CN109810908A - A kind of Solon stripping pore bacterium novel bacterial and the cultural method based on mushroom bran matrix and application thereof - Google Patents
A kind of Solon stripping pore bacterium novel bacterial and the cultural method based on mushroom bran matrix and application thereof Download PDFInfo
- Publication number
- CN109810908A CN109810908A CN201910250401.5A CN201910250401A CN109810908A CN 109810908 A CN109810908 A CN 109810908A CN 201910250401 A CN201910250401 A CN 201910250401A CN 109810908 A CN109810908 A CN 109810908A
- Authority
- CN
- China
- Prior art keywords
- solon
- bacterium
- pore
- culture
- stripping
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of new Rare edible fungus and its cultivation technique, especially Solon to shell pore bacterium novel bacterial and the cultural method based on mushroom bran matrix and application thereof.The Solon stripping pore bacterium novel bacterial is that Solon shells pore bacterium (Piptoporus soloniensis) HMGIM-A150751, and deposit number is CCTCC NO:M 2018756.The beneficial effects of the present invention are: the present invention provides a kind of Solon stripping pore bacterium strain novel bacterial, and additionally provide corresponding artificial cultivation method.The cultural method is at low cost, high-efficient.The Solon shells the edible and medical fungi of pore bacterium novel bacterial low fat, high protein, homofolic acid, homonicotinic acid and potassium magnesium elements rich in, nutritive value is high, active constituent content is higher, and can develop for inhibiting mouse mastopathy cell to be proliferated, and has good economic benefit and social benefit.
Description
Technical field
The present invention relates to a kind of new Rare edible fungus and its cultivation technique, especially Solon stripping pore bacterium novel bacterial and base
In the cultural method and application thereof of mushroom bran matrix.
Background technique
It is expanded by industrialization and urbanization, and the shadow of the Ecological Project Constructions such as conceding the land to forestry, returning farmland to grassland, returning the grain plots to lakes
It rings, country's effectively cultivated land resource is constantly reduced, and then influences the grain security of country.And mushroom industry have " not with people
Strive grain, do not striven with grain ground, fertilizer is not striven with ground, when not striving with agriculture, does not strive resource with other industry " attribute, a grass may be implemented
Cheng Jin, it turns harm into good, turn waste into wealth, without useless production.Meanwhile edible fungus is also rich in vitamin, dietary fiber and amino acid
Equal substances will have irreplaceable role in balancing the diet structure in national diet.
Therefore, the development and utilization of edible mushroom had not only had economic value but also had had healthy value.
Currently, the relevant patent of China report Solon stripping pore bacterium only has " fermentation process of suolunbguan bacterin " and " one kind
Auxotype suolunbguan bacterin and its inoculation method ", the higher cost of inoculation method, and cultivation effect include character and yield rate
Deng all bad.
Summary of the invention
Against the above deficiency, the present invention provides a kind of Solon stripping pore bacterium novel bacterial and the cultural method based on mushroom bran matrix
And application thereof.
The present invention reaches above-mentioned purpose by following scheme:
In a first aspect, providing a kind of Solon stripping pore bacterium novel bacterial, Solon stripping pore bacterium novel bacterial of the invention is picked up from
Tianmu Mountains of Zhejiang Province national natural reserves Western Tianmu Mts are located at 1203 meters of height above sea level, 20.6 DEG C of temperature, are singly born in the dead wood of broad-leaf forest
On, it is named as Solon stripping pore bacterium (Piptoporus soloniensis) HMGIM-A150751, is protected on November 5th, 2018
It is hidden in China typical culture collection center (abbreviation CCTCC, address are as follows: Wuhan City, Hubei Province Wuchang District Bayi Road Luo Jia Shan),
Deposit number is CCTCC NO:M 2018756).
In second aspect, a kind of Solon stripping pore bacterium novel bacterial CCTCC NO:M 2018756 based on mushroom bran matrix is provided
Cultural method, comprising: production separation parent species, production production parent species, make original seed, production production kind, cultivation culture and fruiting
Management, wherein by weight percentage, the cultivation cultivate used in culture material include: 30%~55% mushroom bran, 15%~
30% cotton seed hulls, 15%~25% corncob, 12% wheat bran, 2% corn flour, 1% calcium carbonate, material-water ratio 1:1.1~1:1.3；
Or 30%~60% mushroom bran, 10%~20% weed tree sawdust, 10%~30% cotton seed hulls, 8% wheat bran, 10% corn flour, 1% sugarcane
Sugar, 1% calcium sulfate, material-water ratio 1:1.1~1:1.3.
The mushroom bran is that all kinds of edible and medical fungis are cultivated in production in artificial cultivation, half people with cellulose, hemicellulose, wood
The cultivation residue of the substances such as quality uses after crushing drying.
The material-water ratio is the ratio of basic the composition material dry weight and total water consumption of culture material in cultivation culture.Suitably
Material-water ratio ensure the microorganism in culture material wet process sterilizing in be inactivated completely while build be suitble to Solon stripping pore bacterium
The humidity of growth.Suitable humidity is 62%~65%.
