colony grows; detecting positive clone by PCR, and storing at 4 ℃ for later use.

3) Preparation of Agrobacterium liquid

1) Selecting a positive single colony detected by PCR from an activated LB culture plate, inoculating the positive single colony to 10mL of LB liquid culture medium containing corresponding antibiotics, and carrying out shaking culture at 28 ℃ and 220 r/min; 2) after about 20h, 2mL of the bacterial liquid is sucked and inoculated on 50mL of LB liquid culture medium containing corresponding antibiotics, and the liquid culture medium is subjected to shaking culture at 28 ℃ and 220r/min until OD is reached₆₀₀The value is 0.6-0.8; 3) subpackaging the bacterial liquid in a 50mL centrifuge tube, centrifuging at 5000r/min and 4 ℃ for 2min, removing supernatant, and collecting thalli; 4) suspending thallus with hybrid Liriodendron M13 liquid subculture basis to OD₆₀₀About 0.5.

4) Infection and Co-cultivation

And (3) rolling the callus by using forceps, dispersing the callus, soaking the callus in the prepared bacterial liquid for 10-15 min, filtering the bacterial liquid by using a 150-mesh sterile cell sieve, picking the callus in the cell sieve on an M13 solid culture medium added with 100 mu mol/L acetosyringone, and performing dark culture for 2-3d to obtain the co-culture.

5) Bacteria removal and resistance screening

After co-culture, the antibacterial effect is achieved mainly by washing bacteria and adding a proper amount of cefmenoxime. Selecting embryogenic callus into a 100mL triangular flask, alternately cleaning with M13 liquid culture medium added with cefuromycin and sterile water for 3-4 times, wherein the cleaning time is not more than 10min, the liquid is transparent after cleaning, finally sieving with a 150-mesh sterile cell sieve, draining the liquid as much as possible, selecting callus on the sieve to an M13 solid culture medium added with 300mg/L for culture, transferring the callus to an M13 solid subculture medium added with 200mg/L of cefuromycin and 90mg/L G418 after 20 days, and delaying the screening. When resistant calli grew out, the calli were transferred to a new M13 solid subculture medium supplemented with 100mg/L of cephamycin and 90mg/L G418, and selection culture was continued until resistance stabilized.

After co-cultivation and resistance selection, the non-transgenic calli mostly turned brown and growth was severely inhibited, while the transgenic calli grew out of the browned non-transgenic callus clusters (FIG. 1). And finally, obtaining a resistant cell line from the callus of the transgenic gene, transferring the obtained transgenic callus to a new screening culture medium added with G418 antibiotic, and performing later-stage propagation.

6) PCR detection of transgenic callus

By adopting an agrobacterium-mediated method, a target gene is successfully introduced into the embryonic callus of the hybrid liriodendron, resistant callus is obtained through resistance screening, and the resistance is still stable after multiple screening by G418. And (3) expanding and propagating the transgenic callus, taking the transgenic callus as a raw material, and extracting the genome DNA. Transgenic calli transgenic for LhHB9 were treated with 35S-F: TGAAGATAGTGGAAAAGGAAGGTG (a sequence on the 35S promoter) and gene-specific downstream primers were verified by PCR (FIG. 2). As a result, bands with the same size are amplified in the transgenic callus and the positive recombinant plasmid, while a target band cannot be amplified in the non-transgenic callus and water, and the success of the transgenosis is preliminarily verified.

As can be seen from FIG. 2, after multiple screenings with G418, the transgenic callus positive rate is very high. For LhHB 9-transfected transgenic callus, 3 were randomly selected from the above-identified positive cell lines, a suspension system was established, and somatic embryos were induced by somatic embryo differentiation medium. Extracting genome DNA of somatic embryo, and performing PCR verification with the above primer to obtain the same PCR result as that of callus. The T-DNA is not lost and is stable in plants.

