CN109609396B

CN109609396B - Genetically engineered bacterium and construction method and application thereof

Info

Publication number: CN109609396B
Application number: CN201811640121.7A
Authority: CN
Inventors: 黄双成; 何汉平
Original assignee: Boton Shanghai Biotechnology Co ltd
Current assignee: Boton Shanghai Biotechnology Co ltd
Priority date: 2018-12-29
Filing date: 2018-12-29
Publication date: 2020-11-13
Anticipated expiration: 2038-12-29
Also published as: CN109609396A

Abstract

The invention belongs to the field of genetic engineering, and discloses a genetic engineering bacterium for high yield of 2-phenethyl alcohol, and a construction method and application thereof. According to the gene engineering bacterium, a key gene in a 2-phenethyl alcohol anabolism pathway is integrated on a strain genome. The gene engineering bacteria can be used for converting L-phenylalanine to generate 2-phenethyl alcohol, and the 2-phenethyl alcohol has high yield and extremely high commercial value. Experiments show that the 2-phenethyl alcohol produced by the genetically engineered bacterium CFFSH006 under the in-situ separation fermentation process can reach more than 18g/L, higher production strength can be kept under the condition of greatly reducing the using amount of polypropylene glycol, 2-phenethyl alcohol is effectively accumulated, the yield of the 2-phenethyl alcohol is improved, the method has a very good industrial application prospect, and the using cost of in-situ separation materials in the 2-phenethyl alcohol production process can be greatly reduced.

Description

Genetically engineered bacterium and construction method and application thereof

Technical Field

The invention belongs to the field of genetic engineering, particularly relates to a genetic engineering bacterium and a construction method and application thereof, and particularly relates to a genetic engineering bacterium for high yield of 2-phenethyl alcohol and a construction method and application thereof.

Background

2-phenethyl alcohol (2-phenyl ethanol, also known as phenethyl alcohol) is an aromatic chemical with rose fragrance, and the 2-phenethyl alcohol mainly exists in gymnosperms and angiosperms and essential oil extracted from the gymnosperms and the angiosperms in nature, so that the natural compound has wide application market. In the field of spices, 2-phenylethyl alcohol is widely used as a main fragrance or a base fragrance in the production of edible essence. The stability of 2-phenethyl alcohol under alkaline condition makes it have important application value in the paint washing and cosmetic industries. In addition, 2-phenethyl alcohol is also an important medical intermediate, and can be used for preparing important chemical raw material styrene through dehydration. The source of 2-phenylethyl alcohol includes chemical synthesis from benzene or styrene, or biosynthesis by using biological fermentation mode, wherein the phenylethyl alcohol content in natural plant essential oil (such as rose essential oil can approach 60%). Wherein, the 2-phenethyl alcohol product produced by utilizing natural raw materials in a biological fermentation mode or an enzyme catalysis mode accords with the legal definition of EU (EU directive 88/388/CEE) and American FDA (CFR-21CFR101.22) on natural spices, and has good market prospect and extremely high economic value.

Saccharomyces cerevisiae (Saccharomyces cerevisiae) has long been used in food fermentation and is one of the GRAS (Generally Recognized As Safe) strains of the food and drug administration FDA of the United states, and is an internationally Recognized Safe microorganism. Saccharomyces cerevisiae is one of the microorganisms found to have relatively high 2-phenylethyl alcohol synthesizing capacity. Compared with other microorganisms, the saccharomyces cerevisiae has higher tolerance to a plurality of stress factors, higher adaptability to industrial environment and mature fermentation process control strategy, so the saccharomyces cerevisiae is an ideal strain for producing 2-phenethyl alcohol by a microbial fermentation method. Although the tolerance of the saccharomyces cerevisiae to the phenethyl alcohol is not high, the yield is not high, but the genetic background is clear, so that the construction of the engineering bacteria with excellent production performance and stable fermentation is the key for improving the yield.

The patent CN107177520A and the patent CN107164250A disclose a Saccharomyces cerevisiae CCTCC NO of M2016785 strain for producing 2-phenethyl alcohol, which can produce 200-450 mg/L2-phenethyl alcohol and can be used for fermenting yellow wine, cooking wine, fruit wine, soy sauce and vinegar, and the aromatic flavor of the wine, the vinegar and the fruit wine is improved by utilizing the 2-phenethyl alcohol production characteristic of the strain. Saccharomyces cerevisiae can utilize central metabolic pathway, and 2-phenylethyl alcohol can be directly synthesized de novo from simple substrates such as glucose through shikimic acid pathway and Ehrlich pathway (Ehrlich pathway), which is the reason for generating a small amount of natural 2-phenylethyl alcohol in the fermentation process of Saccharomyces cerevisiae and some other yeast strains. At present, the yield of 2-phenylethyl alcohol produced by the strain can be increased by metabolically engineered yeast engineering strains, for example, Kim genetically engineered Kluyveromyces marxianus can produce 1.3 g/L2-phenylethyl alcohol by using 10g/L glucose (Enzyme & microbiological Technology,2014,61-62:44, doi:10.1016/j. enzmictec 2014.04.011). Another mode for producing 2-phenethyl alcohol more conveniently and efficiently is to directly convert and produce phenethyl alcohol by taking L-phenylalanine which is an intermediate product of an ehrlich pathway as a substrate. Eshkol discloses a technical scheme for producing 2-phenylethyl alcohol by using a saccharomyces cerevisiae strain and taking phenylalanine as a substrate (Journal of Applied Microbiology, 2009, 106(2): 534-542, doi:10.1111/j.1365-2672.2008.04023. x). In the scheme disclosed by Eshkol, the yield of phenethyl alcohol from dozens of wild Saccharomyces cerevisiae strains separated in national park of Miyashan of Galanga islandica, and laboratory standard haploid strains Saccharomyces cerevisiae Y103 and Saccharomyces cerevisiae S288C is detected, wherein the yield of wild yeast Ye9-612 is the highest, the yield of 2-phenethyl alcohol can reach 0.85g/L at the shake flask level, and the yield can reach 4.5g/L under fed-batch fermentation.

The utilization of gene engineering technology to enhance key enzymes and positive control genes in the phenylethanol anabolism pathway or to truncate and weaken competitive metabolic pathways and negative control genes is considered to be an effective strategy for obtaining industrial production strains of saccharomyces cerevisiae with more excellent performance. As shown in FIG. 1, in the Ehrlich pathway, L-phenylalanine is converted into the corresponding 2-phenylethyl alcohol through three steps of transamination, decarboxylation and reduction. Overexpression of key enzyme genes and positive regulation genes related to the pathway can effectively improve the yield of the phenethyl alcohol. In the alder pathway (appl. environ. microbiol, 2008, 74(8):2259-2266, doi: 10.1128/aem.02625-07): the aromatic amino acid aminotransferase coded by aro8, aro9, Bat2 and Bat1 genes catalyzes a transamination step in the aromatic amino acid aminotransferase; pyruvate decarboxylase or alpha-keto acid decarboxylase encoded by pdc1, pdc5, pdc6, aro10, THI3, catalyzing the decarboxylation step therein; alcohol dehydrogenases encoded by adh1, adh2, adh3, adh4, adh5, adh6, and aromatic alcohol dehydrogenases encoded by aad3, aad4, aad6, aad10, aad14, aad15, aad16, and formaldehyde dehydrogenases encoded by sfa1 catalyze the reduction step in the aldrin pathway. Among the regulatory genes of the ehrlich pathway: the transcription factor Aro80p encoded by the Aro80 gene can activate the expression of the genes Aro9 and Aro10 in response to aromatic amino acids; the transcription factor coded by the gene CAT8 can regulate the expression of the genes aro9 and aro10 and promote the growth of cell walls; the genes Gap1 and Agp1 encode Gap1p and Agp1p, which are the major permeases for transporting aromatic amino acids into cells, transport L-phenylalanine intracellularly and participate in the metabolic activity of cells (Journal of Biotechnology 242(2017) 83-91, doi: 10.1016/j.jbiotec.2016.11.028). It is easy to find that the related regulatory gene not only includes the transcription factor and other regulatory factors directly acting on the 2-phenethyl alcohol synthetic path related enzyme, but also includes the transport function element gene including the amino acid permease which plays an indirect role. Boer discloses that more than 3000 regulatory genes are possibly involved in the metabolic regulation of the amino acid Israeli pathway, wherein it is confirmed that 23 regulatory genes can positively regulate the utilization of amino acid in the Israeli pathway Saccharomyces cerevisiae, and wherein the Aro80 and MIP6 regulatory genes can obviously enhance the utilization of L-phenylalanine by strains (FEMS Yeast Res 7(2007) 604-620, doi:10.1111/j.1567-1364.2007.00220. x).

Patent application CN103409332A discloses a method for increasing the ability of saccharomyces cerevisiae engineering strains to convert phenylalanine to produce 2-phenylethyl alcohol by coupling an overexpression aminotransferase gene aro8 and a decarboxylase gene aro10 by taking saccharomyces cerevisiae S288C as an original strain.

Kim discloses a Kluyveromyces marxianus BY25569 strain as an original strain, a pyruvate decarboxylase gene aro10 and ethanol dehydrogenase adh2 from saccharomyces cerevisiae are heterogeneously and over-expressed to enhance the strain Airy pathway, and the 2-phenethyl alcohol yield of the original strain is increased BY 5 times to 1g/L (Enzyme and microbiological Technology 61-62 (2014) 44-47, doi:10.1016/j. enzmictec.2014.04.011). In the solution disclosed by Kim, overexpression of aro10 gene alone, or adh2 alone did not result in any improvement in the production of phenylethanol (page 45, right column, line 8).

The national seoul university discloses a metabolic engineering scheme for improving the yield of the phenethyl alcohol produced by converting phenylalanine into saccharomyces cerevisiae W303-1B strain by co-free over-expression of three genes of aro9, aro10 and aro80 (Biotechnology and Bioengineering, Vol.111, No.1, January,2014, doi: 10.1002/bit.24993). In the technical scheme disclosed at the university of seoul, when Saccharomyces cerevisiae W303-1B singly overexpresses the Aro80 transcription factor, the 2-phenylethyl alcohol capacity of the original strain is improved by 58%, and the yield of 48h is improved from 110.1mg/L of the original strain to 173.8 mg/L. The yield of 2-phenethyl alcohol of the strain can be improved a little when the aro9 gene is singly expressed in a free mode or the aro10 gene is singly expressed in a free mode, but the yield of the strain is greatly improved to 350mg/L when the aro9 and the aro10 are simultaneously overexpressed, and in addition, the yield of 2-phenethyl alcohol of the strain can be further improved to 449.5mg/L when the aro9, the aro10 and the aro80 genes are simultaneously overexpressed.