Preferably, the cultivation culture includes: that production kind is seeded in culture material, 23 DEG C ± 1 DEG C, relative air humidity
The culture material of bacterium bag is covered in 60%~70% shading culture to mycelia, continues After-mature cultivation 10~15 days.
In above-mentioned cultivation culture, the about 25 days time of culture is cultivated.
In above-mentioned cultivation culture, the mark of After-mature cultivation is that bacteria stick starts to switch to band elasticity, and mycelia has the small former base of kink
Start to occur.
Preferably, the mushroom producing culture includes:
Bacteria stick is uprightly placed, bacteria stick lid is kept, marks fruiting mouth in the middle part of bacteria stick, control temperature 19~26 DEG C it
Between, relative air humidity 80%~90%, daily illumination 10 hours, intensity of illumination 300lx~500lx, and keep two in air
Concentration of carbon is aoxidized less than 2%, when mycelium is twisted together to form former base in bacteria stick lid, when long fruiting flower bud, adjusts relative air humidity
85%~95%, gas concentration lwevel holding 0.07%~0.1%, fructification continued propagation 8~12 days, when cap surface color
Light yellow, picking is turned to from crocus.
Preferably, the fruiting mouth is 1cm (centimetre) fruiting mouth.
It include two kinds of Ways of fruiting, the first Ways of fruiting is bacteria stick lid fruiting, such in above-mentioned management of producing mushroom
Ways of fruiting is that bacteria stick does not need any processing, upright to place, and can cover fruiting in bacteria stick；Second of Ways of fruiting is in bacterium
Mark fruiting mouth in the middle part of stick, fruiting mouth can fruiting, and two kinds of Ways of fruiting can carry out simultaneously.
In above-mentioned mushroom producing culture, without processing steps such as mycelium stimulations of uncapping, and only drawn in the middle part of bacteria stick in bacteria stick lid or only
Fruiting mouth can success fruiting.Two Ways of fruiting simple processing steps are suitble to the factorial production.
When preferably, using the first bacteria stick lid Ways of fruiting, when bacteria stick is uprightly placed between bacterium bag and bacterium bag there are
The gap 10cm or more, such as the gap 10cm.
When preferably, using second of fruiting mouth Ways of fruiting, there are the gaps 20cm or more between bacterium bag and bacterium bag, such as
The gap 20cm.
Preferably, the cultural method further includes follow-up management:
The bacteria stick picked continues at 23 DEG C ± 1 DEG C, relative air humidity 80%~90%, daily illumination 2 hours, illumination
Intensity 300lx~500lx twists together once again to bacteria stick lid and forms former base, when long fruiting flower bud, adjusts relative humidity 85%~95%,
Daily illumination 10 hours, intensity of illumination 300lx~500lx, and the carbon dioxide concentration in air 0.2% is kept, until adopting again
It plucks.
In above-mentioned cultural method, every batch of mushroom incubation time is about 6~8 days.
Preferably, the production separation parent species include: will the isolated strain of tissue in 25 DEG C of constant temperature dark cultures, it is long to mycelia
Full inclined-plane obtains separation parent species.
Preferably, by weight percentage, the separation mother culture media includes sawdust wheat bran juice 20%, comprehensive PD
80%, furthermore add agar 2%.
It is further preferred that by weight percentage, the comprehensive PD culture medium includes: potato 20%, glucose
2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin B1Micro, remaining is water.
It is further preferred that the sawdust wheat bran juice is made as sawdust by volume: wheat bran: water is the ratio of 2:1:10
Example, by broad-leaved wood chip with wheat bran is to boil water open 20min to water after, filtrate is obtained by filtration, obtains sawdust wheat bran juice.
Preferably, the production production parent species include: to cover with parent species constant temperature dark culture in 25 DEG C is separated tiltedly to mycelia
Production parent species are obtained behind face.
In above-mentioned production parent species, the time that production parent species cover with is between 7~15 days.
Preferably, by weight percentage, the production mother culture media includes: potato 20%, glucose 2%, egg
White peptone 1%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin B1 are micro, remaining is water.
Preferably, the production original seed includes: that production parent species are inoculated with into original seed material kind, it is ensured that production parent species material block embedment
In original seed material, 25 DEG C of constant temperature dark cultures obtain original seed after mycelia eats full material.
Preferably, by weight percentage, the original seed material includes: 93%~94% (sorghum, wheat, highland barley or mixed
Close object), 5% sawdust, 1~2% calcium carbonate.
Preferably, the production production kind includes: that original seed is inoculated in production kind material, 25 DEG C of constant temperature dark cultures, to bacterium
Silk obtains production kind after eating full material.
Preferably, by weight percentage, the production kind material includes: 38%~42% cotton seed hulls, 36%~40% wood
Bits, 18%~20% wheat bran, 1%~2% calcium carbonate.
, can be with fruiting to 8~12 tides in above-mentioned cultural method, every batch of fruiting of each bacteria stick is at 30~50 grams or so.