7) Phenotypic observations of somatic embryos overexpressing LhHB9

Establishing a suspension cell line for the transgenic callus and the non-transgenic callus which are verified to be positive and transformed into LhHB9 at the same time, culturing the suspension cell line on an induction culture medium I (3/4MS +2, 4-D2.0 mg/L + BA 0.2mg/L + CH 0.5g/L + Vc 5mg/L + sucrose 30g/L, pH 5.7-5.8) (23 +/-2 ℃, rotation speed 95r/min) for 21D in darkness, sieving the suspension cell line by using a 400-mesh cell sieve, culturing the suspension cell line on the induction culture medium II (3/4MS + NAA 0.2mg/L + BA 0.2mg/L + KT 0.5mg/L + CH 0.5g/L + Vc 5mg/L + sucrose 50g/L, pH 5.7-5.8) in darkness (23 +/-2 ℃, rotation speed 95r/min for two days), transferring the suspension cell line to an embryo culture medium (3/4MS + ABA 2.0mg/L + Vc 0.2g/L + Vc 0.5g/L + Vc/L + LH Ac 2g/L + sucrose 40g/L + Agar 2.4g/L, pH 5.7-5.8) was subjected to somatic embryo induction (dark, 23. + -. 2 ℃, cultured for 4 weeks, transferred to 16h (light)/8 h (dark), cultured for 2 weeks, and transferred to a spinner flask).

And (3) performing phenotype observation on the transgenic somatic embryos cultured for about 45d, repeating three containers in each sample, randomly selecting 90 single embryos in each container, counting and counting, and taking an average value. And carrying out shape observation and photographing under a body type microscope.

The overexpression target gene has no influence on the growth and development of the callus and still grows vigorously. The transgenic callus and the non-transgenic callus are induced into somatic embryos simultaneously, and the morphological development conditions of the transgenic callus and the non-transgenic callus are observed. The results showed that somatic embryo induction capacity was not affected in the late stage of the transgenic calli (FIG. 3).

And observing the somatic embryos about 45d, finding that the radicle of the transgenic somatic embryo is obviously longer than that of the control, measuring the length of the radicle under a stereomicroscope, repeating the test samples in three containers, and randomly selecting 90 single embryos in each container. The results showed that transgenic embryos had longer radicle length than non-transgenic ones, and that LhHB 9-transferred embryos were 3-fold longer than the control (FIG. 4).

Sequence listing

<110> Nanjing university of forestry

<120> hybrid liriodendron somatic embryo radicle elongation key gene LhHB9 and application thereof