Li discloses the overexpression of genes related to the Ehrlich pathway in Saccharomyces cerevisiae YPH499 to increase the production of phenethyl alcohol (Journal of Bioscience & Bioengineering,2016,122(1):34-39, doi:10.1016/j. jbios. 2015.12.022). In the protocol disclosed by Li, it screened 3 different 2-keto acid decarboxylases (including aro10 and Thi3 from Saccharomyces cerevisiae, and Kivd from lactococcus lactis), as well as 6 alcohol dehydrogenase genes (including adh1, adh2, adh5, adh6, adh7, and sfa1 for enhancement of the Ehrlich pathway. in the protocol disclosed by Li, the 2-phenylethyl alcohol yield of the combined expression strain of adh1 and aro10 was higher than that of the other gene combinations and the engineered strain expressing aro10 alone.

Although the conclusion that key enzymes and positive regulation genes in the pathway for enhancing the phenylethanol anabolism can possibly obtain a phenylethanol high-yield strain can be drawn through the existing known documents, in the practical process, due to the complexity of biological metabolism, the result of gene expression cannot be predicted, and meanwhile, an optimal expression scheme suitable for a required strain is difficult to select from a massive genome synthesis mode. The complexity of the biological metabolism includes, but is not limited to, the following:

(1) adaptation of strains to genes, that is, expression levels of the same genes are different when the same genes are expressed in different strains, for example, Carreto discloses that the expression levels of the genes of Saccharomyces cerevisiae Lalvin EC-1118, Lalvin ICVD254, S228C, 06L3FF02, 06L6FF20 and J940047 are different in different strains, and have larger difference in different growth stages (BMC Genomics 2011,12:201, doi:10.1186/1471-2164-12-201), sfa1 gene has higher expression level in Lalvin EC-1118, but the expression of the Lalvin ICV D254 strain is higher than that of the EC-1118, S228C strain and J94004947 maintain lower sfa1 gene expression in stable and death stages of the strains. Based on the complexity of strain adaptation, even if a certain gene or several genes that are the same are expressed, the gene expression level or the expression ratio of several genes is different due to different strains, which makes it difficult for the skilled person to know the genes that are adapted to the strain.

(2) Various isoenzymes and homologous enzymes exist in intracellular metabolic steps, and various compensatory mechanisms exist, which are one of the reasons of metabolic complexity, for example, in the metabolic process of reducing phenylacetaldehyde to form 2-phenethyl alcohol, enzymes (isoenzymes) encoded by a plurality of genes including adh1, adh2, adh3, adh4, adh5, adh6, aad3, aad4, aad6, aad10, aad14, aad15, aad16 and sfa1 can catalyze the step. Even for the same enzyme, homologous enzymes from different species or strains of origin may differ in sequence and structure, resulting in differences in enzymatic activity and function. Meanwhile, due to the bias (such as codon bias) of the strains, homologous enzymes with different sequences have larger difference in different strains. Based on the complexity of isoenzymes and isoenzymes, although those skilled in the art can easily know that it is possible to obtain high-yield strains of phenethyl alcohol by enhancing key enzymes and positive control genes in the phenethyl alcohol anabolic pathway, it is still difficult and unpredictable to select which isoenzyme and isoenzyme sequence is the key gene that can actually enhance the yield of phenethyl alcohol.

(3) The complex gene compatibility condition is that a plurality of related enzymes and regulatory elements are mutually coordinated to realize the optimization of metabolic functions due to the fact that a plurality of reactions of a plurality of nodes are involved in the metabolic process, a large amount of assistance and connection exist in the genes, the expression of each gene is proper, and the genes are matched with the whole metabolic network, so that the restriction of metabolic pathways caused by the low expression level of a certain gene is avoided, and the burden of thalli is increased or the inhibitory regulation is activated due to the excessive expression of the certain gene. Several genes identical can produce distinct results at different Expression ratios. For example, Latimer constructs xylose metabolic pathway in Saccharomyces cerevisiae, which adopts different expression promoter combinations to express 8 key enzymes involved in xylose metabolism to different degrees, and the results show that there is great phenotypic difference in xylose utilization among strains with different gene expression ratios, and the difference is also influenced by environmental factors (such as culture conditions) (Metab Eng.2014Sep; 25:20-9.doi: 10.1016/j.ymben.2014.06.002). For this reason, even if one of skill in the art knows that enhancing key enzymes and positive regulatory genes in the phenylethanol anabolic pathway may result in a high-yielding strain of phenylethanol, one would not know which genes involved should be expressed at what expression levels and ratios to optimize the metabolic network.

Disclosure of Invention

In view of the above, the present invention aims to provide a genetically engineered bacterium with high 2-phenylethyl alcohol yield, a construction method thereof, and an application thereof.

In order to realize the purpose of the invention, the invention adopts the following technical scheme:

the invention provides a gene engineering bacterium, wherein a key gene in a 2-phenethyl alcohol anabolism pathway is integrated on a strain genome.

In some embodiments, the genetically engineered strain is saccharomyces cerevisiae.

Further, in some embodiments, the genetically engineered bacterium is saccharomyces cerevisiae BSH-H9.

Preferably, the key genes in the anabolic pathway for 2-phenylethyl alcohol are aro8, aro9, aro10 and sfa 1.

In some embodiments, the present invention provides a genetically engineered bacterium, Saccharomyces cerevisiae CFFSH-006, which has integrated genes aro8, aro9, aro10 and sfa1 essential to the anabolic pathway of 2-phenylethyl alcohol into its genome, and can produce 2-phenylethyl alcohol in high yield. The saccharomyces cerevisiae CFFSH-006 is preserved in China center for type culture Collection with the preservation number of CCTCC NO: m2018669.

The invention provides a construction method of the genetic engineering bacteria, which comprises the steps of respectively constructing expression frames of a plurality of key genes in a 2-phenethyl alcohol anabolism path, then jointly and randomly integrating the expression frames into a host strain polyclonal site to construct a random integration expression library of the 2-phenethyl alcohol metabolism key genes, testing and screening each strain in the library, and obtaining the strain with high 2-phenethyl alcohol yield.

In some embodiments, the method of constructing wherein the integration is a site integration method.

In some embodiments, the method of construction wherein the host strain is Saccharomyces cerevisiae. Further, in some embodiments, the host strain is Saccharomyces cerevisiae BSH-H9.

In some embodiments, the key gene in the anabolic pathway for 2-phenylethyl alcohol in the construction method is at least one of aro8, aro9, aro10, sfa 1. In some embodiments, the key genes in the 2-phenylethyl alcohol anabolic pathway are aro8, aro9, aro10, and sfa 1. Wherein the aro8 gene sequence is shown as SEQ ID NO.2, the aro9 gene sequence is shown as SEQ ID NO.3, the aro10 gene sequence is shown as SEQ ID NO.4, and the sfa1 gene sequence is shown as SEQ ID NO. 5.

The invention also provides application of the genetic engineering bacteria in fermentation production of 2-phenethyl alcohol. In particular to the application of Saccharomyces cerevisiae CFFSH-006 in the fermentation production of 2-phenethyl alcohol.

Furthermore, the invention provides a method for producing 2-phenethyl alcohol, which uses L-phenylalanine as a substrate to produce 2-phenethyl alcohol by using the gene engineering bacteria fermentation or cell catalysis mode.

In some embodiments, the present invention provides a method for producing 2-phenylethyl alcohol by using L-phenylalanine as a substrate and using the Saccharomyces cerevisiae CFFSH-006 of the present invention in a fermentation or cell-catalyzed manner to produce 2-phenylethyl alcohol.

The invention also provides a method for screening the key genes of 2-phenethyl alcohol metabolism, which comprises the following steps:

(1) respectively cloning key genes to be screened and connecting the key genes to be screened into expression frames of free expression plasmids of a host to obtain free expression plasmids respectively carrying different key genes to be screened; wherein the key gene to be screened is an enzyme coding gene, a regulating gene or an auxiliary gene on a 2-phenethyl alcohol anabolism pathway.

(2) Mixing the free expression plasmids respectively carrying different key genes to be screened, co-transforming host bacteria, selecting positive transformants, and obtaining a recombinant strain library carrying the free expression plasmids of the combination of the different key genes to be screened;

(3) and respectively carrying out fermentation test on transformants in the obtained recombinant strain library, screening the 2-phenethyl alcohol production capacity of different transformation strains, selecting strains capable of producing phenethyl alcohol at high yield, and identifying key genes to be screened and key gene combinations to be screened contained in the recombinant strains capable of producing phenethyl alcohol at high yield.

Wherein, in some embodiments, the key genes to be screened in the method for screening key genes for 2-phenylethyl alcohol metabolism are aro8, aro9, aro10, sfa1, aro80, CAT8, gap1 and agp 1.

In some embodiments, in the method for screening key genes of 2-phenylethyl alcohol metabolism, step (1) is specifically to co-transform the gene fragments of a plurality of key genes to be screened, which respectively contain a promoter and a terminator at two ends, and the enzyme-digested linearized free expression vector containing the same promoter and terminator into a host.

In some embodiments, the promoter in the method for screening key genes for 2-phenylethyl alcohol metabolism is a PGK1 strong promoter, the terminator is CYC1, and the episomal expression vector is plasmid pCS 01.

Furthermore, the invention provides a method for constructing high-yield 2-phenethyl alcohol engineering strains, which is characterized in that 2-phenethyl alcohol metabolism key genes are screened and confirmed by the method for screening the 2-phenethyl alcohol metabolism key genes, expression frames are respectively constructed and are jointly and randomly integrated in a host multiple cloning site to obtain a random integration expression library of the 2-phenethyl alcohol metabolism key genes, and each strain in the library is tested and screened to obtain the strain with high 2-phenethyl alcohol yield.

According to the technical scheme, the invention provides the genetic engineering bacteria for high yield of 2-phenethyl alcohol and the construction method and the application thereof. According to the gene engineering bacterium, a key gene in a 2-phenethyl alcohol anabolism pathway is integrated on a strain genome. The gene engineering bacteria can be used for converting L-phenylalanine to generate 2-phenethyl alcohol, and the 2-phenethyl alcohol has high yield and extremely high commercial value. Experiments show that the concentration of 2-phenethyl alcohol of the genetically engineered bacterium CFFSH006 can reach more than 3.5g/L by fermentation at the shake flask level, the concentration of 2-phenethyl alcohol produced by the in-situ separation fermentation process can reach more than 18g/L, higher production strength can be kept under the condition of greatly reducing the using amount of polypropylene glycol, 2-phenethyl alcohol can be effectively accumulated, the yield of 2-phenethyl alcohol is improved, the industrial application prospect is very good, and the use cost of in-situ separation materials in the production process of 2-phenethyl alcohol can be greatly reduced.