Mushroom bran is that Edible Fungi producer generates during culturing edible fungus, and China produces mushroom bran weight about every year
9000000, main matrix is the agricultural stalks such as sawdust, corncob, bagasse, straw, cotton seed hulls, including not yet completely
The substances such as the cellulose, hemicellulose, the lignin that are utilized.
Inventors have found that shelling pore bacterium in production in Solon, mushroom bran can replace the cultivation such as sawdust, corncob, cotton seed hulls
Raw material is decomposed by Solon stripping pore mycelium absorb well, is the ideal matrix of low cost cultivation Solon stripping pore bacterium.
Above-mentioned cultural method can use mushroom bran matrix, realize waste utilization, economic and environment-friendly at low cost, and high yield, have
Practicability.
In the third aspect, a kind of kind Solon that above-mentioned cultivation method obtains stripping pore bacterium is provided.
In fourth aspect, a kind of Solon stripping pore bacterium CCTCC NO:M 2018756 or its extract are provided in treatment mammary gland
The purposes of disease in terms of tumour.
Preferably, the extract is that the ethyl acetate for the fructification that Solon shells pore bacterium CCTCC NO:M 2018756 mentions
Take object.
It is further preferred that the fructification of the Solon stripping pore bacterium CCTCC NO:M 2018756 is the sub real of maturity period
Body.
It can be by observing fruit-body color, it is just in sporogenic maturity period that milky Solon, which shells pore mushroom entity,
Entity.
It is further preferred that the ethyl acetate extraction of the fructification of the Solon stripping pore bacterium CCTCC NO:M 2018756
Object is extract of the concentration more than 500 μ g/mL, such as 1000 μ g/mL.
In a preferred embodiment, the maturity period fructification of Solon stripping pore bacterium CCTCC NO:M 2018756 is dense
Degree is the purposes of ethyl acetate extract disease in terms for the treatment of tumor of breast of 1000 μ g/mL.
At the 5th aspect, a kind of Solon stripping pore bacterium CCTCC NO:M 2018756 or its extract are provided and treated in preparation
Purposes in terms of tumor of breast in the drug of disease.
Preferably, the extract is that the ethyl acetate for the fructification that Solon shells pore bacterium CCTCC NO:M 2018756 mentions
Take object.
It is further preferred that the fructification of the Solon stripping pore bacterium CCTCC NO:M 2018756 is the sub real of maturity period
Body.
It can be by observing fruit-body color, it is just in sporogenic maturity period that milky Solon, which shells pore mushroom entity,
Entity.
It is further preferred that the ethyl acetate extraction of the fructification of the Solon stripping pore bacterium CCTCC NO:M 2018756
Object is extract of the concentration more than 500 μ g/mL, such as 1000 μ g/mL.
In a preferred embodiment, the maturity period fructification of Solon stripping pore bacterium CCTCC NO:M 2018756 is dense
Degree be 1000 μ g/mL ethyl acetate extract preparation treat tumor of breast in terms of disease drug in purposes.
Solon shell pore bacterium Piptoporus soloniensis (Dubois) Pilat, belong to mycota, Basidiomycota,
Hymenomycetes, Aphyllophorales, Polyporaceae, stripping pore Pseudomonas.
The character of Solon stripping pore bacterium strain are as follows:
Fructification is annual, and the raw short handle in tool side or stockless, imbricate is storied, soft leather matter when fresh, soft suberin after doing.Bacterium
Lid is semicircle or round, and diameter reaches 30mm up to 28cm, middle part thickness；Milky when surface is fresh, chocolate after doing；Edge is sharp,
It is wavy when fresh, it is involute after doing.Milky when vent surface is fresh, chocolate after doing, no refractive power reaction；Subcircular, every millimeter 4
~5；Thin edge is thicker, full edge.It is cream-colored when bacterial context is fresh, meat, light yellow or light pink yellow, spongioplasm or soft after doing
Suberin is thick up to 20mm.Tube is homochromy with vent surface, long up to 10mm.It is cream-colored when stem is fresh, shallow ochre after doing
Color, by fine hair or smooth, long up to 2cm, diameter is up to 2cm.4.8~6 × 2.8~3.8 μm of basidiospore, ellipse is colourless,
Thin-walled, smooth, non-starchy, not thermophilic indigo plant.Summer is born on broad leaf tree, and timber brown rot is caused.
Referring to " nutritional ingredient of annex edible and medical fungi " of a piece under " China's food medicine mycology ", comparison Solon stripping pore mushroom is real
For the testing result of body it is found that the fat content of Solon stripping pore bacterium is lower than cepe and mushroom, protein content is higher than beauty
Taste bolete and mushroom.Potassium, content of magnesium are abundant, match in excellence or beauty and not yet realize the wild cepe of artificial cultivation.Compare other foods
Medicinal fungus, Thick many candies, Quantitative Determination of Ergosterol are higher, and folate content highest, Nicotinic Acid Content is only second to true pleurotus cornucopiae.
Through molecular biology identification, ITS molecular sequences measure and analyze result and shell pore bacterium strain close to Solon, in conjunction with
Morphological feature and microscopic feature and Molecular Identification are as a result, show that it shells pore bacterium novel bacterial for Solon.