<130> 100

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2794

<212> DNA

<213> Liriodendron chinense × tulipifera

<400> 1

cttctgtttt ggtggttttc ttgggttttg aagtgaaatt ggaggtgggt tttgtgattt 60

ttctagaaag ctagcttgtt ttgggaattt gcttggaaca tttggagaaa tggcgcttgc 120

gatgcacaag gattcgtcgg cagcagcagc agcagcagca gcagcagcta agcagttgga 180

tgcaagcaag tatgtgaggt atacgcccga gcaggttgag gcgttggaga gggtgtatat 240

ggagtgcccg aagccgagct cgatgcgtag gcagcagctt ataagagaat gccctatact 300

gtcgaatatc gagccgaagc agatcaaggt ctggtttcag aatcgaagat gccgcgagaa 360

gcagaggaaa gaagcttcac gtctccagac agtaaacagg aagctcactg ccatgaacaa 420

gctgttgatg gaggagaacg accgcctaca gaagcaggtc tcgcagctgg tgtatgagaa 480

tggatacatg cggcagcaac tgcagaatgc atctgtggcg accacggaca caagctgcga 540

gtccgtggtc actagcggtc agcaccaaca aaacccaaca ccacagcatc cgcaaaggga 600

tgctaacaac ccagctgggc tccttgcgat tgcagaggag accctggcag agttcctctc 660

caaggctact ggaactgctg tcgactgggt ccagatgctt gggatgaagc ctggtccgga 720

ttctattgga atcgttgctg tttcccacaa ctgtagtggg gttgcagcac gagcctgcgg 780

tcttgtgagt ttagaaccca caaaggtcgc agaaatcctc aaagatcgtc catcgtggtt 840

ccgtgattgc cgttgcctcg agatagttac tgtgctccct gctgggaatg gagggactat 900

cgagcttatt tacatgcaga catatgcacc tactacattg gcatctgcac gcgacttttg 960

gacgctgaga tacaccacgg gtttagaaga tggcagtctt gtgatctgtg agaggtcact 1020

gactccatca actggtggcc cagctggccc gcctgctcca aactttgtac gagctgaaat 1080

gctccccagt ggttatctga tccgcccatg tgagggtggt ggctcgatca ttcacatcgt 1140

tgatcacgtc gatttagatg catggagtgt ccccgaggtg ctccgcccac tctatgaatc 1200

gtcgaagata ctggcacaga aaatgacaat tgcggcattg cgccacataa ggcaaattgc 1260

tcaagagacc agcggggaaa ttgtatatgg tgggggccgt cagcctgcag tgctacgaac 1320

atttagtcag agattaagca ggggtttcaa tgatgctgta aatggttttg cggatgatgg 1380

gtggtcgttg atgggcaatg atggtatgga ggatgtcact atcgccatta actccacgcc 1440

aaacaagctt tttggttctc atgttaactc aacaatgctc cctacaatgg gaggtggcgt 1500

gctatgtgca aaggcatcca tgctgctcca gaatgtgcca cctgctttgc ttgtccgctt 1560

tctgagggag caccgttctg agtggtccga ctgtggcatt gatgcttatt ctgctgcctc 1620

gctgaaggcc agtccttatg cggtccctgg tgcaagagca ggtggcttcc ccggcagtca 1680

ggtcatttta cctcttgctc ataccgttga acacgaagag atgttggagg ttatcaggct 1740

tgaaggccat gggttcgccc aagatgatgc tattttatca agagacatgt acttgttaca 1800

gctatgcagt ggaattgatg aaaatgcagc aggtgcatgt gcccagcttg tctttgcgcc 1860

gattgatgaa tacttcgccg atgattcccc actactgccg tcgggtttcc gtgtcatacc 1920

attagaccca aaaacagatg ggccggcggc gactcgaaca ctcgaccttg catctgcgct 1980

tgaaggacca ggtggggcac gcccagttgg tgaagccacg acaaacgcat ataatttaag 2040

atctgtgctg acaattgcat tccagtttac atatgagaac cacctccgtg acaatgtggc 2100

ggcgatggcc cgccagtatg ttcgaagcgt tgtggggtcg gtacagaggg tggcaatggc 2160

aatcgcacct tcacgacttg gctcacatgt ggggccaaag ccgccacctg ggacccctga 2220

ggccctcacc ctggcgcggt ggatttgccg gagctacagg ttccatactg gagtggagct 2280

cctcagggct gactctcaag aaggcgattc tgttttgaaa ctgctgtggc accattctga 2340

tgctatcatg tgctgttcat tgaaatctaa tgcatcaccg gtcttcacct ttgcgaacca 2400

agcgggcctt gacatgttgg aaaccacact cattgctcta caggatatca tgcttgacaa 2460

gattctcgat gagggcggcc ggaaggtttt gtgttcagag tttgccaaga ttatgcaaca 2520