Biological preservation Instructions

Saccharomyces cerevisiae CFFSH006(Saccharomyces cerevisiae CFFSH006) is preserved in the China center for type culture Collection in 2018, 10 months and 15 days, with the address of China, Wuhan university and the preservation number of CCTCC NO: m2018669.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 is a schematic diagram showing the process followed in the Ehrlich pathway for the conversion of L-phenylalanine to phenethyl alcohol;

FIG. 2 shows a schematic flow diagram of a method for rapid screening of key genes for 2-phenylethyl alcohol metabolism in a yeast host strain;

FIG. 3 is a diagram showing the results of PCR identification of a library of recombinant bacteria, wherein M is Mark control, 1 is Varo8, 2 is Varo9, 3 is Varo10, 4 is Vsfa1, 5 is Vgap1, 6 is Vagp1, 7 is Varo80, and 8 is Vcat 8;

FIG. 4 shows the 2-phenylethyl alcohol production of the 48 clones with the highest OD570 in the primary screen;

FIG. 5 shows the 2-phenylethyl alcohol production of 48 clones with the lowest OD570 in the primary screening;

FIG. 6 shows the yield of 2-phenylethyl alcohol of 48 recombinant bacteria in the first round of re-screening;

FIG. 7 is a graph showing the results of the second round of rescreening 2-phenylethyl alcohol production; wherein colony2, 4, 10, 17 and 18 are five strains with the highest yield in the first round of re-screening, and Host is an original strain BSH-H9;

FIG. 8 is a graph showing the identification results of episomal expression plasmids in 5 recombinant strains, wherein lanes are labeled: m is Mark, C is a control strain BSH-H9, 1 is a recombinant strain colony2, 2 is a recombinant strain colony4, 3 represents a recombinant strain colony10, 4 represents a recombinant strain colony17, and 5 represents a recombinant strain colony 18;

FIG. 9 shows a gel electrophoresis verification scheme of a Donor DNA fragment, in which lane M is Mark, 1 is PGK1p-aro8-CYC1t, 2 is PGK1p-aro9-CYC1t, 3 is PGK1p-aro10-CYC1t, and 4 is PGK1p-sfa1-CYC1 t;

FIG. 10 is a diagram showing the results of gel electrophoresis in PCR identification of the recombinant bacterium library of example 2;

FIG. 11 is a graph showing the results of the first round of screening for 2-phenylethyl alcohol production;

FIG. 12 is a graph showing the results of the second round of screening for 2-phenylethyl alcohol production;

FIG. 13 is a graph showing the results of the third round of screening for 2-phenylethyl alcohol production by each strain;

FIG. 14 shows the dynamic changes of the parameters during fermentation in example 5;

FIG. 15 shows a gel electrophoresis of PCR products of BSH-H9 and CFFSH-006 genome, in which lane M represents Mark, aro8 represents the gene expression cassette for aro8, aro9 represents the gene expression cassette containing aro9, aro10 represents the gene expression cassette containing aro10, and sfa1 represents the gene expression cassette containing sfa 1;

FIG. 16 shows the results of PCR identification gel electrophoresis of a randomly integrated recombinant bacterial library constructed in example 7 using s.cerevisiae CEN.PK 2-1C as a host: PCR identification is carried out on aro8, aro9, aro10 and sfa1 by taking the total genomic DNA of the recombinant bacterium library as a template, and the result shows that four genes of aro8, aro9, aro10 and sfa1 can be detected in the total genomic DNA of the recombinant bacterium library;

FIG. 17 shows the yields of 2-phenylethyl alcohol from each strain of the first round of screening in example 7;

FIG. 18 shows the 2-phenylethyl alcohol production by each strain of the second round of screening in example 7.

Detailed Description

The invention discloses a genetic engineering bacterium and a preparation method and application thereof. Those skilled in the art can modify the process parameters appropriately to achieve the desired results with reference to the disclosure herein. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and products of the present invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications of the methods described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of the present invention without departing from the spirit and scope of the invention.

In the application of the invention, the inventor intends to use wine-making saccharomyces cerevisiae BSH-H9 screened by a company as an initial strain, obtain key genes which have significant influence through screening, and adopt a proper construction mode to ensure that the strain can be expressed on a genome integrated with a saccharomyces cerevisiae BSH-H9 strain in an optimized gene expression ratio, thereby constructing a genetic engineering strain saccharomyces cerevisiae with high 2-phenylethyl alcohol yield.

In the application, the BSH-H9 strain is a beer YEAST M15EMPIRE ALE YEAST from Mangrove Jack company, and after a large amount of commercial saccharomyces cerevisiae and food industry YEAST are compared, the strain is found to have higher 2-phenethyl alcohol basic yield and tolerance capability, so the strain is renamed to be BSH-H9 and is used as a host strain for screening key genes and a modified starting strain in the application. The invention provides a method for rapidly screening key genes of yeast host strain 2-phenethyl alcohol metabolism.

The key genes of 2-phenethyl alcohol metabolism in the application refer to coding genes, or regulating genes or other auxiliary genes (such as transmembrane transport genes and the like) of enzymes which can obviously improve the yield of thalli 2-phenethyl alcohol after being expressed in a yeast host strain.

The invention also provides a method for constructing the high-yield 2-phenethyl alcohol engineering strain.

Due to the complexity of biological metabolism, the process of producing 2-phenylethyl alcohol by yeast strains needs the joint participation of a plurality of genes and regulatory genes, so the adaptation condition of the genes and thalli, the matching condition of the genes and the genes, and the expression ratio of which genes are selected and expressed all need to be solved when obtaining the high-yield 2-phenylethyl alcohol strains. Therefore, it is necessary to screen key genes and key regulatory genes on the 2-phenylethyl alcohol synthesis path adapted to the strain. Because the number of genes and regulatory genes related to the 2-phenylethyl alcohol synthesis path is huge and various, and the phenotype of the strain is also influenced by the expression level and the expression ratio of each gene, the method for screening by adopting gene screening one by one and constructing expression libraries of different gene combinations needs to consume a large amount of time and research and development investment.

Therefore, the invention adopts a method for rapidly screening the key genes of the 2-phenethyl alcohol metabolism of the yeast host strain to identify the key genes which are most suitable for the wild strain and influence the yield of the 2-phenethyl alcohol. The method for rapidly screening the key genes of the 2-phenethyl alcohol metabolism of the yeast host strain comprises the steps of randomly expressing enzyme coding genes or regulating genes or auxiliary genes on a plurality of 2-phenethyl alcohol metabolism approaches in a host body freely to form a random free expression strain library, screening strains with greatly improved 2-phenethyl alcohol yield in the library, identifying the types of genes carried on free expression plasmids in the strains with greatly improved yield by PCR, and obtaining the free expression genes and gene combinations detected in high-yield strains with greatly improved yield as the key genes of the 2-phenethyl alcohol metabolism. The method specifically comprises the following steps: (1) cloning key enzyme genes (including but not limited to aro8, aro9, aro10, sfa1 and the like) and regulation auxiliary genes (including but not limited to aro80, CAT8, gap1 and agp1) on a 2-phenethyl alcohol synthetic path to be used as screened genes, and cloning and connecting genes to be screened into expression frames of free expression plasmids of a yeast host respectively to construct a series of free expression plasmids respectively carrying a certain different gene to be screened; (2) mixing the free expression plasmids loaded with different genes to be screened, which are constructed in the step (1), to obtain a plasmid mixture containing plasmids loaded with different genes to be screened; (3) co-transforming saccharomyces cerevisiae by using the free expression plasmid mixed solution of the genes to be screened, and selecting positive transformants from the saccharomyces cerevisiae, thereby constructing a recombinant strain library which potentially contains different combinations of the genes to be screened and is possible to be free expressed; (4) respectively performing fermentation tests on transformants in the recombinant strain library obtained by cotransformation, testing and screening the 2-phenethyl alcohol production capacity of different transformation strains, and selecting strains capable of highly producing phenethyl alcohol; (5) identifying the gene to be screened and the gene combination to be screened contained in the high-yield phenethyl alcohol recombinant strain, thereby determining that the gene to be screened or the gene combination to be screened is a key gene which can remarkably increase the phenethyl alcohol yield of the wild strain.

In the steps (1) to (3) of the method for rapidly screening the key genes of the 2-phenethyl alcohol metabolism of the yeast host strain, intracellular one-step gene assembly substitution can also be adopted (the method can be referred to as Bioengineered 5:4, 254-263; DOI:10.4161/bioe.29167), namely, homology arms matched with free expression plasmids are designed at two ends of an expression frame of a gene to be expressed, an enzyme digestion linearized free expression vector and a gene fragment to be screened, the two ends of which contain the homology arms, are simultaneously transformed into the host strain, and the assembly of the expression gene frame is completed in a strain cell by utilizing the homologous recombination of yeast. The enzyme digestion linearization site of the episome expression vector is positioned between a plasmid promoter and a terminator, and can meet the requirement that complete circular episome expression plasmids can be formed when the gene segments of enzyme coding genes or regulatory genes or auxiliary genes, both ends of which respectively contain a yeast promoter and a terminator, and the episome expression vectors containing the same promoter and the same terminator are subjected to homologous recombination and assembly. In order to generate random recombinant bacteria library containing abundant combinations of different genes to be screened and expression ratio combinations, it is necessary to co-transform linearized episomal expression plasmids with homologous arm recombinant gene fragments of multiple genes to be screened (as shown in FIG. 2).

In the method for rapidly screening the key genes of the 2-phenethyl alcohol metabolism of the yeast host strain, the genes are assembled and transformed randomly, so that a large number of transformation results and gene combination modes are generated, and a free expression recombinant bacterium library is constructed. In the recombination library of free expression, theoretically, there exist not only a recombination strain into which only a single gene to be screened is transferred, but also a mode of co-transformation of different combinations among a plurality of genes. Meanwhile, as the transferred quantity of the episomal expression vector is completely random, the episomal expression vector of a certain gene to be screened in the transferred strain can be single copy or multiple copy number. Because the expression level of each gene to be screened in the strain is influenced by the transfer copy number, the expression ratio among the genes to be screened is random, and the probability that the 2-phenethyl alcohol yield of the whole strain is influenced by poor expression ratio and then the key gene cannot be identified is reduced.

In the method for rapidly screening the key genes of the 2-phenethyl alcohol metabolism of the yeast host strain, the key enzyme genes and the regulation auxiliary genes on the 2-phenethyl alcohol synthesis path can be derived from the genome genes of the yeast host and can also be heterologous source genes.

After the key genes which are matched with the host strain and can obviously increase the yield of the phenethyl alcohol are screened out by the method for rapidly screening the key genes of the 2-phenethyl alcohol metabolism of the yeast host strain, the key genes are integrated on the genome of the host strain at a proper expression ratio, and researchers in the field can hardly work out a polygene over-expression scheme which can be most suitable for the host strain to produce the 2-phenethyl alcohol by the aid of the prior art due to the complexity of a metabolic network and a regulation mechanism. Therefore, the invention provides a method for constructing a high-yield 2-phenethyl alcohol engineering strain, which comprises the following steps: (1) respectively constructing expression frames of various quasi-expression genes driven by strong promoters, wherein the quasi-expression genes are determined by utilizing the method for rapidly screening the key genes of the 2-phenethyl alcohol metabolism of the saccharomyces cerevisiae host strain; (2) and (3) taking the delta () sequence of the host yeast as an integration site, mixing and merging the components of each key gene expression frame, and randomly integrating the key genes into the yeast by adopting a site integration method to obtain an integrated and expressed recombinant strain library. (3) And testing and screening each strain in the integrated and expressed recombinant strain library to obtain the engineering recombinant strain with high yield.

In the method for constructing the high-yield 2-phenethyl alcohol engineering strain, in the step (1), genes expressed in the host strain are selected to be strains which can increase the yield of the host strain 2-phenethyl alcohol and are determined after being screened by the method for rapidly screening the key genes of the saccharomyces cerevisiae host strain 2-phenethyl alcohol metabolism, the genes which are matched with the host strain are screened from massive genes related to the 2-phenethyl alcohol metabolism and regulation by the method for rapidly screening the key genes of the saccharomyces cerevisiae host strain 2-phenethyl alcohol metabolism, and the increase of interference caused by isoenzymes, homologous enzymes and regulation and control of the metabolism complexity is reduced. The construction method is also characterized in that when the integration expression is carried out by adopting a site integration method, a plurality of genes to be expressed are randomly integrated after being randomly mixed, so that the combination mode among the obtained genes and the expression ratio among the genes are random. Therefore, there are a plurality of abundant combinations of genes whose combination patterns and expression ratios are different from each other in the obtained library of integrally expressed recombinant strains. Wherein, theoretically, a certain strain or a plurality of recombinant strains must exist, the combination mode of the strains integrated into the genome and the expression ratio thereof are more suitable for the metabolism of the 2-phenethyl alcohol of the host strain, so that the phenethyl alcohol yield of the host strain can be greatly improved. The gene combination mode refers to a gene combination mode which is possible to generate in the integration result when a plurality of genes are mixed and randomly integrated on the host strain genome, for example, four genes A, B, C and D are mixed and then randomly integrated, and the possible gene combination modes in the integration result include: only the A gene is integrated, the A + B gene is integrated, the A + C + D gene is integrated, the A + B + C + D four genes are integrated in the genome, and other combination modes of the four genes are provided. In theory, the recombinant strain library contains all possible combinations of genes to be expressed. The expression ratio refers to the ratio between the expression levels of different genes, and since the integration process is random, the copy number of the gene integrated on the genome is also random, and the expression levels of different genes are also random due to the difference of the copy number. The site integration method is a gene operation method for integrating genes and yeast genome-sites, and comprises a yeast-site mode of randomly integrating expressed genes in a homologous arm recombination mode (Nucleic Acids Res.2009Feb; 37(2). doi:10.1093/nar/gkn991), a mode of integrating genes into a yeast chromosome group in a CRISPR-Cas9 mediated mode disclosed by Shuobo (S.Shi et al. Metabolic Engineering 33(2016) 19-27, doi:10.1016/j. ymben.2015.10.011), and other gene operation methods for integrating genes and yeast-sites known by technical personnel in the field.

In the method for constructing the high-yield 2-phenethyl alcohol engineering strain, besides the site, other multiple cloning sites of the host yeast genome can also be integrated.

The invention also constructs an engineering strain Saccharomyces cerevisiae CFFSH006(Saccharomyces cerevisiae CFFSH006) capable of being applied to industrial production of the 2-phenethyl alcohol. The saccharomyces cerevisiae CFFSH006 is obtained by screening wine-making saccharomyces cerevisiae BSH-H9 from a company as a host strain of gene expression, then screening by adopting the method for rapidly screening the key genes of 2-phenethyl alcohol metabolism of the saccharomyces cerevisiae host strain, selecting key enzymes and regulating genes (comprising aro8, aro9, aro10, sfa1, aro80, CAT8, gap1 and agp1) in a 2-phenethyl alcohol synthesis path as genes to be screened, and carrying out co-transformation after integrating a free expression vector of an expression vector pCS01 with a gene expression frame to be screened so as to obtain a free expression recombinant bacteria library. The 5 strains with the highest 2-phenethyl alcohol yield in the free expression recombinant strain library are identified by PCR, and all contain four genes of aro8, aro9, aro10 and sfa1, so that the aro8, aro9, aro10 and sfa1 in the genes to be screened are key genes which are matched with the strain saccharomyces cerevisiae BSH-H9 and can obviously improve the yield, and the aro80, CAT8, gap1 and agp1 genes have no obvious influence on the saccharomyces cerevisiae BSH-H9.

The application utilizes the method for constructing the high-yield 2-phenethyl alcohol engineering strain, the aro8, aro9, aro10 and sfa1 genes are randomly integrated on the genome of saccharomyces cerevisiae BSH-H9 by using a CRISPR-Cas9 mediated-site integration method, and a recombinant engineering strain with the highest yield and the most stable phenotype is screened from 1037 recombinant strains in a total recombinant strain library screened, wherein the recombinant engineering strain is named saccharomyces cerevisiae CFFSH 006.

The invention also provides a method for producing 2-phenethyl alcohol. The saccharomyces cerevisiae CFFSH006 constructed by the invention can be used for converting L-phenylalanine to generate 2-phenethyl alcohol, and has extremely high commercial value. In the method, a saccharomyces cerevisiae CFFSH006 strain is taken as a production strain and inoculated in a culture medium containing a substance capable of supporting the growth of the saccharomyces cerevisiae, and L-phenylalanine is added into the culture medium in a single time or in batches to be taken as a substrate, so that the L-phenylalanine in the culture medium is converted into 2-phenylethyl alcohol by utilizing the L-phenylalanine conversion capacity of the CFFSH006 strain. The Saccharomyces cerevisiae CFFSH006 starting strain is a commercial fruit wine Saccharomyces cerevisiae strain, has no special nutritional requirements, and can be cultured in a culture medium commonly used in the yeast brewing industry, or in a culture medium commonly used in yeast culture, such as a yeast extract glucose (YPD) culture medium.

In order to further understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Unless otherwise specified, the reagents involved in the examples of the present invention are all commercially available products, and all of them are commercially available.

Example 1 Rapid screening of Yeast host Strain 2-Phenylethanolic metabolism Key genes

(1) Construction of E.coli-s.cerevisiae shuttle free expression vector pSC01

An escherichia coli-saccharomyces cerevisiae shuttle vector pSC01 is constructed by using an escherichia coli replicon oriE, a saccharomyces cerevisiae replicon 2 mu ori, a Kan resistance gene, a saccharomyces cerevisiae promoter PGK1p and a terminator CYC1t as basic elements and is used for free expression of a target gene in saccharomyces cerevisiae, and the constructed pSC01 gene sequence is shown as a gene sequence SEQ ID NO. 1.

(2) Cloning of key enzymes and regulatory genes

The primers with homology arms designed to recombine with the promoter PGK1 and the terminator CYC1 in the expression vector pCS01 are shown in Table 1. Extracting a genome of the saccharomyces cerevisiae BSH-H9 as a template, and using key enzymes and regulatory genes (including aro8, aro9, aro10, sfa1, aro80, CAT8, gap1 and agp1) in a PCR amplification 2-phenethyl alcohol synthetic pathway as genes to be screened. The PCR was performed by NEB

The High-Fidelity PCR Master Mix with HF Buffer kit performs PCR according to the PCR reaction system described in the instruction, and the adopted PCR reactionThe conditions are as follows: firstly, pre-denaturing at 98 ℃ for 30 s; then, three temperature cycle programs of 98 ℃ for 10s, 50 ℃ for 30s and 72 ℃ for 1min and 30s are adopted, and the cycle times are 3 times; then, three temperature cycle programs of 98 ℃ for 10 seconds, 55 ℃ for 30 seconds and 72 ℃ for 1 minute and 30 seconds are adopted, and the cycle frequency is 29 times; then keeping the temperature at 72 ℃ for 5 min; finally, the temperature is reduced to 4 ℃ to finish the PCR reaction. And (3) identifying and sequencing the 8 gene fragments to be screened which respectively contain the homologous arms recombined by the promoter PGK1 and the terminator CYC1 at two ends obtained by PCR, and storing for later use.

TABLE 1 cloning of the host's own key enzymes and regulatory genes

(3) Construction of recombinant Strain libraries

The aro8, aro9, aro10, sfa1, aro80, CAT8, gap1 and agp1 gene fragments of the homologous arms which are preserved and ready to be recombined and contain the promoter PGK1 and the terminator CYC are co-transformed into a saccharomyces cerevisiae BSH-H9 strain together with a linearized pCS01 plasmid which is digested by BamHI restriction enzyme, and then DNA is rapidly assembled in cells to construct a recombinant strain library (the flow is shown in a figure 2).

The construction process is as follows: (1) inoculating a single colony of saccharomyces cerevisiae BSH-H9 in a YPD liquid culture medium, and culturing at 30 ℃ and 200rpm until the OD600 is about 3-3.5; (2) centrifuging at 4 ℃ and 4000rpm for 5min to collect thalli, adding 16mL of pre-precooled sterile water for resuspending cells, sequentially adding 2mL of 10 × TE buffer, uniformly mixing, 2mL of 1M lithium acetate, and uniformly mixing; (3) shaking and incubating the uniformly mixed resuspended cells for 45min at the temperature of 30 ℃ and the speed of 85 rpm; (4) adding 500 μ L of 1M DTT, mixing, incubating at 30 deg.C and 85rpm for 15 min; (5) adding water to complement the volume to 50mL, centrifuging at 4 ℃ and 4000rpm for 5min, removing supernatant, and adding 50mL of precooled sterile water for resuspension; (6) centrifuging at 4 deg.C and 4000rpm for 5min, discarding supernatant, adding 30mL precooled sterile 1M sorbitol, and rinsing once; (7) centrifuging at 4 deg.C and 4000rpm for 5min, discarding supernatant, adding appropriate amount of precooled sterile 1M sorbitol, and resuspending to obtain BSH-H9 competent cells; (8) taking 40 mu LBSH-H9 competent cells, adding 5 mu L of DNA mixture (containing BamHI digested and linearized pCS01 plasmid DNA fragment, aro8, aro9, aro10, sfa1, aro80, CAT8, gap1 and agp 18 gene fragments containing homologous arms) and carrying out electrotransformation in a 2mm electric rotor (the electrotransfer voltage is 1.5 kv); (9) the cells after electroporation were resuspended in 1mL of 1M sorbitol, then diluted and plated on YPD agar plates containing G418 geneticin (300. mu.g/mL), and cultured in an incubator at 30 ℃ until single colonies were formed, for further isolation of single colonies of the recombinant strain library for key gene screening. Meanwhile, a part of the resuspension is taken and directly inoculated into a liquid culture medium containing 300 mug/mL G418 geneticin for culture for 72 hours, and a mixed culture containing all the strains of the recombinant bacterium library is obtained for identification of the recombinant bacterium library.

(4) Identification of recombinant Strain libraries

Taking the mixed culture of the recombinant bacterium library after 72h of culture, and extracting the total DNA of the culture. An upstream primer CPGK1p-F identified by PCR is designed based on the sequence of the PGK1p promoter of the vector pCS01 (the sequence is shown in Table 2), and a PCR downstream primer Caro8-R, Caro9-R, Caro10-R, Caro80-R, Csfa1-R, Cgap1-R, Cagp1-R, Ccat8-R is designed according to the sequence of each gene respectively, and the sequence is shown in Table 2.

And respectively carrying out PCR amplification on different genes to be expressed by taking the total DNA of the extracted mixed culture as a template and taking a common upstream primer CPGK1p-F and downstream primers corresponding to the respective genes as primer pairs. PCR is carried out by using a ready-to-use high-fidelity PCR amplification kit of Shanghai Czeri bioengineering GmbH according to the general method described in the specification, and the amplification result is identified by nucleic acid gel electrophoresis. Gel electrophoresis of the amplification products of the different primers is shown in FIG. 3. The result shows that the size of the promoter PGK1p obtained by amplification and the tandem fragment of the gene to be expressed is consistent with the expected result, and the result shows that the gene to be expressed and the pCS01 linearized vector are assembled into a complete plasmid in cells. The result also indicates that in the constructed recombinant bacteria library, all 8 kinds of expression boxes of the pseudoexpression genes complete the intracellular assembly with the pCS01 free expression vector. Theoretically, any combination of these 8 episomal expression plasmids for the pseudoexpression genes may exist intracellularly in the strains in the recombinant library.

TABLE 2 recombinant Strain library identification primers

Primer name	Description of the invention	5'-sequence-3'
			CPGK1p-F	Upstream primer	caacagcctgttctcacaca
Caro8-R	Aro8 downstream primer	CAGCACTGAACCCGTATTGC
			Caro9-R	Aro9 downstream primer	ACTCTCTGTCGAAGGTCAGG
Caro10-R	Aro10 downstream primer	GTACGTCTCCAAGGATCGCA
			Caro80-R	Aro8 downstream primer	ACCTAGTACTAGCCTCTGCC
Csfa1-R	Sfa1 downstream primer	GACGGTTCTTAAGCAATCAC
			Cgap1-R	Downstream primer of Gap1	ATCTGGATTATTCTTCTCGTACG
Cagp1-R	Agp1 downstream primer	ACGCACGGCAGAAGTGTTAT
			Ccat8-R	Cat8 downstream primer	TTCTCCAGTTATCCAGTGCG

The total DNA of the recombinant bacteria library is used as a template, a common upstream primer CPGK1p-F and downstream primers corresponding to respective genes are used as primer pairs for amplification, and the gel electrophoresis result of the PCR amplification product is shown in FIG. 3.

The theoretical length of the promoter PGK1p and the gene fragment to be expressed in tandem is shown in Table 3, wherein the fragment name is indicated by the V + gene name.

TABLE 3 theoretical Length of the Gene fragment for the promoter PGK1p in tandem with the Gene to be expressed

No.	Fragments	Size(bp)
			1	Varo8	570
2	Varo9	820
			3	Varo10	1030
4	Vsfa1	1380
			5	Vgap1	300
6	Vagp1	410
			7	Varo80	1240
8	Vcat8	2550

(5) Screening of high producing strains from recombinant strain libraries

Monoclonal colonies of the recombinant bacterial library were selected from YPD agar plates containing G418 geneticin, and inoculated into 96-well plates for primary screening. A96-well plate is used as a culture carrier, 200 mu L of culture medium is added into each well, and the culture is performed for 48h at 30 ℃ and 150rpm with shaking. The culture medium comprises the following components: 10g/L of yeast extract, 60g/L of glucose, 8g/L of phenylalanine, 0.5g/L of monopotassium phosphate and 0.5g/L of magnesium sulfate. A total of 384 monoclonal colonies, 4X 96, were selected from the plate for this preliminary screening, cultured in a 96-well plate, and the 2-phenylethyl alcohol yield was determined by HPLC sampling. Among them, the production amount of 2-phenylethyl alcohol from 48 strains having the highest growth rate (measured by OD570 turbidity method) is shown in FIG. 4; among these, the yields of 2-phenylethyl alcohol from 48 strains having the lowest growth rate (measured by OD570 turbidity method) are shown in FIG. 5. The results show that the yield of a small number of strains is obviously higher than the average level, and meanwhile, the yield is obviously reduced due to the mismatching of recombinant expression genes of part of strains.

Then, 48 strains with the highest yield among 384 single clones in the primary screening are selected for the first round of re-screening. The first round of re-screening method comprises the following steps: and (3) transferring the selected 48 monoclonal strains with the highest yield into a 24-well plate, adding 1mL of culture medium, and culturing for 16h, wherein the formula of the culture medium and the culture conditions are consistent with those of the primary screening. The content of 2-phenylethyl alcohol was measured by HPLC, and the measurement results are shown in fig. 6. Among them, 5 recombinant strains with the highest 2-phenylethyl alcohol yield (FIG. 6, hollow bar column) were selected for the second round of rescreening.

And the second round of re-screening tests the yield of the 2-phenethyl alcohol of the strain by adopting a shake flask fermentation mode. And (3) transferring the 5 strains with the highest yield selected in the first round of re-screening into a 250mL shaking flask for shake culture, wherein the liquid loading amount is 50mL, and shake fermentation is carried out for 24 hours at 200rpm by adopting a synthetic culture medium at 30 ℃. The culture medium comprises 6.7g/L YNB yeast nitrogen source, 60g/L glucose, 8g/L phenylalanine, 0.5g/L potassium dihydrogen phosphate, 0.5g/L magnesium sulfate, and natural pH. The results of the first round of re-screening the strains in the shake flask for 48H are shown in FIG. 7, and the 2-phenylethyl alcohol yield of 5 recombinant strains is higher than that of the control (original BSH-H9).

(6) Identification of free expression plasmids in 5 recombinant strains

According to the screening results, 5 recombinant strains (colony2, colony4, colony10, colony17 and colony18) which were obtained in the second round of rescreening and confirmed to have significantly improved yields were cultured in YPD medium containing G418 at a concentration of 300. mu.g/mL for 24 hours (30 ℃), and free expression plasmids contained in the 5 recombinant strains were extracted, respectively (Yeast Plasmid Mini Preparation Kit (Yeast Plasmid Preparation Kit) produced by Biyunshi Biotechnology research was used, and the method described in the specification was used). Then, the plasmids extracted from 5 strains were used as templates, the CPGK1p-F listed in Table 2 in step (4) of this example was used as an upstream primer, and the identification primers for each gene listed in Table 2 were used as downstream primers (Caro8-R, Caro9-R, Caro10-R, Caro80-R, Csfa1-R, Cgap1-R, Cagp1-R, Ccat8-R), respectively, and amplification and identification were carried out by PCR. The results of gel electrophoresis of the PCR products are shown in FIG. 8.

FIG. 8 the results of electrophoresis show that: detecting free expression plasmids carrying aro8 in recombinant strains colony2, colony4, colony17 and colony 18; free expression plasmids carrying aro9 were detected in all strains colony2, colony4, colony17, and colony 18; free expression plasmids of aro10 were detected in both strains colony17 and colony 18; free expression plasmids containing sfa1 were detected in both strain colony10 and strain colony 18; meanwhile, free expression plasmids containing genes of gap1, agp1, aro80 and cat8 are not detected in 5 high-yield recombinant strains including strains colony2, colony4, colony10, colony17 and colony 18. No free expression plasmid was detected in the control strain BSH-H9. The results show that the fragments of aro8, aro9, aro10 and sfa1 in tandem with the PGK1 promoter can be detected in the five recombinant strains with the highest yield confirmed in the second round of re-screening, but the fragments of gap1, agp1, aro80 and cat8 in tandem with the PGK1 promoter are not detected. Thus, it was shown that aro8, aro9, aro10, sfa1 genes and a reasonable combination of the above four genes are key genes for increasing the 2-phenylethyl alcohol yield of the host wild-type s.cerevisiae BSH-H9 with a high probability, while the gap1, agp1, aro80, cat8 genes and their combinations were not significant for increasing the 2-phenylethyl alcohol yield of strain BSH-H9 strain. Therefore, through random transformation and expression and 3 rounds of screening, the key gene which is really matched with host thalli and can significantly influence the improvement of the yield of the 2-phenethyl alcohol can be found from a plurality of candidate genes.

Example 2 Rapid construction of high-yield 2-Phenylethanolic engineering strains

Based on the experimental results of example 1, it was confirmed that aro8, aro9, aro10, sfa1 and combinations thereof are key genes for increasing the production of 2-phenylethyl alcohol from BSH-H9 strain, and in order to construct a genetically stable 2-phenylethyl alcohol-producing strain, it is necessary to integrate the above 4 key genes into the genome of BSH-H9 strain in their most suitable combinations and expression ratios. This example uses a Crispr/Cas 9-mediated delta site integration protocol, with the Crispr/Cas9 tool plasmid being pCAS. The workflow of genomic integration using pCAS plasmid has been described in detail in the open literature Expresses S.physiology Cas9 plus an HDV ribozyme-sgRNA for genome integration in year (eLife.2014; 3: e03703, doi: 10.7554/eLife.03703), and the specific implementation in this example is as follows:

(1) delta site sgRNA fragment inserted into pCAS plasmid

The vector using the pCAS Plasmid as the sgRNA (from Addgene, Plasmid No. #60847, see http:// www.addgene.org /) was used. Circular extension PCR cloning (Circular polymerase extension cloning, the principle and process of the method are described in detail in PLoS one.2009; 4(7): e 6441; doi: 10.1371/joural. pane. 0006441) is carried out by taking plasmid pCAS as a template and delta-gRNA-F and delta-gRNA-R as primers. The PCR was performed by NEB

High-Fidelity PCR Kit, the PCR reaction conditions are as follows: maintaining at 98 deg.C for 1 min; then three-stage circulation is carried out (30 s is kept at 98 ℃, 1min is kept at 58 ℃, 10min is kept at 72 ℃ and 30 times of total circulation is carried out); then keeping the temperature at 72 ℃ for 10 min; finally, the temperature is reduced to 4 ℃ to finish the reaction. The gene sequences of the primers delta-gRNA-F and delta-gRNA-R are shown as follows, and the primers contain specific sgRNA sequences with delta site breakage of a yeast genome: 5' -GGAACTGTCATCGAAGTTAG-3.

delta-gRNA-F：CGGGTGGCGAATGGGACTTTGGAACTGTCATCGAAGTTAGGTTTTAGAGCTAGAAATAGC，

delta-gRNA-R：GCTATTTCTAGCTCTAAAACCTAACTTCGATGACAGTTCCAAAGTCCCATTCGCCACCCG。

The PCR product was digested with the restriction enzyme DpnI for 6h, the digested product was transformed into competent E.coli DH5 α, and plated on an LB plate containing 50. mu.g/mL kanamycin to isolate a single clone. 5 monoclonals are picked for sequencing, the sequencing is verified to be correct, the constructed plasmid is stored, and the obtained plasmid is newly named pCd 5.

(2) Amplification of Gene expression cassettes requiring overexpression

According to the experimental screening results of example 1, aro8, aro9, aro10, sfa1 and the gene combinations thereof are key genes of BSH-H9 strain for increasing the production of 2-phenylethyl alcohol. 4 gene fragments to be detected (aro8, aro9, aro10 and sfa1) which are cloned in the step of cloning key enzyme and regulatory gene in the step (2) in the embodiment 1 of the application and have the promoter PGK1 and CYC1 terminators at two ends are respectively used as PCR templates, and primer pairs deltaHR-F and deltaHR-R containing a saccharomyces cerevisiae genome delta sequence homology arm are designed for PCR amplification. PCR Using NEB

The conditions for carrying out the PCR reaction by the High-Fidelity PCR Kit are as follows: maintaining at 98 deg.C for 1 min; then three-stage circulation is carried out (30 s is kept at 98 ℃, 1min is kept at 58 ℃, 10min is kept at 72 ℃ and 30 times of total circulation is carried out); then keeping the temperature at 72 ℃ for 10 min; finally, the temperature is reduced to 4 ℃ to finish the reaction. The primers deltaHR-F and deltaHR-R are as follows:

deltaHR-F：ACTACCAATATATTATCATATACGGTGTTAGACGATGACATAAGATACGAactgtaattgctttta gttgtg；

deltaHR-R：TTATTCCTCATTCCGTTTTATATGTTTCATTATCCTATTACATTATCAATaaattaaagccttcga gcg。

through respective PCR amplification, gene segments which simultaneously contain a saccharomyces cerevisiae genome delta sequence homology arm and a gene expression frame to be expressed are obtained and are respectively named as PGK1p-aro8-CYC1t, PGK1p-aro9-CYC1t, PGK1p-aro10-CYC1tPGK1p-sfa1-CYC1 t. The fragment length of 4 PCR products in total, namely PGK1p-aro8-CYC1t, PGK1p-aro9-CYC1t, PGK1p-aro10-CYC1t and PGK1p-sfa1-CYC1t, are verified by gel electrophoresis. The results of gel electrophoresis are shown in FIG. 9, and the lengths of the DNA fragments of Donor were designed as shown in Table 4. The fragment size obtained was consistent with the expected results. By using a special agarose gel DNA recovery kit GK2043-50 for scientific research of Shanghai Czeri bioengineering GmbH, cutting gel according to the gel recovery method described in the specification, recovering PCR products, storing for later use, and taking the PCR products as Donor DNA when key genes aro8, aro9, aro10 and sfa1 are integrated and expressed in the next step.

Table 4 lengths of the Donor DNAs designed

No.	Fragments	Size(bp)
			1	PGK1p-aro8-CYClt	2639
2	PGK1p-aro9-CYC1t	2678
			3	PGK1p-sfa1-CYC1t	2297
4	PGK1p-aro10-CYC1t	3044

(3) Random integration of delta sites for 4 key genes

After 4 kinds of Donor DNA (i.e. PGK1p-aro8-CYC1t, PGK1p-aro9-CYC1t, PGK1p-aro10-CYC1 and PGK1p-sfa1-CYC1t) constructed in the step (2) of this example were mixed, Saccharomyces cerevisiae BSH-H9 strain was transformed by electrotransformation together with the pCd5 constructed in the step (1). The electrotransformation conditions were the same as those of the electrotransformation protocol and conditions described in the (3) th step of example 1. Then, the bacteria liquid after the electric conversion is divided into two parts: a portion of the dilution was plated on YPD agar plates containing G418 geneticin resistance (300. mu.g/mL) to isolate individual transformant colonies. The other part of the culture solution is directly added into YPD liquid culture medium containing G418 geneticin resistance (300 mu G/mL), and shake culture is carried out for 72h at 30 ℃ for obtaining a recombinant bacteria library mixed with all different transformants.

The total genomic DNA of a recombinant bacterial library mixed with all different transformants was extracted using a yeast genomic DNA extraction kit (Shanghai Czeri bioengineering Co., Ltd., GK1901) according to the genomic DNA extraction method described in the specification. According to the PCR identification method described in "identification of recombinant strain library as described in step (4) of example 1", the genome of the strain library was identified using CPGK1p-F in Table 2 as an upstream primer, Caro8-R, Caro9-R, Caro10-R, Csfa1-R in Table 2 as a downstream primer, and the total genomic DNA of the extracted recombinant strain library mixed with all the different transformants as a PCR template. The results of gel electrophoresis of the PCR products of the total genomic DNA of the recombinant bacterial library are shown in fig. 10, and the results show that four genes aro8, aro9, aro10 and sfa1 in the total genomic DNA of the recombinant bacterial library can be detected, which means that the gene expression cassettes of the four genes aro8, aro9, aro10 and sfa1 have been successfully integrated into the genome of a certain strain or several transformants in the recombinant bacterial library.

(4) Screening of integration expression Strain libraries

Single colonies of transformants which integrated the library of the expression recombinant bacteria isolated on YPD agar plates resistant to G418 geneticin (300. mu.g/mL) were picked. In the first round of screening, single colonies of 1056 transformants are selected in total and inoculated into 11 groups of wells of a 96-well plate for culture, 300 mu L of composite culture medium is added into each well for fermentation (the culture medium is 10g/L of yeast extract, 60g/L of glucose, 8g/L of phenylalanine, 0.5g/L of potassium dihydrogen phosphate, 0.5g/L of magnesium sulfate and pH is 6.5), shaking fermentation is carried out at 30 ℃ for 40h, and sampling is carried out to detect the content of 2-phenethyl alcohol by HPLC. The phenylethanol yield of the 1056 strain screened in the first round is shown in fig. 11, and since the types and copy numbers of the genes integrated on the genomes of different transformants are random, the types, numbers and expression ratios of the genes integrated by different transformants have differences, so that the adaptation level of the transformants to the host has larger difference, and the actual yield of the 2-phenylethanol among the 1056 strains has difference.

The 95 strains with the highest 2-phenylethyl alcohol yield were selected from the transformants obtained in the first round of selection and subjected to the second round of selection, the selection method was the same as that in the first round, and the results of 2-phenylethyl alcohol yield were shown in FIG. 12 (96 strains in total, wherein the strains numbered 1 to 95 were transformants; the strain numbered 96 was a control group BSH-H9, and the rightmost light-colored bar column was indicated). The results show that the yield of 2-phenethyl alcohol of partial strains is obviously higher than that of the control group, while the yield of 2-phenethyl alcohol of partial recombinant strains is lower than that of the control group. The second round of selection was performed on the 10 strains with the highest 2-phenylethyl alcohol yield (FIG. 12, light bar bars) for the third round of shake flask selection.

The third round of screening adopts a shaking culture mode, strains are transferred to an SC complete culture medium and are subjected to shaking culture in a shaking flask of 250mL (the liquid loading is 50mL, the temperature is 30 ℃, the rpm is 200, and the time is 24 hours). The SC complete culture medium comprises the following components: 6.7g/L YNB yeast nitrogen source, 60g/L glucose, 8g/L phenylalanine, 0.5g/L monopotassium phosphate, 0.5g/L magnesium sulfate. The fermentation results are shown in FIG. 13, and the yield of 10 strains is higher than that of the original strain BSH-H9. Wherein the strain with the serial number of 978 (H9-978) has the highest phenethyl alcohol yield and is named as the saccharomyces cerevisiae CFFSH-006 strain (deposited in 2018, 10 and 15 days and China center for type culture Collection, CCTCC NO: M2018669).

Example 3 production of 2-Phenylethanol Using the Strain Saccharomyces cerevisiae CFFSH-006

The fermentation medium used in this example was: 60g/L of sucrose, 35g/L of yeast extract powder, 0.5g/L of magnesium sulfate and 4g/L, L g/L of monopotassium phosphate-8 g/L of phenylalanine. The fermentation process comprises the steps of inoculating the saccharomyces cerevisiae CFFSH-006 in a 250mL shake flask filled with 50mL of fermentation medium, shaking and fermenting for 72 hours (30 ℃, 200rpm) in a constant temperature shaking table, detecting the yield of 2-phenethyl alcohol by HPLC, and measuring that the concentration of the 2-phenethyl alcohol of the strain saccharomyces cerevisiae CFFSH-006 is 3.85g/L by fermentation at the shake flask level.

Example 4 production of 2-phenylethyl alcohol by Saccharomyces cerevisiae CFFSH-006 in an in situ separation fermentation Process

The in-situ separation method is a common means for enlarging industrial production by fermenting 2-phenethyl alcohol. This example is in accordance with the publication "An aqueous-organic two-phase reagents for efficacy production of the natural aromatic chemicals 2-phenolethane and 2-phenolacetate with the term" in Etschmann, M.M.W.&A fermentation method of a two-phase in situ separation system disclosed by Schrader, J.appl Microbiol Biotechnol (2006)71:440.https:// doi.org/10.1007/s00253-005-0281-6) takes CFFSH-006 as a fermentation strain to establish a fermentation scheme. The detailed fermentation scheme is as follows: the liquid medium used in this example was prepared by using 60g/L molasses (73% of which was glucose and 27% of which was sucrose) as a carbon source, and adding 6.2g/L KH₂PO₄、0.8g/L K₂HPO₄50g/L L-phenylalanine; the mixture was added in a 10L fermenter at a volume ratio of 1: 1. The saccharomyces cerevisiae CFFSH-006 strain is firstly inoculated to a shake flask filled with a YPD culture medium and is shake-cultured for 18 hours to be used as a seed liquid. Then inoculating into the fermentation tank with 6% (v/v) of inoculum size, and adding glucose solution (with sugar concentration of 600g/L) at a flow rate of 10mL/h after 18h during fermentation. And (4) finishing fermentation when the fermentation time reaches 66h, sampling, and measuring the content of the 2-phenethyl alcohol in the fermentation liquor by using HPLC (detection at 210nm, C-18 column). The results show that the volume yield (Product related to total volume) of 2-phenylethyl alcohol under the experimental conditions reaches 26g/L, which is far more than the production capacity of the strains K.marxianus CBS 600 and S.cerevisiae Giv 2009 in the reference.

Example 5 production of 2-phenylethyl alcohol by Saccharomyces cerevisiae CFFSH-006 in situ separation fermentation Process

The large amount of low 2-phenylethyl alcohol tolerance and high cost in-situ separation material (such as PPG1500, macroporous adsorption resin) is an important factor for restricting the industrialization of 2-phenylethyl alcohol fermentation production. The reduction of the use of in-situ separation materials in the expensive in-situ separation process is the key to realizing the industrial production of the 2-phenethyl alcohol and reducing the cost. This example examines the 2-phenylethyl alcohol yield of the strain Saccharomyces cerevisiae CFFSH-006 with a greatly reduced amount of in situ separation material. The fermentation was carried out under the experimental conditions described in example 4, the only experimental conditions in this example differing from example 4 were a change of the volume ratio of the medium to polypropylene glycol 1500(PPG1500) to 7:1, i.e.medium 7L, PPG 15001L. The fermentation process curve is shown in FIG. 14.

The result shows that the saccharomyces cerevisiae CFFSH-006 can maintain higher production intensity under the condition of greatly reducing the usage amount of the polypropylene glycol, the total volume yield (Product related to total volume) reaches 18.4g/L, and the conversion efficiency of the L-phenylalanine is 78%. The result shows that the saccharomyces cerevisiae CFFSH-006 strain has a very good industrial application prospect, and the use cost of in-situ separation materials in the production process of 2-phenethyl alcohol can be greatly reduced.

Example 6 identification of genes contained in the genome of Saccharomyces cerevisiae CFFSH-006

The genomic DNAs of the original strain BSH-H9 and CFFSH-006 were extracted using a yeast genomic DNA extraction kit (GK 1901, Czeri bioengineering, Inc., Shanghai) according to the genomic DNA extraction method described in the specification. According to the PCR identification method described in "identification of recombinant strain library in step (4) of example 1", the PCR identification was performed using CPGK1p-F in Table 2 as an upstream primer, Caro8-R, Caro9-R, Caro10-R, Csfa1-R in Table 2 as a downstream primer, and genomes of BSH-H9 and CFFSH-006 as PCR templates. The results of gel electrophoresis of the PCR products are shown in FIG. 15.

The results showed that no gene expression cassette was detected in the BSH-H9 genome, and that a gene expression cassette containing aro8 (PGK1p-aro8-CYC1t) and aro10 (PGK1p-aro10-CYC1t) was detected in CFFSH-006.

Example 7 expression of Key genes in other yeasts

It was confirmed by example 1 that aro8, aro9, aro10, sfa1, and combinations thereof are key genes for increasing the production of 2-phenylethyl alcohol from BSH-H9 strain. In order to verify that the four key genes aro8, aro9, aro10 and sfa1 and the combination thereof are also key genes for the yield of 2-phenylethyl alcohol of other saccharomyces cerevisiae strains, the 4 key genes need to be integrated on the genome of the strain to be adapted in the most appropriate combination mode and expression ratio.

In this example, a recombinant strain library was obtained by the integrated expression method described in example 2 using a commercially available model strain S.cerevisiae CEN.PK 2-1C as a host strain (EUR 0SCARF culture Collection, Germany). The specific results in this example are as follows:

the results of gel electrophoresis of PCR products of total genomic DNA of a randomly integrated recombinant bacterial library of 4 key genes constructed according to the method described in example 2 are shown in FIG. 16. The results show that four genes aro8, aro9, aro10 and sfa1 in the total genomic DNA of the recombinant bacteria library can be detected, which means that the gene expression cassettes of the four genes aro8, aro9, aro10 and sfa1 are successfully integrated into the genome of a certain strain or a certain number of transformants in the recombinant bacteria library.

The procedure was followed as described in (4) in example 2. The phenylethanol yield results of the 48 strains obtained in the first round of screening are shown in FIG. 17 (48 strains in total, 6 strains with higher yield are indicated by diagonal bars). Because the types and copy numbers of the integrated genes on the genomes of different transformants are random, the types, the numbers and the expression ratios of the integrated genes of different transformants have difference, so that the adaptation level of the transformants and the host has larger difference, and the actual yield of the 2-phenylethyl alcohol among 48 transformants has difference.

The 6 strains with the highest 2-phenylethyl alcohol yield from the transformants obtained in the first round of selection were selected for the second round of selection, the selection method was the same as that in the first round, the results of 2-phenylethyl alcohol yield were shown in fig. 18, and the control group (s. cerevisiae CEN. pk 2-1C, abbreviated as CEN) was marked with an oblique bar. The result shows that the yield of the recombinant strain 2-phenethyl alcohol is obviously several times higher than that of the control group.

The results indicate that the key genes identified with the BSH-H9 strain as the host strain are equally applicable to other yeast strains. By adopting the random integration scheme provided by the patent application, the high-yield saccharomyces cerevisiae engineering strain can be quickly obtained, and the optimal matching of the expression ratio of multiple genes and the combination mode can be quickly achieved.

Sequence listing

<110> Boston (Shanghai) Biotechnology Ltd

<120> genetic engineering bacterium and construction method and application thereof

<130> MP1828951

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4005

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtcgactttc cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca 60

gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct 120

cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc 180

gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt 240

tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc 300

cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc 360

cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg 420

gtggcctaac tacggctaca ctagaaggac agtatttggt atctgcgctc tgctgaagcc 480

agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag 540

cggtggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga 600

tcctttgatc ttttctacac tagtcgaagc atctgtgctt cattttgtag aacaaaaatg 660

caacgcgaga gcgctaattt ttcaaacaaa gaatctgagc tgcattttta cagaacagaa 720

atgcaacgcg aaagcgctat tttaccaacg aagaatctgt gcttcatttt tgtaaaacaa 780

aaatgcaacg cgagagcgct aatttttcaa acaaagaatc tgagctgcat ttttacagaa 840

cagaaatgca acgcgagagc gctattttac caacaaagaa tctatacttc ttttttgttc 900

tacaaaaatg catcccgaga gcgctatttt tctaacaaag catcttagat tacttttttt 960

ctcctttgtg cgctctataa tgcagtctct tgataacttt ttgcactgta ggtccgttaa 1020

ggttagaaga aggctacttt ggtgtctatt ttctcttcca taaaaaaagc ctgactccac 1080

ttcccgcgtt tactgattac tagcgaagct gcgggtgcat tttttcaaga taaaggcatc 1140

cccgattata ttctataccg atgtggattg cgcatacttt gtgaacagaa agtgatagcg 1200

ttgatgattc ttcattggtc agaaaattat gaacggtttc ttctattttg tctctatata 1260

ctacgtatag gaaatgttta cattttcgta ttgttttcga ttcactctat gaatagttct 1320

tactacaatt tttttgtcta aagagtaata ctagagataa acataaaaaa tgtagaggtc 1380

gagtttagat gcaagttcaa ggagcgaaag gtggatgggt aggttatata gggatatagc 1440

acagagatat atagcaaaga gatacttttg agcaatgttt gtggaagcgg tattcgcaat 1500

gagctcgaca tggaggccca gaataccctc cttgacagtc ttgacgtgcg cagctcaggg 1560

gcatgatgtg actgtcgccc gtacatttag cccatacatc cccatgtata atcatttgca 1620

tccatacatt ttgatggccg cacggcgcga agcaaaaatt acggctcctc gctgcagacc 1680

tgcgagcagg gaaacgctcc cctcacagac gcgttgaatt gtccccacgc cgcgcccctg 1740

tagagaaata taaaaggtta ggatttgcca ctgaggttct tctttcatat acttcctttt 1800

aaaatcttgc taggatacag ttctcacatc acatccgaac ataaacaacc atgggtaagg 1860

aaaagactca cgtttcgagg ccgcgattaa attccaacat ggatgctgat ttatatgggt 1920

ataaatgggc tcgcgataat gtcgggcaat caggtgcgac aatctatcga ttgtatggga 1980

agcccgatgc gccagagttg tttctgaaac atggcaaagg tagcgttgcc aatgatgtta 2040

cagatgagat ggtcagacta aactggctga cggaatttat gcctcttccg accatcaagc 2100

attttatccg tactcctgat gatgcatggt tactcaccac tgcgatcccc ggcaaaacag 2160

cattccaggt attagaagaa tatcctgatt caggtgaaaa tattgttgat gcgctggcag 2220

tgttcctgcg ccggttgcat tcgattcctg tttgtaattg tccttttaac agcgatcgcg 2280

tatttcgtct cgctcaggcg caatcacgaa tgaataacgg tttggttgat gcgagtgatt 2340

ttgatgacga gcgtaatggc tggcctgttg aacaagtctg gaaagaaatg cataagcttt 2400

tgccattctc accggattca gtcgtcactc atggtgattt ctcacttgat aaccttattt 2460

ttgacgaggg gaaattaata ggttgtattg atgttggacg agtcggaatc gcagaccgat 2520

accaggatct tgccatccta tggaactgcc tcggtgagtt ttctccttca ttacagaaac 2580

ggctttttca aaaatatggt attgataatc ctgatatgaa taaattgcag tttcatttga 2640

tgctcgatga gtttttctaa tcagtactga caataaaaag attcttgttt tcaagaactt 2700

gtcatttgta tagttttttt atattgtagt tgttctattt taatcaaatg ttagcgtgat 2760

ttatattttt tttcgcctcg acatcatctg cccagatgcg aagttaagtg cgcagaaagt 2820

aatatcatgc gtcaatcgta tgtgaatgct ggtcgctata ctgctcgaga ctgtaattgc 2880

ttttagttgt gtatttttag tgtgcaagtt tctgtaaatc gattaatttt tttttctttc 2940

ctctttttat taaccttaat ttttatttta gattcctgac ttcaactcaa gacgcacaga 3000

tattataaca tctgcataat aggcatttgc aagaattact cgtgagtaag gaaagagtga 3060

ggaactatcg catacctgca tttaaagatg ccgatttggg cgcgaatcct ttattttggc 3120

ttcaccctca tactattatc agggccagaa aaaggaagtg tttccctcct tcttgaattg 3180

atgttaccct cataaagcac gtggcctctt atcgagaaag aaattaccgt cgctcgtgat 3240

ttgtttgcaa aaagaacaaa actgaaaaaa cccagacacg ctcgacttcc tgtcttccta 3300

ttgattgcag cttccaattt cgtcacacaa caaggtccta gcgacggctc acaggttttg 3360

taacaagcaa tcgaaggttc tggaatggcg ggaaagggtt tagtaccaca tgctatgatg 3420

cccactgtga tctccagagc aaagttcgtt cgatcgtact gttactctct ctctttcaaa 3480

cagaattgtc cgaatcgtgt gacaacaaca gcctgttctc acacactctt ttcttctaac 3540

caagggggtg gtttagttta gtagaacctc gtgaaactta catttacata tatataaact 3600

tgcataaatt ggtcaatgca agaaatacat atttggtctt ttctaattcg tagtttttca 3660

agttcttaga tgctttcttt ttctcttttt tacagatcat caaggaagta attatctact 3720

ttttacaaca aatataaaac agatggggga tccactagtg tcatgtaatt agttatgtca 3780

cgcttacatt cacgccctcc ccccacatcc gctctaaccg aaaaggaagg agttagacaa 3840

cctgaagtct aggtccctat ttattttttt atagttatgt tagtattaag aacgttattt 3900

atatttcaaa tttttctttt ttttctgtac agacgcgtgt acgcatgtaa cattatactg 3960

aaaaccttgc ttgagaaggt tttgggacgc tcgaaggctt taatt 4005

<210> 2

<211> 1503

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgactttac ctgaatcaaa agacttttct tacttgtttt cggatgaaac caatgctcgt 60

aaaccatccc cattgaaaac ctgcatccat cttttccaag atcctaacat tatctttttg 120

ggtggtggcc tgccattaaa agattatttc ccatgggata atctatctgt agattcaccc 180

aagcctcctt ttccccaggg tattggagct ccaattgacg agcagaattg cataaaatac 240

accgtcaaca aagattacgc tgataaaagt gccaatcctt ccaacgatat tcctttgtca 300

agagctttgc aatacgggtt cagtgctggt caacctgaac tattaaactt cattagagat 360

cataccaaga ttatccatga tttgaagtat aaggactggg acgttttagc cactgcaggt 420

aacacaaatg cctgggaatc tactttaaga gtcttttgta accgaggtga tgtcatctta 480

gttgaggcac attctttttc ctcttcattg gcttctgcag aggctcaagg tgtcattacc 540

ttccccgtgc caattgacgc tgatggtatc attcctgaaa aattagctaa agtcatggaa 600

aactggacac ctggtgctcc taaaccaaag ttgttataca ctattccaac gggccaaaat 660

ccaactggta cttccattgc agaccataga aaggaggcaa tttacaagat cgctcaaaag 720

tacgacttcc taattgtgga agatgaacct tattatttct tacaaatgaa tccctacatc 780

aaagacttga aggaaagaga gaaggcacaa agttctccaa agcaggacca tgacgaattt 840

ttgaagtcct tggcaaacac tttcctttcc ttggatacag aaggccgtgt tattagaatg 900

gattcctttt caaaagtttt ggccccaggg acaagattgg gttggattac tggttcatcc 960

aaaatcttga agccttactt gagtttgcat gaaatgacga ttcaagcccc agcaggtttt 1020

acacaagttt tggtcaacgc tacgctatcc aggtggggtc aaaagggtta cttggactgg 1080

ttgcttggcc tgcgtcatga atacactttg aaacgtgact gtgccatcga tgccctttac 1140

cagtatctac cacaatctga tgctttcgtg atcaatcctc caattgcagg tatgtttttc 1200

accgtgaaca ttgacgcatc tgtccaccct gagtttaaaa caaaatacaa ctcagaccct 1260

taccagctag aacagagtct ttaccacaaa gtggttgaac gtggtgtttt agtggttccc 1320

ggttcttggt tcaagagtga gggtgagacg gaacctcctc aacccgctga atctaaagaa 1380

gtcagtaatc caaacataat tttcttcaga ggtacctatg cagctgtctc tcctgagaaa 1440

ctgactgaag gtctgaagag attaggtgat actttatacg aagaatttgg tatttccaaa 1500

tag 1503

<210> 3

<211> 1542

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgactgctg gttctgtccc ccctgttgat tacgcttcct taaagaagaa cttccaaccg 60

tttctctcca gaagagtaga aaatagatct ctgaaaagct tttgggatgc ttctgacatc 120

tcagatgacg tcattgagct agctggtgga atgccaaacg agagattttt tcctatcgaa 180

tctatggatt tgaaaatatc aaaagttcct tttaatgata acccaaaatg gcatgattcg 240

tttaccacgg cgcatttgga cttgggatcc cccagtgagc tacccattgc acgttctttc 300

caatacgcag aaaccaaggg tttaccccct ctcttacatt ttgttaaaga ttttgtgtcc 360

agaattaatc gcccagcctt ttccgatgag acggagtcta actgggatgt catcctttct 420

ggcgggtcca acgattcaat gtttaaggtt tttgaaacaa tttgcgacga atcaaccact 480

gtgatgattg aagagtttac tttcaccccg gctatgtcca atgtggaggc tacaggagca 540

aaagtcatcc ccatcaagat gaacctgacc ttcgacagag agtcccaggg tattgatgtc 600

gaatatctaa cccagttgct cgataattgg tcaactggac catacaaaga cttaaacaag 660

ccaagggtcc tatataccat tgcaacgggc caaaatccta ccgggatgtc tgtccctcag 720

tggaaaagag agaaaattta ccagttggcc caaagacacg atttcctcat tgttgaagat 780

gatccctacg gttatctgta ctttccttcc tataatccgc aagagccatt agaaaaccct 840

taccattcta gcgacctgac tactgaacgg tatttgaatg attttttaat gaaatcattc 900

ttgactttgg atacagatgc ccgtgtcatc cgtttggaga ctttttctaa aatttttgct 960

cctggattaa ggttatcctt catcgttgct aataaattcc ttttgcaaaa aatcttggat 1020

ttggccgaca ttactacaag ggcccccagt ggtacctcac aagctattgt ttattctaca 1080

ataaaggcaa tggctgagtc caacttatcg tcctctcttt ctatgaaaga agcaatgttt 1140

gagggttgga taagatggat aatgcagatt gcttctaaat acaatcatag gaaaaatctt 1200

actttgaaag ccttatacga aacagaatct taccaagctg gtcagtttac cgttatggaa 1260

ccctccgcgg gtatgttcat cattattaaa atcaattggg ggaatttcga taggcctgac 1320

gatttgccgc aacagatgga tattttagat aagttcttgg tgaagaatgg tgttaaacta 1380

gtgcttggtt ataaaatggc tgtttgccca aattattcaa agcagaattc agattttcta 1440

agactcacca tcgcctatgc aagggatgat gatcagttga ttgaagcttc caaaagaatc 1500

ggtagtggca taaaagaatt ttttgacaac tataaaagtt ga 1542

<210> 4

<211> 1908

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atggcacctg ttacaattga aaagttcgta aatcaagaag aacgacacct tgtttccaac 60

cgatcagcaa caattccctt tggtgaatac atattcaaaa gattgttgtc catcgatacg 120

aaatcagttt tcggtgttcc tggtgacttc aacttatctc tattagaata tctctattca 180

cctagtgttg aatcagctgg cctaagatgg gtcggcacgt gtaatgaact gaacgccgct 240

tatgcggccg acggatattc ccgttactct aataagattg gctgtttaat aaccacgtat 300

ggcgttggtg aattaagcgc cttgaacggt atagccggtt cgttcgctga aaacgtcaaa 360

gttttgcaca ttgttggtgt ggccaagtcc atagattcgc gttcaagtaa ctttagtgat 420

cggaacctac atcatttggt cccacaacta catgattcaa attttaaagg gccaaatcat 480

aaagtatatc atgatatggt aaaagataga gtcgcttgct cggtagccta cttggaggat 540

attgaaactg catgtgacca agtcgataat gttatccgcg atatttacaa gtattctaaa 600

cctggttata tttttgttcc tgcagatttt gcggatatgt ctgttacatg tgataatttg 660

gttaatgttc cacgtatatc tcaacaagat tgtatagtat acccttctga aaaccaattg 720

tctgacataa tcaacaagat tactagttgg atatattcca gtaaaacacc tgcgatcctt 780

ggagacgtac tgactgatag gtatggtgtg agtaactttt tgaacaagct tatctgcaaa 840

actgggattt ggaatttttc cactgttatg ggaaaatctg taattgatga gtcaaaccca 900

acttatatgg gtcaatataa tggtaaagaa ggtttaaaac aagtctatga acattttgaa 960

ctgtgcgact tggtcttgca ttttggagtc gacatcaatg aaattaataa tgggcattat 1020

acttttactt ataaaccaaa tgctaaaatc attcaatttc acccgaatta tattcgcctt 1080

gtggacacta ggcagggcaa tgagcaaatg ttcaaaggaa tcaattttgc ccctatttta 1140

aaagaactat acaaacgcat tgacgtttct aaactttctt tgcaatatga ttcaaatgta 1200

actcaatata cgaacgaaac aatgcggtta gaagatccta ccaatggaca atcaagcatt 1260

attacacaag ttcacttaca aaagacgatg cctaaatttt tgaaccctgg tgatgttgtc 1320

gtttgtgaaa caggctcttt tcaattctct gttcgtgatt tcgcatttcc ttcgcagtta 1380

aaatatatat cgcaaggatt tttcctttcc attggcatgg cccttcctgc cgccctaggt 1440

gttggaattg ccatgcaaga ccactcaaac gctcacatca atggtggcaa cgtaaaagag 1500

gactataagc caagattaat tttgtttgaa ggtgacggtg cagcacagat gacaatccaa 1560

gaactgagca ccattctgaa gtgcaatatt ccactagaag ttatcatttg gaacaataac 1620

ggctacacta ttgaaagagc catcatgggc cccaccaggt cgtataacga cgttatgtct 1680

tggaaatgga ccaaactatt tgaagcattc ggagacttcg acggaaagta tactaatagc 1740

actctcattc aatgtccctc taaattagca ctgaaattgg aggagcttaa gaattcaaac 1800

aaaagaagcg ggatagaact tttagaagtc aaattaggcg aattggattt ccccgaacag 1860

ctaaagtgca tggttgaagc agcggcactt aaaagaaata aaaaatag 1908

<210> 5

<211> 1161

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgtccgccg ctactgttgg taaacctatt aagtgcattg ctgctgttgc gtatgatgcg 60

aagaaaccat taagtgttga agaaatcacg gtagacgccc caaaagcgca cgaagtacgt 120

atcaaaattg aatatactgc tgtatgccac actgatgcgt acactttatc aggctctgat 180

ccagaaggac ttttcccttg cgttctgggc cacgaaggag ccggtatcgt agaatctgta 240

ggcgatgatg tcataacagt taagcctggt gatcatgtta ttgctttgta cactgctgag 300

tgtggcaaat gtaagttctg tacttccggt aaaaccaact tatgtggtgc cgttagagct 360

actcaaggga aaggtgtaat gcctgatggg accacaagat ttcataatgc gaaaggtgaa 420

gatatatacc atttcatggg ttgctctact ttttccgaat atactgtggt ggcagatgtc 480

tctgtggttg ccatcgatcc aaaagctccc ttggatgctg cctgtttact gggttgtggt 540

gttactactg gttttggggc ggctcttaag acagctaatg tgcaaaaagg cgataccgtt 600

gcagtatttg gctgcgggac tgtaggactc tccgttatcc aaggtgcaaa gttaaggggc 660

gcttccaaga tcattgccat tgacattaac aataagaaaa aacaatattg ttctcaattt 720

ggtgccacgg attttgttaa tcccaaggaa gatttggcca aagatcaaac tatcgttgaa 780

aagttaattg aaatgactga tgggggtctg gattttactt ttgactgtac tggtaatacc 840

aaaattatga gagatgcttt ggaagcctgt cataaaggtt ggggtcaatc tattatcatt 900

ggtgtggctc ccgctggtgg agaaatttct acaaggccgt tccagctggt cactggtaga 960

gtgtggaaag gctctgcttt tggtggcatc aaaggtagat ctgaaatggg cggtttaatt 1020

aaagactatc aaaaaggtac cttaaaagtc gaagaattta tcactcacag gagaccattc 1080

aaagaaatca atcaagcctt tgaagatttg cataacggtg attgcttaag aaccgtcttg 1140

aagtctgatg aaataaaata g 1161

Claims

1. The genetically engineered bacterium is preserved in China Center for Type Culture Collection (CCTCC) with the preservation number of CCTCC NO: m2018669.

2. The use of the genetically engineered bacteria of claim 1 in the fermentative production of 2-phenylethyl alcohol.

3. A method for producing 2-phenylethyl alcohol, which uses L-phenylalanine as a substrate to produce 2-phenylethyl alcohol by utilizing the genetically engineered bacteria of claim 1 in a fermentation or cell catalysis mode.