The beneficial effects of the present invention are: the present invention provides a kind of Solon stripping pore bacterium strain novel bacterial, and additionally provide
Corresponding artificial cultivation method.The cultural method is at low cost, high-efficient.The Solon shell pore bacterium novel bacterial low fat, high protein,
The edible and medical fungi of homofolic acid, homonicotinic acid and potassium magnesium elements rich in, nutritive value is high, and active constituent content is higher, and energy
Exploitation has good economic benefit and social benefit for inhibiting mouse mastopathy cell to be proliferated.
Detailed description of the invention
Fig. 1 is wild fructification picture.
Fig. 2 is the fructification picture of artificial cultivation.
Fig. 3 is the fructification picture of the artificial cultivation of batch.
Specific embodiment
Below in conjunction with specific embodiment, invention is further explained.
Embodiment 1
On July 18th, 2015, Mo Weipeng, Feng Jiaqi were wild big in the progress of Tianmu Mountains of Zhejiang Province national natural reserves Western Tianmu Mts
In the investigation of type fungus resource, a stripping pore Pseudomonas (Piptoporus) fungus sporophore sample (HMGIM-A150751) is obtained,
On November 20th, 2018, its pure culture was preserved in China typical culture collection center (abbreviation CCTCC, address are as follows: Hubei Province
Wuchang, wuhan area Bayi Road Luo Jia Shan, deposit number are CCTCC NO:M 2018756.
Wild subobject graph is as shown in Figure 1.
Embodiment 2
Sample and pure culture to embodiment 1 carry out Molecular Identification identification, and program is as follows:
Fructification sampling to wild acquisition, obtains its meat bacteria organization, to pure culture plug Luo phenol film-PDA culture medium
Culture obtains fresh mycelia, and (40 DEG C) of low temperature drying, using liquid nitrogen grinding, utilize Ezup pillar fungal genomic DNA respectively
Extraction agent box (Sangon Biotech (Shanghai) Co., Ltd.) carries out the extraction of DNA genome, obtained DNA solution
(DNA profiling) -20 DEG C of refrigerations are spare.
By fungi ribosomes intergenic region universal primer ITS1/ITS4 (ITS1:TCCGTAGGTGAACCTGCGG,
ITS4:TCCTCCGCTTATTGATATGC is synthesized by Sangon Biotech (Shanghai) Co., Ltd.) carry out ITS~PCR reality
It tests, ITS1 is primer 1, and ITS4 is primer 2, and amplification carries out in Biometra PCR instrument, and PCR reaction solution forms (totally 50 μ l) such as
Under:
Reaction condition are as follows: 94 DEG C of reaction 5min；94 DEG C of reaction 1min, 55 DEG C of reaction 1min, 72 DEG C of reaction 1min, 30 are followed
Ring；72 DEG C of reaction 10min.
The direct inspection of PCR product carries out bidirectional sequencing, is completed by Hua Da gene.Sequencing result is subjected to sequence in GenBank
Blast is arranged, it is found that fructification and mycelial ITS-DNA segment and Solon shell pore bacterium Piptoporus soloniensis
(Dubois) Pilat similitude is up to nearly 100%, by Morphological Identification, the fungus specimen gross feature and microscopic features with
Solon shells pore bacterium Piptoporus soloniensis (Dubois) Pilat description unanimously, fructification and mycelium identification knot
Fruit is Solon stripping pore bacterium Piptoporus soloniensis.
Embodiment 3
One, culture medium for cultivating is following (unless otherwise instructed, by weight percentage):
1, separate mother culture media: furthermore sawdust wheat bran juice 20%, comprehensive PD 80% add agar 2%.
Comprehensive PD culture medium: potato 20%, glucose 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin
B1 is micro, remaining is water.
2, mother culture media: potato 20%, glucose 2%, peptone 1%, agar 2%, potassium dihydrogen phosphate is produced
0.3%, magnesium sulfate 0.15%, vitamin B1 are micro, remaining is water.
3, original seed material: 93%~94% (sorghum, wheat, highland barley or mixture), 5% sawdust, 1~2% calcium carbonate.
4, production kind material include: 38%~42% cotton seed hulls, 36%~40% sawdust, 18%~20% wheat bran, 1%~
2% calcium carbonate.
5, culture material include: 30~55% mushroom brans, 15%~30% cotton seed hulls, 15%~25% corncob, 12% wheat bran,
2% corn flour, 1% calcium carbonate；Material-water ratio 1:1.1~1:1.3 of culture material or,
Culture material includes: 30~60% mushroom brans, 10~20% weed tree sawdusts, 10~30% cotton seed hulls, 8% wheat bran, 10% jade
Rice flour, 1% sucrose, 1% calcium sulfate；Material-water ratio 1:1.1~1:1.3 of culture material.