gggttttgct tatctgccat ctggagtgtg cgtctcgagc atgggcagac cagtgtcgta 2580

tgagcaagca attgcatgga aggtcctgaa tgaagaggac tcaaatcact gcttggcctt 2640

cttgttcatg aactggtctt ttctttgaac ccatatatat tatatagatt tccctagttt 2700

ggcttgagaa aactttctta aactctcctc tgcccttctc ttattatata tataatgctt 2760

aagttatgaa agatagccaa tgtaggtaga ggac 2794

<210> 2

<211> 852

<212> PRT

<213> Liriodendron chinense × tulipifera

<400> 2

Met Ala Leu Ala Met His Lys Asp Ser Ser Ala Ala Ala Ala Ala Ala

1 5 10 15

Ala Ala Ala Ala Lys Gln Leu Asp Ala Ser Lys Tyr Val Arg Tyr Thr

20 25 30

Pro Glu Gln Val Glu Ala Leu Glu Arg Val Tyr Met Glu Cys Pro Lys

35 40 45

Pro Ser Ser Met Arg Arg Gln Gln Leu Ile Arg Glu Cys Pro Ile Leu

50 55 60

Ser Asn Ile Glu Pro Lys Gln Ile Lys Val Trp Phe Gln Asn Arg Arg

65 70 75 80

Cys Arg Glu Lys Gln Arg Lys Glu Ala Ser Arg Leu Gln Thr Val Asn

85 90 95

Arg Lys Leu Thr Ala Met Asn Lys Leu Leu Met Glu Glu Asn Asp Arg

100 105 110

Leu Gln Lys Gln Val Ser Gln Leu Val Tyr Glu Asn Gly Tyr Met Arg

115 120 125

Gln Gln Leu Gln Asn Ala Ser Val Ala Thr Thr Asp Thr Ser Cys Glu

130 135 140

Ser Val Val Thr Ser Gly Gln His Gln Gln Asn Pro Thr Pro Gln His

145 150 155 160

Pro Gln Arg Asp Ala Asn Asn Pro Ala Gly Leu Leu Ala Ile Ala Glu

165 170 175

Glu Thr Leu Ala Glu Phe Leu Ser Lys Ala Thr Gly Thr Ala Val Asp

180 185 190

Trp Val Gln Met Leu Gly Met Lys Pro Gly Pro Asp Ser Ile Gly Ile

195 200 205

Val Ala Val Ser His Asn Cys Ser Gly Val Ala Ala Arg Ala Cys Gly

210 215 220

Leu Val Ser Leu Glu Pro Thr Lys Val Ala Glu Ile Leu Lys Asp Arg

225 230 235 240

Pro Ser Trp Phe Arg Asp Cys Arg Cys Leu Glu Ile Val Thr Val Leu

245 250 255

Pro Ala Gly Asn Gly Gly Thr Ile Glu Leu Ile Tyr Met Gln Thr Tyr

260 265 270

Ala Pro Thr Thr Leu Ala Ser Ala Arg Asp Phe Trp Thr Leu Arg Tyr

275 280 285

Thr Thr Gly Leu Glu Asp Gly Ser Leu Val Ile Cys Glu Arg Ser Leu

290 295 300

Thr Pro Ser Thr Gly Gly Pro Ala Gly Pro Pro Ala Pro Asn Phe Val

305 310 315 320

Arg Ala Glu Met Leu Pro Ser Gly Tyr Leu Ile Arg Pro Cys Glu Gly

325 330 335

Gly Gly Ser Ile Ile His Ile Val Asp His Val Asp Leu Asp Ala Trp

340 345 350

Ser Val Pro Glu Val Leu Arg Pro Leu Tyr Glu Ser Ser Lys Ile Leu

355 360 365

Ala Gln Lys Met Thr Ile Ala Ala Leu Arg His Ile Arg Gln Ile Ala

370 375 380

Gln Glu Thr Ser Gly Glu Ile Val Tyr Gly Gly Gly Arg Gln Pro Ala

385 390 395 400

Val Leu Arg Thr Phe Ser Gln Arg Leu Ser Arg Gly Phe Asn Asp Ala

405 410 415

Val Asn Gly Phe Ala Asp Asp Gly Trp Ser Leu Met Gly Asn Asp Gly

420 425 430

Met Glu Asp Val Thr Ile Ala Ile Asn Ser Thr Pro Asn Lys Leu Phe

435 440 445

Gly Ser His Val Asn Ser Thr Met Leu Pro Thr Met Gly Gly Gly Val

450 455 460

Leu Cys Ala Lys Ala Ser Met Leu Leu Gln Asn Val Pro Pro Ala Leu

465 470 475 480

Leu Val Arg Phe Leu Arg Glu His Arg Ser Glu Trp Ser Asp Cys Gly

485 490 495

Ile Asp Ala Tyr Ser Ala Ala Ser Leu Lys Ala Ser Pro Tyr Ala Val

500 505 510

Pro Gly Ala Arg Ala Gly Gly Phe Pro Gly Ser Gln Val Ile Leu Pro

515 520 525

Leu Ala His Thr Val Glu His Glu Glu Met Leu Glu Val Ile Arg Leu

530 535 540

Glu Gly His Gly Phe Ala Gln Asp Asp Ala Ile Leu Ser Arg Asp Met