Two, cultural method is as follows:
1, production separation parent species
The broad-leaved wood chips such as Qinggang and wheat bran (by volume sawdust: wheat bran: water=2:1:10) to boil water to water are opened into 20min
Afterwards, filtrate is obtained by filtration, takes 20% filtrate that 80% comprehensive PD is added and sawdust-PD culture medium is prepared, dispensed after dissolving agar
Test tube takes out cooling sterile working and obtains separation parent species in 0.11MPa atmospheric pressure, 121 DEG C of high temperature and pressure moist heat sterilization 30min
Culture medium, the strain (embodiment 1) of access tissue separation, is placed in constant temperature dark culture in 25 DEG C of incubators, covers with inclined-plane to mycelia
It can then transfer afterwards.
2, production production parent species
Production production mother culture media, dispenses test tube, in 0.11MPa atmospheric pressure, 121 DEG C of high temperature and pressure moist heat sterilizations
30min takes out cooling sterile working access and separates successful strain.It is placed in constant temperature dark culture in 25 DEG C of incubators, it is long to mycelia
Production parent species are obtained behind full inclined-plane can then transfer.The time that general parent species cover with is between 7~15 days.
3, original seed is made
Sorghum, wheat, highland barley or the mixture of required ratio are weighed, it is wet overnight through bubble, it is mixed into sawdust, carbonic acid in proportion
Calcium obtains original seed material, is fitted into 13cm × 25cm transparent polypropylene strain bag resistant to high temperature, and equivalent every packed siccative 250g~
300g.It is burrowed in Bag Material after installing material with small wood, hole is deep to a bag bottom, then covers upper plastic hoop in sack, buckles matched
The original seed Bag Material that lid makes to get one.In 0.147MPa atmospheric pressure, 128 DEG C of high temperature and pressure moist heat sterilization 90min, take out
Sterile working access production parent species after cooling.Ensure in parent species material block embedment original seed material when inoculation.Vaccinated original seed is placed in
Constant temperature dark culture in 25 DEG C of incubators, mycelia, which eats full material then, after 15~20 days can be used as in original seed use access cultivating bag.
4, production production kind
The same original seed of manufacturing process, but formula used is different, and sack used is 15cm × 30cm resistant to high temperature transparent poly-
Propylene strain bag.Equivalent per packed siccative 350g~400g (production kind material).It is about 25 days that the time kind is covered in production.It is given birth to
Produce kind.
5, cultivation management and management of producing mushroom
Using culture material, sack used is 17cm × 35cm transparent polypropylene strain bag resistant to high temperature.It is equivalent to be done per packed
Expect 420g~500g.
Production kind is seeded in culture material, in 23 DEG C ± 1 DEG C, relative air humidity 60%~70% after bacteria stick inoculation
Culture is protected from light in culturing room.After culture material in the long purseful of the mycelia in bacteria stick, continue shading After-mature cultivation 10~15 days.Bacterium
Stick vertical setting of types places (between bag and bag should there are the gaps 10cm), retains cultivating bag fruiting lid, 19 DEG C~26 DEG C, relative humidity
In 80%~90% environment, daily diffused light is shone 10 hours, intensity of illumination 300lx~500lx, and keeps titanium dioxide in air
Concentration of carbon is less than 2%.It twists together to form former base when bacteria stick lid, when long fruiting flower bud, daily to spraying water mist 1~2 time above mushroom flower bud, adjust
Section relative air humidity 85%~95%, gas concentration lwevel holding 0.07%~0.1%, fructification continued propagation 8~12 days,
Cap surface color turns to light yellow from crocus, indicates fructification most suitable edible period, can pick, and color turns to milky white
Color indicates that fructification maturation starts to discharge spore.
6, follow-up management
The bacteria stick picked is placed in 23 DEG C ± 1 DEG C, is diffused in the culturing room of relative air humidity 80%~90% daily
It cultivates within light 2 hours, intensity of illumination 300lx~500lx.After culture 8 days, bacteria stick lid is twisted together form former base once again, when long fruiting flower bud,
The environment of relative humidity 85~95% is adjusted, daily diffused light is shone 10 hours, intensity of illumination 300lx~500lx, and keeps air
Middle gas concentration lwevel 0.2%, until picking again.
About fruiting 1, each batch of mushroom, every nearly weighs 30g~50g.Every batch of mushroom incubation time is about at 6~8 days.
As a result as shown in Figures 2 and 3.
7, fruiting situation
(1) fruiting phase: the kind physiological maturity is 40 days, and first batch of fruiting phase is 52 days, and every batch is spaced 6~8 days, can
8~12 tide of fruiting.
(2) yield: every batch of fruiting 30g~50g of each bacteria stick or so.
(3) fructification character: fructification cap is rounded or oval, early period crocus, later period color has pale yellow discoloration
Milky, stockless, meat is thick, and quality is soft.Storage life 2 years or long-term (kept dry) after 60 DEG C of drying.
The measurement of 4 nutritional ingredient of embodiment
The measurement of nutritional ingredient, including hydrolysis amino have been carried out for the Solon stripping pore bacterium of the artificial cultivation of embodiment 3
Acid, polysaccharide, protein and important microelement etc..Using cepe, mushroom as control, measurement result is as shown in table 1.
Table 1: composition measurement table
Note: "-" indicates undetermined.
Such as table 1 as can be seen that the fat content of Solon stripping pore bacterium is lower than cepe and mushroom, protein content is high
In cepe and mushroom.Potassium, content of magnesium are abundant, match in excellence or beauty and not yet realize the wild cepe of artificial cultivation.Compare it
His edible and medical fungi, Thick many candies, Quantitative Determination of Ergosterol are higher, and folate content highest, Nicotinic Acid Content is only second to true pleurotus cornucopiae.
Therefore, Solon stripping pore bacterium is a kind of low fat, high protein, homofolic acid, homonicotinic acid and potassium magnesium rich in member
Element edible and medical fungi, it would be highly desirable to human research and exploitation, artificial domesticating cultivation and research for edible mushroom development and using have
There is positive meaning.
Proliferation of the Solon stripping pore mushroom entity in 5 two growth periods of embodiment to 4T1 cell (mouse mastopathy cell)
It influences
1, Solon shells pore mushroom entity extract
It takes cap color to be in two different growing stages Solon stripping pore mushroom entities of crocus and milky respectively (to implement
Example 3 provides), wherein crocus Solon stripping pore bacterium does not produce spore and belongs to the immature phase, and milky Solon stripping pore bacterium is producing
Spore belongs to the maturity period.60 DEG C of fructification drying, crushed 60 mesh sieve, and 100g is taken to be impregnated 12 hours with ethyl acetate, ultrasound
Extraction 3 times, 2 hours every time, material ratio 1:3, extracting solution reduced pressure was evaporated to obtain ethyl acetate extract.It places standby at 4 DEG C
With.
2,4T1 cell culture
4T1 cell inoculation is placed in DMEM culture solution (containing 10% fetal calf serum and each 100U/mL of penicillin, streptomysin)
37 DEG C, 5%CO2It is incubated for 2 days in the incubator of saturated humidity.It is observed under inverted microscope, 4T1 cell adherent growth.It takes pair
The cell in number growth period is for testing.
3, cell count
Cell 2 times in logarithmic growth are cleaned with sterile PBS, with 0.25% trypsin digestion, addition contains in right amount
In the DMEM culture solution of 10%FBS and single cell suspension is made in tryptic activity, soft piping and druming.With the PBS of 0.4% trypan blue
Dye liquor 1:1 mixing carries out refusing the dyeing of dye method.Dead cell is dyed to blue, and living cells is uncolored because of complete cell membrane.With thin
Born of the same parents' counter measures viable count.Each experiment is repeated 3 times.
4, mtt assay detects inhibitory effect
Logarithmic phase cell is collected, adjusts concentration of cell suspension to 1 × 10 with the DMEM culture solution containing 10%FBS5A/mL.
On 96 orifice plates, if one group of zeroing hole CK group.DMEM culture solution of the 100 μ L containing 10%FBS, the every hole of experimental group is added in the every hole of CK group
100 μ L cell suspensions are added, bed board makes every hole, and there are 104A cell to be measured.Edge hole is filled with sterile PBS.
Accurately weighing extract 10mg is placed in 1.5mL centrifuge tube, and 100 μ L DMSO dissolve to obtain 105μ g/mL fermentation slightly mentions
Object original solution.It is 100 μ g/mL, 1000 μ g/mL with the DMEM culture solution difference compound concentration containing 10%FBS.
Plus incubator, 5%CO are set in the translation of 96 orifice plates of cell suspension2, 37 DEG C are incubated for and keep cell sufficiently adherent in 12 hours.
The 100 μ L of DMEM culture solution containing 0.64%DMSO is added in the every hole of CK group, and the fermentation that corresponding concentration is added in the every hole of remaining experimental group is thick
100 μ L of extract solution.Above-mentioned every group sets 6 multiple holes.5%CO2, 37 DEG C are incubated for 48 hours, observe under inverted microscope.
20 μ L MTT (5mg/mL) are added in every hole, continue to be incubated for 4 hours.It terminates and carefully sucks culture solution in hole after being incubated for,
150 μ L DMSO are added in every hole, set low speed on shaking table and shake 10min, dissolve crystal sufficiently.In enzyme-linked immunosorbent assay instrument
The light absorption value in each hole is measured at OD490nm.Calculate the inhibiting rate that extract grows 4T1 cell.The results are shown in Table 2.
Table 2: inhibiting rate result
| Extract concentrations | Immature phase inhibiting rate % | Maturity period inhibiting rate % |
| 100μg/mL | -21.52 | -8.23 |
| 1000μg/mL | 18.59 | 97.15 |
From table 2 it can be seen that the ethyl acetate extract of Solon stripping pore mushroom entity influences in examination 4T1 cell Proliferation
Agent dependence inhibits, and the Solon stripping pore mushroom entity in maturity period is more advantageous to the external inhibition using 4T1 cell.In concentration
Under the low dosage of 100 μ g/mL, the ethyl acetate extract of two groups of Solon stripping pore mushroom entities is equal to 4T1 cell
There is the promotion proliferation function of small degree instead in unrestraint proliferation function, to 4T1 cells with nutrient ingredient and promote proliferation because
Son.Under 1000 μ g/mL high dose of concentration, two groups of extracts have inhibiting effect to 4T1 cell Proliferation, and maturity period group is in significant
Property inhibiting effect, rate inhibit up to 97.15%.