545 550 555 560

Tyr Leu Leu Gln Leu Cys Ser Gly Ile Asp Glu Asn Ala Ala Gly Ala

565 570 575

Cys Ala Gln Leu Val Phe Ala Pro Ile Asp Glu Tyr Phe Ala Asp Asp

580 585 590

Ser Pro Leu Leu Pro Ser Gly Phe Arg Val Ile Pro Leu Asp Pro Lys

595 600 605

Thr Asp Gly Pro Ala Ala Thr Arg Thr Leu Asp Leu Ala Ser Ala Leu

610 615 620

Glu Gly Pro Gly Gly Ala Arg Pro Val Gly Glu Ala Thr Thr Asn Ala

625 630 635 640

Tyr Asn Leu Arg Ser Val Leu Thr Ile Ala Phe Gln Phe Thr Tyr Glu

645 650 655

Asn His Leu Arg Asp Asn Val Ala Ala Met Ala Arg Gln Tyr Val Arg

660 665 670

Ser Val Val Gly Ser Val Gln Arg Val Ala Met Ala Ile Ala Pro Ser

675 680 685

Arg Leu Gly Ser His Val Gly Pro Lys Pro Pro Pro Gly Thr Pro Glu

690 695 700

Ala Leu Thr Leu Ala Arg Trp Ile Cys Arg Ser Tyr Arg Phe His Thr

705 710 715 720

Gly Val Glu Leu Leu Arg Ala Asp Ser Gln Glu Gly Asp Ser Val Leu

725 730 735

Lys Leu Leu Trp His His Ser Asp Ala Ile Met Cys Cys Ser Leu Lys

740 745 750

Ser Asn Ala Ser Pro Val Phe Thr Phe Ala Asn Gln Ala Gly Leu Asp

755 760 765

Met Leu Glu Thr Thr Leu Ile Ala Leu Gln Asp Ile Met Leu Asp Lys

770 775 780

Ile Leu Asp Glu Gly Gly Arg Lys Val Leu Cys Ser Glu Phe Ala Lys

785 790 795 800

Ile Met Gln Gln Gly Phe Ala Tyr Leu Pro Ser Gly Val Cys Val Ser

805 810 815

Ser Met Gly Arg Pro Val Ser Tyr Glu Gln Ala Ile Ala Trp Lys Val

820 825 830

Leu Asn Glu Glu Asp Ser Asn His Cys Leu Ala Phe Leu Phe Met Asn

835 840 845

Trp Ser Phe Leu

850

<210> 3

<211> 25

<212> DNA

<213> LhHB9-F primer sequence (Artificial)

<400> 3

cttctgtttt ggtggttttc ttggg 25

<210> 4

<211> 25

<212> DNA

<213> LhHB9-R primer sequence (Artificial)

<400> 4

gtcctctacc tacattggct atctt 25

<210> 5

<211> 38

<212> DNA

<213> PJIT166-LhHB 9F primer sequence (Artificial)

<400> 5

ggagaggaca gcccaagctt atggcgcttg cgatgcac 38

<210> 6

<211> 51

<212> DNA

<213> PJIT166-LhHB 9R primer sequence (Artificial)

<400> 6

gctcaccatg gatcctctag aaagaaaaga ccagttcatg aacaagaagg c 51

<210> 7

<211> 48

<212> DNA

<213> PBI121-LhHB9-F primer sequence (Artificial)

<400> 7

ggagagaaca cgggggactc tagaggatcc atggcgcttg cgatgcac 48

<210> 8

<211> 58

<212> DNA

<213> PBI121-LhHB9-R primer sequence (Artificial)

<400> 8

ttgaacgatc ggggaaattc gagctctcaa agaaaagacc agttcatgaa caagaagg 58

<210> 9

<211> 24

<212> DNA

<213> 35S-F sequence (Artificial)

<400> 9

tgaagatagt ggaaaaggaa ggtg 24

Claims (4)

1. Key gene for elongation of somatic embryo radicle of hybrid liriodendron tulipiferaLhHB9The DNA sequence is shown in the 110-position 2665 of SEQ ID NO. 1.

2. The key gene for elongation of somatic embryo radicle of liriodendron hybrids as claimed in claim 1LhHB9The amino acid sequence of the expression protein is shown as SEQ ID NO. 2.

3. Contains the key gene for elongation of somatic embryo radicle of the hybrid liriodendron tulipifera as claimed in claim 1LhHB9The expression vector or host bacterium of (1).

4. The key gene for elongation of somatic embryo radicle of liriodendron hybrids as claimed in claim 1LhHB9Application in promoting elongation of somatic embryo radicle of hybrid liriodendron.

Images