It can be seen from the results above that Solon stripping pore bacterium of the invention has external Inhibit proliferaton to act in 4T1 cell, it can
It is further applied in Mice Body and inhibits 4T1 cell Proliferation, the screening of antibumor molecules monomer, clinical treatment and prevention human milk gland
Cancer related disease etc..
The above, preferable specific embodiment only of the invention, but scope of protection of the present invention is not limited thereto,
Anyone skilled in the art in the technical scope disclosed by the present invention, according to the technique and scheme of the present invention and its
Design is subject to equivalent substitution or change, should be covered by the scope of protection of the present invention.
Claims (10)
1. a kind of Solon shells pore bacterium novel bacterial, which is characterized in that the Solon stripping pore bacterium novel bacterial is that Solon shells pore bacterium
(Piptoporus soloniensis) HMGIM-A150751, deposit number are CCTCC NO:M 2018756.
2. a kind of cultural method of the Solon stripping pore bacterium novel bacterial CCTCC NO:M 2018756 based on mushroom bran matrix, comprising:
Production separation parent species, production production parent species make original seed, production production kind, cultivation culture and management of producing mushroom, wherein with weight
Percentages, culture material used in cultivation culture includes: 30%~55% mushroom bran, 15%~30% cotton seed hulls, 15%
~25% corncob, 12% wheat bran, 2% corn flour, 1% calcium carbonate, material-water ratio 1:1.1~1:1.3；Or 30%~60% bacterium
Chaff, 10%~20% weed tree sawdust, 10%~30% cotton seed hulls, 8% wheat bran, 10% corn flour, 1% sucrose, 1% calcium sulfate, material
Water ratio 1:1.1~1:1.3.
3. cultural method according to claim 2, which is characterized in that the cultivation culture includes: to be seeded to production kind
In culture material, the culture material of bacterium bag is covered in 23 DEG C ± 1 DEG C, 60%~70% shading culture of relative air humidity to mycelia, continues
After-mature cultivation 10~15 days.
4. cultural method according to claim 2, which is characterized in that the mushroom producing culture includes:
Bacteria stick is uprightly placed, bacteria stick lid is kept, fruiting mouth is marked in the middle part of bacteria stick, controls temperature between 19 DEG C~26 DEG C,
Relative air humidity 80%~90%, daily illumination 10 hours, intensity of illumination 300lx~500lx, and keep titanium dioxide in air
Concentration of carbon is less than 2%, when mycelium is twisted together to form former base in bacteria stick lid, when long fruiting flower bud, adjust relative air humidity 85%~
95%, gas concentration lwevel keeps 0.07%~0.1%, and fructification continued propagation 8~12 days, when cap surface color is from orange
Color turns to light yellow, picking.
5. cultural method according to claim 2, which is characterized in that the cultural method further includes follow-up management:
The bacteria stick picked continues at 23 DEG C ± 1 DEG C, relative air humidity 80%~90%, daily illumination 2 hours, intensity of illumination
300lx~500lx twists together once again to bacteria stick lid and forms former base, when long fruiting flower bud, adjusts relative humidity 85%~95%, daily
Illumination 10 hours, intensity of illumination 300lx~500lx, and the carbon dioxide concentration in air 0.2% is kept, until picking again.
6. the kind Solon stripping pore bacterium that any cultivation method obtains in a kind of claim 2 to 5.
7. a kind of Solon stripping pore bacterium CCTCC NO:M 2018756 or its extract disease in terms of tumor of breast is treated in preparation
Drug in purposes.
8. purposes according to claim 7, which is characterized in that the extract is that Solon shells pore bacterium CCTCC NO:M
The ethyl acetate extract of 2018756 fructification.
9. purposes according to claim 7 or 8, which is characterized in that the Solon shells pore bacterium CCTCC NO:M
2018756 fructification is the fructification in maturity period.
10. purposes according to claim 9, which is characterized in that Solon shell pore bacterium CCTCC NO:M 2018756 at
The ethyl acetate extract of 1000 μ g/mL concentration of ripe phase fructification preparation treat tumor of breast in terms of disease drug in
Purposes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910250401.5A CN109810908B (en) | 2019-03-29 | 2019-03-29 | New strain of Clostridia ramalina, cultivation method based on mushroom bran matrix and application of new strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910250401.5A CN109810908B (en) | 2019-03-29 | 2019-03-29 | New strain of Clostridia ramalina, cultivation method based on mushroom bran matrix and application of new strain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109810908A true CN109810908A (en) | 2019-05-28 |
| CN109810908B CN109810908B (en) | 2022-04-15 |
Family
ID=66611026
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910250401.5A Active CN109810908B (en) | 2019-03-29 | 2019-03-29 | New strain of Clostridia ramalina, cultivation method based on mushroom bran matrix and application of new strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109810908B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114342741A (en) * | 2022-01-21 | 2022-04-15 | 河北科技师范学院 | Novel strain of Clostridia tubificans and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1656872A (en) * | 2004-03-24 | 2005-08-24 | 唐延军 | Nutrition type suolunbguan bacterin and its cultivating method |
| JP2011167073A (en) * | 2010-02-16 | 2011-09-01 | Tottori Univ | Sterilizing and antimicrobe technique using volatile antimicrobial substance of mushroom |
| CN102405764A (en) * | 2011-04-19 | 2012-04-11 | 唐延军 | Method for fermenting piptoporus soloniensis |
| CN106396807A (en) * | 2016-08-31 | 2017-02-15 | 天津市宝坤农业科技有限公司 | Culture medium for improving bioconversion rate of edible fungi, preparation method of culture medium and cultivation method of edible fungi |
-
2019
- 2019-03-29 CN CN201910250401.5A patent/CN109810908B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1656872A (en) * | 2004-03-24 | 2005-08-24 | 唐延军 | Nutrition type suolunbguan bacterin and its cultivating method |
| JP2011167073A (en) * | 2010-02-16 | 2011-09-01 | Tottori Univ | Sterilizing and antimicrobe technique using volatile antimicrobial substance of mushroom |
| CN102405764A (en) * | 2011-04-19 | 2012-04-11 | 唐延军 | Method for fermenting piptoporus soloniensis |
| CN106396807A (en) * | 2016-08-31 | 2017-02-15 | 天津市宝坤农业科技有限公司 | Culture medium for improving bioconversion rate of edible fungi, preparation method of culture medium and cultivation method of edible fungi |
Non-Patent Citations (4)
| Title |
|---|
| HASSAN ABD EL-BAKY ET AL.: "PsoP1, a Milk-Clotting Aspartic Peptidase from the Basidiomycete Fungus Piptoporus soloniensis", 《JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY》 * |
| 侯立娟等: "食用菌菌糠再利用研究概述", 《中国食用菌》 * |
| 覃宝山等: "新型培养料栽培食用菌研究的现状及展望", 《中国农学通报》 * |
| 贾静等: "菌糠袋栽元蘑技术初步研究", 《山西农业大学学报(自然科学版)》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114342741A (en) * | 2022-01-21 | 2022-04-15 | 河北科技师范学院 | Novel strain of Clostridia tubificans and application thereof |
| CN114342741B (en) * | 2022-01-21 | 2022-11-25 | 河北科技师范学院 | Novel strain of Clostridia tubificans and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109810908B (en) | 2022-04-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104770222A (en) | Method for inoculating stock spawn of edible fungi | |
| CN106978353B (en) | Te Shi Xylaria sp. fungus and its cultural method | |
| CN104798601A (en) | Cultivation method for lentinula edodes | |
| CN101735952B (en) | Novel strain of pholiota adiosapose | |
| CN107475130B (en) | Thin handle Isaria novel bacterial and its cultural method and purposes | |
| CN104686194B (en) | A kind of artificial cultivation method of wild leather ear | |
| KR20200076934A (en) | Method for obtaining mass proliferation of Cordyceps sinensis and mass culture method using it | |
| TW201221065A (en) | Method for producing Antrodia cinnamomea tea leaves | |
| CN104082033B (en) | Ganoderma lucidum planting method | |
| CN107455142A (en) | A kind of implantation methods for improving ganoderma lucidum quality | |
| CN108260475A (en) | A kind of liquid spawn and its fermentation process | |
| CN103875453A (en) | Tibet hazel agaricus bisporus strains and cultivation method of fruit bodies of Tibet hazel agaricus bisporus strains | |
| CN103299822A (en) | Schizophyllum commune Fr high-yield fruiting body strain and three-dimensional ecology-returning cultivation method | |
| CN109810908A (en) | A kind of Solon stripping pore bacterium novel bacterial and the cultural method based on mushroom bran matrix and application thereof | |
| CN101735329B (en) | Pholiota adiosapose polysaccharide and preparation method thereof | |
| CN110447457A (en) | A kind of pycnoporus samguineus new strains and its artificial cultivation method and purposes | |
| CN109504613A (en) | A kind of cultural method and its culture medium of Morchella esculenta (L.) Pers mycelium | |
| CN106258999B (en) | A kind of thickness pleat Aode mushroom strain, cultural method and application thereof | |
| CN104982219B (en) | The pleurotus eryngii liquid strain and its fermentation process that a kind of mycelium pellet is evenly distributed | |
| CN108611279B (en) | Domestication method of sorangium cellulosum, domesticated sorangium cellulosum and application | |
| KR100204984B1 (en) | The method of culturing phellinus linteus | |
| KR100759021B1 (en) | Method growing edible mushroom | |
| CN110117548B (en) | New strain of phellinus linteus as well as artificial cultivation method and application thereof | |
| CN105543111B (en) | Aweto mycelium plate method and solid medium used based on food materials | |
| CN104611234A (en) | Separation method of epixylous medicinal fungus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |