CN112608936A - Promoter for regulating and controlling expression of yeast exogenous gene, regulation and control method and application thereof - Google Patents

Abstract

The invention provides a promoter for regulating and controlling yeast exogenous gene expression, a regulating and controlling method and application thereof. The invention modifies GAL regulation system in yeast, so as to achieve the purpose of controlling the gene expression controlled by GAL promoter in GAL regulation system by regulating the glucose concentration in fermentation liquor without galactose induction. The invention can achieve the purpose only by replacing the GAL80 promoter with the glucose-activated promoter HXT 1. The method is also used for regulating and controlling the biosynthesis of the saccharomyces cerevisiae beta-carotene, and the effectiveness of the regulating and controlling system is verified.

Description

Promoter for regulating and controlling expression of yeast exogenous gene, regulation and control method and application thereof

Technical Field

The invention belongs to the technical field of bioengineering, particularly relates to regulation and control of yeast gene expression, and more particularly relates to a method for improving a Gal regulation and control system in yeast.

Background

Yeast is an ideal material for genetic analysis and genetic engineering research, and has been deeply understood about the expression regulation pathways of many yeast genes. As a Generally Recognized as Safe microorganism (GRAS), Saccharomyces cerevisiae has been studied clearly in terms of its physiological, biochemical and genetic backgrounds, and genetic manipulation is relatively simple, so that it plays a very important role in recent synthetic biological and metabolic engineering research. In addition to the use of Saccharomyces cerevisiae to ferment ethanol to produce beer, it has become a common host for the synthesis of high value-added natural products.

In most studies, strong constitutive promoters are used for the expression of foreign genes in Saccharomyces cerevisiae, such as the commonly used pTEF1 promoter, pHXT7 promoter, pTDH3 promoter, pPGK1 promoter and the like (Partow, S., et al (2010). "mutagenesis of genetic promoters for identification a new expression vector in Saccharomyces cerevisiae" Yeast 27(11): 955-. The use of constitutive promoters has the disadvantages that the expression intensity is not controllable, excessive constitutive strong expression of genes or early expression causes metabolic burden of a host, influences the growth of cells and finally influences the total yield of target products. Therefore, the expression of foreign genes using inducible promoters is a common way to maximize cell productivity.

The most commonly used inducible expression system in s.cerevisiae is the s.cerevisiae galactose inducible system (GAL inducible system). In this system pGAL1, pGAL7, pGAL10, pGAL2 promoters are strictly inducible promoters whose transcriptional activation is regulated by the forward activation of GAL4 transcription factor, GAL4 transcription factor activity is inhibited by GAL80 negative regulatory protein, and GAL80 protein activity is regulated by galactose in the medium, and when galactose is present in the cell growth environment, galactose competes with GAL80 protein to release GAL4 transcription factor, GAL4 transcription factor further activates pGAL1, pGAL7, pGAL10 and pGAL2 promoters in the system (Pilauri, V., (2005.) transcription of "Gal80 transcription and the ye gene switch 169., (4) 1913). Thus, in the GAL regulatory system, galactose is an activator of the GAL promoter. However, galactose induction is not suitable for industrial use because galactose itself can be utilized by cells, the induction ability is reduced as galactose is utilized, and galactose is expensive, too high in cost, and antibiotic needs to be added.

Therefore, in the field of synthetic biology, the construction of a foreign gene expression method which is good in genetic stability, simple, high in sensitivity, low in cost and controllable in saccharomyces cerevisiae, is used for regulating and controlling saccharomyces cerevisiae to produce high value-added products, and is the direction of continuous efforts of researchers in the field.

Disclosure of Invention

The invention aims to solve the technical problem that the regulation and control of the expression of the exogenous gene in the yeast can not be simply, efficiently and controllably realized under the condition of not adding an expensive inducer in the prior art.

The present invention regulates the expression of foreign genes in yeast by genetically modifying yeast host species and/or altering culture conditions. In particular, the invention provides a yeast gene expression regulation and control system and a regulation and control method which are convenient, high in sensitivity, wide in regulation and control range and low in cost, and can be used for fermentation synthesis of products with high added values in yeast. By modifying the GAL regulation system in the yeast, the goal of strictly regulating and controlling the expression of the foreign gene can be achieved without adding galactose. In addition, in order to verify the feasibility of the regulation and control system and the regulation and control method, the regulation and control system and the regulation and control method are applied to the construction of the beta-carotene saccharomyces cerevisiae gene engineering bacteria, and the aim of high yield is fulfilled.

In a first aspect, the present invention provides a GAL regulatory system for expression of exogenous genes in yeast, wherein the GAL80 promoter is replaced with an HXT1 promoter.

In some embodiments, the GAL regulatory system further comprises a GAL promoter. Preferably, the exogenous gene is operably linked to the GAL promoter, which controls the expression of the exogenous gene.

The GAL promoter is a heterologous GAL promoter or a homologous GAL promoter.

In some embodiments, the GAL promoter is one or more promoters selected from GAL1, GAL7, GAL2, or GAL 10. The activity of the GAL1, GAL7, GAL2 or GAL10 promoter is activated depending on the binding to the transcription factor GAL4 protein, while the GAL80 protein can bind to the GAL4 protein to prevent the binding of the GAL4 protein to the GAL1, GAL7, GAL2 or GAL10 promoter. Therefore, the expression of the gene to be expressed under the GAL regulatory system can be achieved by operably linking the exogenous gene to be expressed with one or more promoters selected from GAL1, GAL7, GAL2 or GAL 10.

In some embodiments, the GAL10 gene, GAL1 gene, and GAL7 gene native to the GAL regulatory system are silenced, preferably the GAL10 gene, GAL1 gene, and GAL7 gene are knocked out.

In some embodiments, the yeast is saccharomyces cerevisiae.

In some embodiments, the HXT1 promoter has the nucleotide sequence shown in SEQ ID No.1 or a nucleotide sequence which is added, deleted, substituted by one or several bases but still has the same function as the nucleotide sequence shown in SEQ ID No. 1.

In some embodiments, the exogenous gene is a gene involved in the synthesis of terpenoids including, but not limited to, monoterpenes, sesquiterpenes, diterpenes, and the like, such as β -carotene, lutein, canthaxanthin, astaxanthin, lycopene, artemisinine, artemisinin, taxadiene, paclitaxel, dammarenediol, α -santalene, tanshinone, squalene, ginsenosides.

In a second aspect, the invention provides a yeast cell comprising a GAL regulatory system for expression of an exogenous gene, in which the GAL80 promoter is replaced with a HXT1 promoter.

In some embodiments, the GAL regulatory system further comprises a GAL promoter, such that the exogenous gene is expressed under the control of the GAL promoter. Preferably, the exogenous gene is operably linked to the GAL promoter to control expression of the exogenous gene.

The GAL promoter is a heterologous GAL promoter or a homologous GAL promoter.

In some embodiments, the GAL promoter is one or more promoters selected from GAL1, GAL7, GAL2, or GAL 10. The activity of the GAL1, GAL7, GAL2 or GAL10 promoter is activated depending on the binding to the transcription factor GAL4 protein, while the GAL80 protein can bind to the GAL4 protein to prevent the binding of the GAL4 protein to the GAL1, GAL7, GAL2 or GAL10 promoter. Therefore, the expression of the gene to be expressed under the GAL regulatory system can be achieved by operably linking the exogenous gene to be expressed with one or more promoters selected from GAL1, GAL7, GAL2 or GAL 10.

In some embodiments, the GAL10 gene, GAL1 gene, and GAL7 gene originally present in the yeast cell are silenced, preferably, the GAL10 gene, GAL1 gene, and GAL7 gene are knocked out. GAL10 (epimerase), GAL1 (kinase) and GAL7 (transferase) are three related enzymes used to convert galactose to glucose.

In some embodiments, the yeast is saccharomyces cerevisiae.

In some embodiments, the HXT1 promoter has the nucleotide sequence shown in SEQ ID No.1 or a nucleotide sequence which is added, deleted, substituted by one or several bases but still has the same function as the nucleotide sequence shown in SEQ ID No. 1.

Preferably, the yeast is YLK-pHXT1-BT2 strain which is classified and named HEC-YLK9I-07 and is preserved in China Center for Type Culture Collection (CCTCC) at 11/18/2020 with the address: the preservation number of the preservation center of Wuhan university in Wuhan, China is CCTCC M2020754.

In some embodiments, the exogenous gene is a gene involved in the synthesis of terpenoids including, but not limited to, monoterpenes, sesquiterpenes, diterpenes, and the like, such as β -carotene, lutein, canthaxanthin, astaxanthin, lycopene, artemisinine, artemisinin, taxadiene, paclitaxel, dammarenediol, α -santalene, tanshinone, squalene, ginsenosides.

Preferably, the exogenous gene is a gene involved in the synthesis of β -carotene.

In some embodiments, the beta-carotene synthesis pathway related gene is placed under GAL1, GAL7, GAL2 or GAL10 promoter (collectively referred to as GAL promoter) for expression, so that the control of glucose on the beta-carotene synthesis pathway gene expression can be realized, and the switch of the synthesis pathway can be controlled by regulating the glucose concentration in a culture system, thereby achieving the purpose of controlling the synthesis of metabolites.

In some embodiments, the tmgh 1 gene is operably linked to a pGAL1 promoter, the BtcrtE gene is operably linked to a GAL10 promoter, the btcryb gene is operably linked to a GAL1 promoter, and the BtcrtI gene is operably linked to a GAL10 promoter; and silencing the GAL1 gene, GAL7 gene, and GAL10 gene.

Similarly, the saccharomyces cerevisiae engineering bacteria can be used for fermentation to obtain other required products, and only genes related to biosynthesis of other target products need to be placed under the control of one or more promoters selected from GAL1, GAL7, GAL2 and GAL10 for expression. Preferably, the GAL1 gene, GAL7 gene, and GAL10 gene will be silenced. Also can realize that the GAL regulation system is organically combined with the glucose concentration in the culture system, and the high-efficiency expression of the exogenous gene can be perfectly realized without adding an inducer, thereby obtaining the required fermentation product.

In a third aspect, the present invention provides a method for regulating expression of a foreign gene in yeast, the method comprising replacing a GAL80 promoter with an HXT1 promoter in a GAL regulatory system.

In some embodiments, the method further comprises the step of placing the exogenous gene under the control of a GAL promoter. Preferably, the exogenous gene is operably linked to a GAL promoter.

The GAL promoter is a heterologous GAL promoter or a homologous GAL promoter.

In some embodiments, the GAL promoter is one or more promoters selected from GAL1, GAL7, GAL2, or GAL 10. The activity of the GAL1, GAL7, GAL2 or GAL10 promoter is activated depending on the binding to the transcription factor GAL4 protein, while the GAL80 protein can bind to the GAL4 protein to prevent the binding of the GAL4 protein to the GAL1, GAL7, GAL2 or GAL10 promoter. Therefore, the expression of the gene to be expressed under the GAL regulatory system can be achieved by operably linking the exogenous gene to be expressed with one or more promoters selected from GAL1, GAL7, GAL2 or GAL 10.

In some embodiments, the method further comprises the step of silencing the GAL10 gene, GAL1 gene, and GAL7 gene originally in the yeast cell, preferably wherein the silencing is by gene knockout.

In some embodiments, the yeast is saccharomyces cerevisiae.

In some embodiments, the HXT1 promoter has the nucleotide sequence shown in SEQ ID No.1 or a nucleotide sequence which is added, deleted, substituted by one or several bases but still has the same function as the nucleotide sequence shown in SEQ ID No. 1.

Preferably, the yeast is YLK-pHXT1-BT2 strain which is classified and named HEC-YLK9I-07 and is preserved in China Center for Type Culture Collection (CCTCC) at 11/18/2020 with the address: the preservation number of the preservation center of Wuhan university in Wuhan, China is CCTCC M2020754.

In some embodiments, the exogenous gene is a gene involved in the synthesis of terpenoids including, but not limited to, monoterpenes, sesquiterpenes, diterpenes, and the like, such as β -carotene, lutein, canthaxanthin, astaxanthin, lycopene, artemisinine, artemisinin, taxadiene, paclitaxel, dammarenediol, α -santalene, tanshinone, squalene, ginsenosides.

Preferably, the exogenous gene is a gene involved in the synthesis of β -carotene. The beta-carotene synthesis pathway related genes are placed under GAL1, GAL7, GAL2 or GAL10 promoters (collectively called GAL promoters) for expression, the control of glucose on the beta-carotene synthesis pathway gene expression can be realized, the switch of the synthesis pathway is controlled by regulating the concentration of glucose in a culture system, and the aim of controlling the synthesis of metabolites is fulfilled.

In some embodiments, the tmgh 1 gene is operably linked to a pGAL1 promoter, the BtcrtE gene is operably linked to a GAL10 promoter, the btcryb gene is operably linked to a GAL1 promoter, and the BtcrtI gene is operably linked to a GAL10 promoter; and silencing the GAL1 gene, GAL7 gene, and GAL10 gene.

In some embodiments, further comprising the step of adjusting the glucose concentration in the culture system. Preferably, the culture system is a fermentation broth. The GAL regulation system is organically combined with the glucose concentration in the culture system, and the high-efficiency expression of the exogenous gene can be perfectly realized without adding an inducer. The concentration of glucose in a culture system can be adjusted as required, so that the two processes of thallus growth and product accumulation can be perfectly separated, and organic connection is realized.

In some embodiments, the culture system has a higher pre-basal glucose concentration and a later product accumulation time, and organic separation of the two stages of bacterial growth and product expression can be achieved without the need for additional inducer. The higher the base glucose concentration, the relative lag in bacterial growth and product accumulation during the initial fermentation phase, but the yield of the target product is significantly better than the case of the lower level of base glucose.

In some embodiments, the initial concentration of glucose in the culture system is in the range of 1% to 15%, preferably in the range of 2% to 10%, more preferably 10%.

In the embodiment of the invention for fermenting beta-carotene by using the saccharomyces cerevisiae, as the initial glucose concentration is increased (2%, 4%, 6%, 8% and 10% respectively), the biomass of mycelium shows a linear growth trend, and the pigment yield and the unit OD pigment yield have a certain plateau within the range of 4% -8% glucose concentration, the yield is not obviously improved, but the pigment yield is obviously improved under the 10% glucose concentration, and the initial glucose concentration has a great influence on the accumulation of the final carotenoid.

Similarly, the desired product can be obtained by fermentation using the engineered strain of Saccharomyces cerevisiae of the second aspect by expressing the gene involved in the biosynthesis of the product under the control of one or more promoters selected from GAL1, GAL7, GAL2 and GAL 10. Preferably, the GAL1 gene, GAL7 gene, and GAL10 gene are silenced. Also can realize that the GAL regulation system is organically combined with the glucose concentration in the culture system, and the high-efficiency expression of the exogenous gene can be perfectly realized without adding an inducer, thereby obtaining the required fermentation product.

The culture conditions are not particularly limited, and may be batch culture, continuous culture, fed-batch culture, etc., with fed-batch culture being preferred.

In a fourth aspect, the invention provides the GAL regulatory system of the first aspect, and the use of a yeast cell of the second aspect in regulating expression of a foreign gene in yeast.

In a fifth aspect, the invention provides the GAL regulatory system of the first aspect, and the use of the yeast cell of the second aspect in the production of terpenoids, including but not limited to the synthesis of monoterpenes, sesquiterpenes, diterpenes and the like, such as β -carotene, lutein, canthaxanthin, astaxanthin, lycopene, artenadiene, artemisinin, taxadiene, paclitaxel, dammarenediol, α -santalene, tanshinones, squalene, ginsenosides.

The GAL80 gene promoter is replaced by an HXT1 promoter (glucose activated promoter), a GAL regulation system and the glucose concentration in a culture system are organically combined, the high-efficiency expression of exogenous genes can be perfectly realized without adding an inducer, and the two processes of thallus growth and product accumulation can be perfectly separated by controlling the glucose concentration in a fermentation system and organically linked.

The gene expression regulation and control mode is adopted and applied to the construction of the beta-carotene synthesis strain. By adopting the strain transformed by the method, the related genes of the synthetic pathway of the beta-carotene are put under GAL1, GAL7, GAL2 or GAL10 promoters (collectively called GAL promoters) for expression, the control of glucose on the gene expression of the synthetic pathway of the beta-carotene can be realized, the switch of the synthetic pathway is controlled by adjusting the concentration of glucose in a fermentation system, and the aim of controlling the synthesis of metabolites is fulfilled.

In the embodiment of the invention for fermenting beta-carotene by using the saccharomyces cerevisiae, as the initial glucose concentration is increased (2%, 4%, 6%, 8% and 10% respectively), the biomass of mycelium shows a linear growth trend, and the pigment yield and the unit OD pigment yield have a certain plateau within the range of 4% -8% glucose concentration, the yield is not obviously improved, but the pigment yield is obviously improved under the 10% glucose concentration, and the initial glucose concentration has a great influence on the accumulation of the final carotenoid.

According to the embodiment of the invention for fermenting beta-carotene by using the saccharomyces cerevisiae, the yield of the beta-carotene of the glucose inhibition regulation strain is the highest, the yield of the beta-carotene of the copper ion induction strain is the next highest, and the yield of the beta-carotene of the galactose induction strain is the lowest.

In a sixth aspect, the present invention provides a method for synthesizing β -carotene using yeast, comprising the step of producing β -carotene using the yeast cell of the second aspect by fermentation.

The GAL80 promoter is replaced with the HXT1 promoter in the GAL regulatory system of the yeast cell.

In some embodiments, the beta-carotene synthesis pathway related gene is placed under GAL1, GAL7, GAL2 or GAL10 promoter (collectively referred to as GAL promoter) for expression, so that the control of glucose on the beta-carotene synthesis pathway gene expression can be realized, and the switch of the synthesis pathway can be controlled by regulating the glucose concentration in a culture system, thereby achieving the purpose of controlling the synthesis of metabolites.

In some embodiments, the tmgh 1 gene is operably linked to a pGAL1 promoter, the BtcrtE gene is operably linked to a GAL10 promoter, the btcryb gene is operably linked to a GAL1 promoter, and the BtcrtI gene is operably linked to a GAL10 promoter; and silencing the GAL1 gene, GAL7 gene, and GAL10 gene.

Preferably, the yeast is YLK-pHXT1-BT2 strain which is classified and named HEC-YLK9I-07 and is preserved in China Center for Type Culture Collection (CCTCC) at 11/18/2020 with the address: the preservation number of the preservation center of Wuhan university in Wuhan, China is CCTCC M2020754.

In some embodiments, the fermentation is performed via liquid fermentation. The liquid culture medium comprises 20-120g/L of glucose, 5-9g/L of ammonium sulfate, 1-4g/L of yeast powder, 1-4g/L of peptone, 10-40g/L of corn steep liquor, 3-7g/L of monopotassium phosphate, 1-4g/L of magnesium sulfate, 0.5-3g/L of zinc sulfate, 1150-2500 mg/L of vitamin B, 3150-250mg/L of vitamin B and 6150-250mg of vitamin B.

In some embodiments, the pH of the medium is controlled between 5 and 6 during fermentation. In some embodiments, the glucose is supplemented during the fermentation to maintain a concentration of not less than 2g/l during a fermentation time of not more than 20-30 hours. In the process of research, the inventor finds that when the glucose concentration is lower than 2g/L, the exogenous gene expression is induced, so that the glucose concentration at the early stage needs to be maintained at a higher level. In some embodiments, the dissolved oxygen is controlled at 30% during fermentation and the dissolved oxygen is correlated to the agitation speed. In some embodiments, ethanol is exchanged for a carbon source after 20-30 hours of fermentation.

Biological material preservation information:

YLK-pHXT1-BT2 strain, which is classified and named as Saccharomyces cerevisiae HEC-YLK9I-07(Saccharomyces cerevisiae HEC-YLK9I-07), is preserved in China Center for Type Culture Collection (CCTCC) at 11/18/2020, and has a preservation number of CCTCC NO: m2020754.

Drawings

FIG. 1 shows the principle of the glucose-induced GAL regulatory system of the present invention.

FIG. 2 shows a Donor DNA fragment prepared according to an example of the present invention, which is used to replace the native promoter of GAL80 gene in Saccharomyces cerevisiae.

Detailed Description

The following are preferred embodiments of the present invention, and the present invention is not limited to the following preferred embodiments. It should be noted that various changes and modifications based on the inventive concept herein will occur to those skilled in the art and are intended to be included within the scope of the present invention. The reagents used are not indicated by the manufacturer, and are all conventional products commercially available.

In the present application, the promoters "GAL 1", "GAL 7", "GAL 2", "GAL 80", "HXT 1" and "GAL 10" are used interchangeably with "pGAL 1", "pGAL 7", "pGAL 2", "pGAL 80", "pHXT 1" and "pGAL 10", respectively.

GAL10 (epimerase), GAL1 (kinase) and GAL7 (transferase) are three related enzymes for converting galactose to glucose, and genomic DNA of GAL10, GAL1 and GAL7 expression regions are clustered on the Saccharomyces cerevisiae chromosome. GAL10, GAL1 and GAL7 genes are transcribed from their respective promoters, and the transcription of the GAL gene is tightly regulated.

The key point of the invention is that a glucose-activated promoter HXT1 is used to replace a GAL80 promoter in a GAL regulatory system of a yeast genome, so that the original galactose induction mode of the yeast is changed into a mode of glucose-controlled expression. Referring to the glucose induction scheme shown in fig. 1 according to the embodiment of the present invention, it can be seen that the activities of the promoters GAL1, GAL2, GAL7, GAL10 are activated depending on the binding of the transcription factor GAL4p protein, and that the GAL80p repressor protein can bind to GAL4p protein to prevent the binding of GAL4p to the above-mentioned promoters.

When high-concentration glucose exists in a growth environment, the HXT1 promoter is in an activated state, the GAL80 repressor protein is expressed, and the GAL4 protein is combined with the promoter in a suppressed state, so that genes controlled by GAL1, GAL2, GAL7 and GAL10 are not expressed; when glucose is depleted in the yeast growth environment, the HXT1 promoter activity is inhibited and the GAL80 repressor protein is not expressed, so that the GAL4 protein is in a free state, and binds to the UAS binding domain of the downstream GAL promoter to activate the expression of the downstream gene, and therefore the GAL1, GAL2, GAL7 and GAL10 controlled genes are also induced to be expressed. Therefore, the invention realizes the purpose of controlling the expression of the target gene through the glucose concentration of the growth environment in the culture process of the saccharomyces cerevisiae.

HXT1 is a glucose-activated promoter derived from yeast having the amino acid sequence shown in SEQ ID NO:1 or a nucleotide sequence which is added, deleted and substituted by one or more bases and still has the same function with the nucleotide sequence shown in SEQ ID NO. 1.

The replacement of the GAL80 promoter in the GAL regulatory system of the yeast genome with the glucose-activated promoter HXT1 can be carried out in a manner known per se. Preferably, the method is performed by gene editing.

According to the embodiment of the invention, the adopted starting strains are CCTCC NO: the HEC-YLK strain of M2018062, which is deposited at the China center for type culture Collection on the 1 st 29 th 2018 (see China patent application publication CN 110982721A).

It should be noted that, although the engineered saccharomyces cerevisiae strain containing the GAL regulatory system has verified the precise regulation of gene expression in synthesizing target products by constructing saccharomyces cerevisiae containing the GAL regulatory system and genes related to β -carotene synthesis in the examples of the present invention, and the product yield is improved compared to the prior art, those skilled in the art know that the GAL regulatory system of the present invention, and the engineered saccharomyces cerevisiae strain containing the GAL regulatory system can be widely used for the synthesis of other target products, and the regulation of exogenous genes. For example, the mevalonate pathway of brewer's yeast provides a direct precursor for the synthesis of heterologous terpenoids. The synthesis of terpenoids, including but not limited to monoterpenes, sesquiterpenes, diterpenes, etc., such as β -carotene, lutein, canthaxanthin, astaxanthin, lycopene, arteannuin, artemisinin, taxadiene, paclitaxel, dammarenediol, α -santalene, tanshinone, squalene, ginsenoside.

The invention changes the traditional mode of adopting galactose to induce the GAL promoter and realizes the gene expression controlled by the GAL promoter regulated by glucose. The GAL regulation system and the yeast containing the GAL regulation system can strictly and efficiently realize regulation and control of exogenous gene expression, and the exogenous gene is basically not expressed and has low background expression level under the condition of high-concentration glucose; under the condition of low-concentration glucose or no glucose, the exogenous gene is quickly expressed. Moreover, the GAL regulation system and the yeast containing the GAL regulation system can be used for expressing the exogenous gene in metabolic engineering, the separation of the thallus growth and the product accumulation stage is realized by controlling the expression time of the glucose concentration control gene in the fermentation system, the high-efficiency expression of the exogenous gene can be perfectly realized without adding an inducer, and the two processes of the thallus growth and the product accumulation can be perfectly separated and organically linked by controlling the concentration of the glucose in the fermentation system. In addition, the glucose is used as an inducer instead of the galactose, so that the production cost is greatly reduced, and the possibility is provided for producing the target product by utilizing the yeast for industrial fermentation.

Example 1 construction of Gene editing vectors

All gene integration and genomic DNA fragment replacement in the present invention were performed by gene editing, and for this purpose, the present invention has previously constructed a series of gene editing vectors for the subsequent examples, see table 1 below. The constructed gene editing vectors all use pCAS9W03 as a launch vector (patent application No.: 201910754882.3), and adopt fusion PCAnd replacing the N20 sequence on the original vector in the R mode to obtain different gene editing target vectors, wherein the editing sites are designed by adopting an sgRNA online design tool, and website links are as follows:http://crispr.dbcls.jp/. The primer sequences required for constructing the gene editing vector are shown in the following table: the underlined part is the N20 substitution region, which is the targeted region at the corresponding site on the genome.

Table 1:

the construction process of the vector is as follows:

the 4 fragments in Table 2 below were first amplified using the primers described above.

Table 2:

the 4 fragments obtained above were digested with NheI + NotI, ligated to the similarly digested pCAS9W03 vector backbone, transformed into E.coli DH 5. alpha. and spread on ampicillin-resistant plates containing 100mg/ml, and positive clones were selected, and the successfully constructed plasmids were named pCAS9-HO, pCAS9-GAL7, pCAS9-GAL80 and pCAS9-GAL4, respectively.

Example 2 preparation of Donor DNA fragment

1) Preparation of PHXT1 Donor DNA

The genome of Saccharomyces cerevisiae HEC-YLK (preservation number: CCTCC NO: M2018062) is used as a template, PHXT1-F (TTTCTTCATTTACCGGCGCACTCTCGCCCGAACGACCTCAA AATGTCTGCTTGCAGGTCTCATCTGGAATATAATTCC (SEQ ID NO:12)) and PHXT1-R (GGAGCTGCATTAGGCACGGTTGAGACCGAAGATCTCTTGTTGTAGTCCATGATTTTACGTATATCAA CTAGTTGACGATTATG (SEQ ID NO:13)) sequences are used as primers, Takara Hi Fi enzyme (PrimeSTAR Max DNA Polymerase) is used for PCR amplification, and a GelExtractionkit kit (OMEGA, America) is used for purifying and recovering PCR products according to the instructions of manufacturers, so that PHXT1 Donor DNA is obtained, wherein the nucleotide sequence of the DNA is shown in SEQ ID NO: 27.

TTTCTTCATTTACCGGCGCACTCTCGCCCGAACGACCTCAAAATGTCTGCTTGCAGGTCTCATCTGGAATATAATTCCCCCC TCCTGAAGCAAATTTTTCCTTTGAGCCGGAATTTTTGATATTCCGAGTTCTTTTTTTCCATTCGCGGAGGTTATTCCATTCC TAAACGAGTGGCCACAATGAAACTTCAATTCATATCGACCGACTATTTTTCTCCGAACCAAAAAAATAGCAGGGCGAGAT TGGAGCTGCGGAAAAAAGAGGAAAAAATTTTTTCGTAGTTTTCTTGTGCAAATTAGGGTGTAAGGTTTCTAGGGCTTAT TGGTTCAAGCAGAAGAGACAACAATTGTAGGTCCTAAATTCAAGGCGGATGTAAGGAGTATTGGTTTCGAAAGTTTTTC CGAAGCGGCATGGCAGGGACTACTTGCGCATGCGCTCGGATTATCTTCATTTTTGCTTGCAAAAACGTAGAATCATGGTA AATTACATGAAGAATTCTCTTTTTTTTTTTTTTTTTTTTTTTTTTACCTCTAAAGAGTGTTGACCAACTGAAAAAACCCTTC TTCAAGAGAGTTAAACTAAGACTAACCATCATAACTTCCAAGGAATTAATCGATATCTTGCACTCCTGATTTTTCTTCAAAG AGACAGCGCAAAGGATTATGACACTGTTGCATTGAGTCAAAAGTTTTTCCGAAGTGACCCAGTGCTCTTTTTTTTTTTCC GTGAAGGACTGACAAATATGCGCACAAGATCCAATACGTAATGGAAATTCGGAAAAACTAGGAAGAAATGCTGCAGGG CATTGCCGTGCCGATCTTTTGTCTTTCAGATATATGAGAAAAAGAATATTCATCAAGTGCTGATAGAAGAATACCACTCATA TGACGTGGGCAGAAGACAGCAAACGTAAACATGAGCTGCTGCGACATTTGATGGCTTTTATCCGACAAGCCAGGAAAC TCCACCATTATCTAATGTAGCAAAATATTTCTTAACACCCGAAGTTGCGTGTCCCCCTCACGTTTTTAATCATTTGAATTAGT ATATTGAAATTATATATAAAGGCAACAATGTCCCCATAATCAATTCCATCTGGGGTCTCATGTTCTTTCCCCACCTTAAAATC TATAAAGATATCATAATCGTCAACTAGTTGATATACGTAAAATCATGGACTACAACAAGAGATCTTCGGTCTCAACCGTGCC TAATGCAGCTCC(SEQ ID NO:27)

2) preparation of pCRT3 donor DNA

The genome of Saccharomyces cerevisiae HEC-YLK (preservation number: CCTCC NO: M2018062) is used as a template, PCTR3-F2(TTTCTTCAT TTACCGGCGCACTCTCGCCCGAACGACCTCA AAATGTCTGCGTATTCCAATGAGAATCGCTAG (SEQ ID NO:14)) and PCTR3-R2(GGAGCTGCATTAGGCACGGTTG AGACCGAAGATCTCTTGTTGTAGTCCATCTTTGTATAGCCCTTAAATG (SEQ ID NO:15)) sequences are used as primers, Takara high fidelity enzyme (PrimeSTAR Max DNA Polymerase) is used for PCR amplification, and a PCR product is purified and recovered by a GelExtractionKit kit (OMEGA, America) according to the instructions of manufacturers to obtain pCRT3 donor DNA. 3) preparation of pCUP1 donor DNA

The genome of Saccharomyces cerevisiae HEC-YLK (preservation number: CCTCC NO: M2018062) is used as a template, 046-CUP1p-F (AGGGGCGATTGGTTTGGGTGCGTGAGCGGCAAGAAGTTTCGTAAGCCGATCCCATTACCG (SEQ ID NO:16)) and 047-CUP1p-R (AGAAGACAGTAGCTTCATCTTTCAGGAGGCTTGCTTCTCTGTCAGTTTGTTTTTCTTAATATCTATTTCG ((SEQ ID NO:17))) sequences are used as primers, Takara Hi Fi enzyme (PrimeSTAR Max DNA Polymerase) is used for PCR amplification, and a GelExtractionkit kit (OMEGA, America) is used for purifying and recovering PCR products according to the instructions of manufacturers, so that pCUP1 donor DNA is obtained.

Example 3 editing and engineering of GAL regulatory System

1) Saccharomyces cerevisiae electrotransformation competence preparation and gene editing

"High-efficiency layer transformation using the LiAc/SS carrier DNA/PEG method" according to the method of Gietz, R.D. et al (Gietz, R.D. and R.H. Schiestl (2007).) "Nature Protocols(2) (1):31-34) Saccharomyces cerevisiae competence was prepared and transformed, and 100. mu.l of yeast cells were added to the centrifuge tube with the following substances in Table 3:

table 3:

and (3) putting the mixed system into a temperature of 42 ℃ and preserving the temperature for 40min for heat shock. Then adding 1ml YPD liquid culture medium, performing shake cultivation at 30 ℃ for 3h, taking 100 mul of transformation liquid after recovery, coating on a YPD solid plate containing 200 mug/ml G418, performing cultivation at 30 ℃, picking out clones growing on the plate after 3 days, and performing genotype verification to obtain clones with correct genotypes. The clones were subcultured 2 times in YPD liquid medium to lose the CAS9 gene editing vector therein.

2) Replacement of pGAL80 promoter with pHXT1 promoter

According to the method of the embodiment 3.1, the saccharomyces cerevisiae electrotransformation and gene editing method, saccharomyces cerevisiae HEC-YLK (preservation number: CCTCC NO: M2018062) is taken as a host, pCAS9-GAL80 is taken as a gene editing vector, and PHXT1 Donor DNA is taken as a homologous integration fragment, so that the engineering bacterium YLK-pHXT1 with pGAL80 promoter replaced by pHXT1 promoter is obtained.

3) Copper ion induction system modification

a. By adopting the transformation method, HEC-YLK (the preservation number: CCTCC NO: M2018062) is taken as a host, pCAS9-GAL80 is taken as a gene editing vector, and Donor DNA is taken as pCRT3 Donor DNA, so that the gene engineering strain YLK-Cu01 with pGAL80 promoter replaced by pCRT3 promoter is obtained.

b. Using the above transformation method, a genetically engineered strain YLK-Cu02 in which pGAL4 promoter was replaced with pCUP1 promoter was obtained using YLK-Cu01 as a host, pCAS9-GAL4 as a gene editing vector, and Donor DNA as pCUP1 Donor DNA.

EXAMPLE 4 construction of beta-Carotene producing strains

1) Construction of copper ion-inducible beta-carotene strain

The beta-carotene synthesis pathway genes BtcrE (GGPP synthase, GenBank:: AFC92798.1), BtcrI (phytoene dehydrogenase, GenBank:: AAX20903.1) and BtcrYB (phytoene synthase/cyclase bifunctional enzyme, GenBank:: Q67GH9.1) from Blakeslea trispora were codon optimized and gene synthesized according to the codons of Saccharomyces cerevisiae. The optimized gene sequences are shown in the following table 4:

table 4:

the BtcrtE gene EcoRI and BglII are cloned on a saccharomyces cerevisiae expression vector pESC-URA in a double-enzyme digestion connection mode, escherichia coli DH5a is transformed, Amp resistance screening cloning is carried out, pESC-URA-BtcrtE is obtained, an HEC-YLK yeast genome is used as a template, tHMG1-BamHI (CCCGGATCCAAAAATGGACCAATTGGTGAAAACTGAAG (SEQ ID NO:21)) and tHMG1-SalI (CCCGTCGACTTAGGATTTAATGCAGGTGACG (SEQ ID NO:22)) are used as primers, a catalytic region tHMG1 of HMG1 is amplified, BamHI + SalI digestion is carried out, gel electrophoresis is recovered, the product is connected to a pESC-URA-BtcrtE vector recovered by the same enzyme, escherichia coli DH5a is transformed, Amp resistance screening cloning is carried out, pESC-BtcrE-tHMG 1 is obtained, and the promoter on the PESC-URA is pGAL1-PGAL10 bidirectional promoter, and the BtcrE and the t1 gene are respectively under the expression control of pGAL10 promoter and PGAL 1.

To integrate BtcrE and tHMG1 at the HO site by means of gene editing, primers HO-donor-F (cttatgatggttttttggaattattattatcctaccatcaagcgtctgacccagctgaattggag cga (SEQ ID NO:23)) and HO-donor-R (cgcggaaaaaagtaaacagctattgctactcaaatgaggtttgcagaagcgcagct ggatcttcgagcgtcccaaaacc (SEQ ID NO:24)) carrying homologous arms upstream and downstream of the HO cleavage site were designed to amplify BtcrE-tHMG 1 donor DNA from pESC-URA-BtcrE-tHMG 1 using high fidelity enzymes.

The BtcrtI gene EcoRI and BglII are subjected to double enzyme digestion connection cloning to a saccharomyces cerevisiae expression vector pESC-URA, escherichia coli DH5a is transformed, Amp resistance screening cloning is carried out, pESC-URA-BtcrtI, BtcYB gene BamHI and HindIII are obtained through double enzyme digestion, the BtccrI gene BamHI and the BtIII are connected to a pESC-URA-BtcrtI vector subjected to the same enzyme digestion, escherichia coli DH5a is transformed, Amp resistance screening cloning is carried out, and pESC-URA-BtccrtI-BtccrtYB is obtained. Since the promoter on PESC-URA is pGAL1-PGAL10 bidirectional promoter, BtcrtI and BtcrtYB genes are expressed under the control of pGAL10 and PGAL1 promoters, respectively.

In order to replace GAL1-GAL7 region on genome with BtcrI and BtcrYB expression cassettes by means of gene editing, primers GAL7-CAS9-F (tgtagataatgaatctgaccatctaaatttcttagtttttcagcagcttgttccgaagttaaatctctttcggttagagcggatc ttagc (SEQ ID NO:25)) and GAL1-CAS9-R (gcattttctagctcagcatcagtgatcttagggtacttgaccttgta gaactcattggcaagggcttcttgaccaaacctctggcgaag (SEQ ID NO:26)) carrying homologous arms upstream and downstream of GAL1-GAL7 cleavage sites are designed, and BtcrI-BtcrYBtYB donor DNA is amplified from pESC-URA-BtcrI-BtcrYBtYBtYBtI-BtYBtYBtBtR by using high fidelity enzyme.

The genetically engineered strain YLK-Cu-BT1 with the HO gene replaced by the BtcrtE-tHMG1 expression cassette was obtained using the Saccharomyces cerevisiae transformation method described in example 3.1, using YLK-Cu02 as host, pCAS9-HO as gene editing vector, BtcrtE-tHMG1 donor DNA.

The Saccharomyces cerevisiae transformation method described in example 3.1 was used to obtain the genetically engineered strain YLK-Cu-BT2 with the GAL1-GAL7 region replaced by the BtcrtI-BtcrtYB expression cassette, using YLK-Cu-BT1 as the host, pCAS9-GAL7 as the genetic editing vector, and BtcrtI-BtcrYB donor DNA.

2) Construction of galactose-inducible beta-carotene Strain

When GAL80 and GAL4 in the GAL regulatory system are not modified, the transcriptional activity of promoters such as pGAL1, pGAL2, pGAL7, pGAL10 in the GAL regulatory system needs to be induced by galactose. In order to construct a galactose-inducible Beta-carotene synthetic strain for control experiments, the Saccharomyces cerevisiae transformation method described in example 3.1 was used, HEC-YLK was used as the host, pCAS9-HO was used as the gene editing vector, BtcrE-tHMG 1 donor DNA, to obtain the genetically engineered strain YLK-GAL-BT1 in which the HO gene was replaced by the BtcrE-tHMG 1 expression cassette. YLK-GAL-BT1 was used as host, pCAS9-GAL7 as gene editing vector, BtcrI-BtcrYB donor DNA, to obtain genetically engineered strain YLK-GAL-BT2 with GAL1-GAL7 region replaced by BtcrI-BtcrYB expression cassette. The colony of the engineering strain YLK-GAL-BT2 clearly turns red when growing on a YPD plate added with 2% galactose for 3 days, while the colony is white when cultured on a YPD plate without galactose for 3 days, which indicates that the constructed strain really needs to be induced by galactose.

3) Construction of glucose-inhibited beta-carotene Strain

The engineering strain YLK-pHXT1 obtained in the patent example 3.2 is used as a starting host, the saccharomyces cerevisiae transformation method described in the example 3.1 is adopted, pCAS9-HO is used as a gene editing vector, BtcrE-tHMG 1 donor DNA is used, and the genetic engineering strain YLK-pHXT1-BT1 with the HO gene replaced by a BtcrE-tHMG 1 expression cassette is obtained. Then, using YLK-pHXT1-BT1 as host, pCAS9-GAL7 as gene editing carrier and Btcrt I-BtcrtYB donor DNA to obtain genetically engineered strain YLK-pHXT1-BT2 with the GAL1-GAL7 region replaced by Btcrt I-BtcrtYB expression cassette, which is classified and named HEC-YLK9I-07 and preserved in China Center for Type Culture Collection (CCTCC) at 11-18 months in 2020 with the preservation number of CCTCC M2020754. The colony color of the engineering bacteria is milky white under the condition of high glucose concentration; the colony color gradually changes to red along with the consumption of the glucose, which indicates that the expression of the exogenous gene of the engineering bacteria is not controlled by galactose but is controlled by the concentration of the glucose.

EXAMPLE 5 comparison of shake flask fermentation of engineered bacteria producing beta-carotene

1) Fermentation medium

YPD medium: glucose 20.0g/L, soybean peptone 20.0g/L, yeast extract powder 1.0g/L

YNB medium: YNB 1.7g/l, anhydrous ammonium sulfate 5.0g/l, glucose 20.0g/l

2) Yeast carotenoid extraction and content detection

The extraction method comprises the following steps: taking 1mL of the culture into a 15mL centrifuge tube, centrifuging to remove supernatant and collecting the thallus; then 2ml of 3M hydrochloric acid is added, and the mixture is treated in boiling water bath for 3min to destroy the yeast cell wall; cooling the treated cells in an ice water bath for 1min, centrifuging to remove supernatant, and washing with pure water for 2 times to remove residual hydrochloric acid; then 5ml of acetone is added, and the pigment in the mixture is extracted by shaking up and down.

Content determination: detecting OD value under the wavelength of 450nm, and calculating the content of beta-carotene in the extracting solution according to the following formula;

a1- -absorbance of diluted beta-carotene at 450nm wavelength in a cell with 1cm light path

A^1％Extinction coefficient of beta-carotene at 1% concentration (10mg/mL), here the value 2500AU

N- -determination of OD₄₅₀Beta-carotene solution dilution factor

10g/mL----A^1％At 2500AUConcentration of beta-carotene solution

The beta-carotene content in the fermentation broth corresponds to the beta-carotene concentration C determined above x the amount of acetone ml used for extraction/ml of fermentation broth used.

3) Shake flask fermentation

Strains YLK-Cu-BT2, YLK-GAL-BT2 and YLK-pHXT1-BT2 preserved by a glycerol method are taken from a refrigerator at the temperature of-80 ℃, dissolved at room temperature, and then inoculated into a bottle of 50ml YPD liquid culture medium by 1 percent of inoculum size, and activated at the temperature of 30 ℃ and 250rpm for 15-18h to prepare seed liquid. Then the seed liquid was transferred to 50ml/250ml YPD fermentation medium at 1% inoculum size and fermented at 30 ℃ at 250rpm for 72 h. After the fermentation was completed, the pigment content was extracted and measured by the method of example 5.2. The results are shown in table 5 below:

table 5:

numbering	Bacterial strains	Induction concentration	OD600	Pigment content mg/L
					1	YLK-GAL-BT2	0.2g/l galactose	26.48	245.1
2	YLK-GAL-BT2	0.4g/l galactose	26.34	251.2
					3	YLK-Cu-BT2	5 μ M copper ion	27.63	276.8
4	YLK-Cu-BT2	10 μ M copper ion	25.34	357.2
					5	YLK-pHXT1-BT2	N/A	24.96	550.7
6	YLK-pHXT1-BT2	N/A	25.34	545.6

By comparing three different GAL regulation systems of galactose induction, copper ion induction and glucose inhibition regulation, the accumulation effect on beta-carotene is different, wherein the yield of the glucose inhibition regulation strain YLK-pHXT1-BT2 is the highest, the yield of the copper ion induction strain YLK-Cu-BT2 is the next lowest, and the yield of the galactose induction strain YLK-GAL-BT2 is the lowest.

4) Influence of different glucose concentrations on coloring matter production of YLK-pHXT1-BT2 engineering bacteria

The strain YLK-pHXT1-BT2 preserved by glycerol method is taken from a refrigerator at-80 deg.C, dissolved at room temperature, inoculated with 50ml YNB liquid culture medium with 1% inoculum size, and activated at 30 deg.C and 250rpm for 15-18h to obtain seed liquid. Then transferring the seed liquid into 50ml/250ml YNB fermentation medium with 1% inoculation amount, and adding 0ml, 2ml, 4ml, 6ml and 8ml of 50% glucose mother liquor in sequence, fermenting at 30 ℃ and 250rpm for 120 h. After the fermentation was complete, the pigment content was extracted and measured as in example 5.2. The results are shown in table 6 below:

table 6:

from the above table, it can be seen that the biomass is in a linear increasing trend with the increase of the initial glucose concentration, and the pigment yield and the unit OD pigment yield have a certain plateau within the range of 4% -8% glucose concentration, the yield is not significantly increased, but the pigment yield is significantly increased under the 10% glucose concentration, which indicates that the initial glucose concentration has a great influence on the final accumulation of beta-carotene.

Example 6 fermentation investigation on YLK-pHXT1-BT2 engineering bacteria 50L tank

1) Fermentation tank culture medium

20g/L glucose, 7g/L ammonium sulfate, 2g/L yeast powder, 2g/L peptone, 30g/L corn steep liquor, 5g/L monopotassium phosphate, 2g/L magnesium sulfate, 1g/L zinc sulfate, 1200 mg/L vitamin B, 3200 mg/L vitamin B6200 mg & lt/EN & gt/beaver

2) Preparing seeds with seed liquid in tank

Glycerol seeds YLK-GAL-BT2, YLK-pHXT1-BT2 and YLK-Cu-BT2 are taken from a refrigerator at the temperature of-80 ℃, are inoculated into a bottle of 50ml YPD liquid culture medium by five thousandths of inoculum size after being melted at room temperature, and are activated for 15 to 18 hours at the temperature of 30 ℃ and 250rpm to prepare first-grade seeds. Then, the primary seed was transferred to 300ml YPD seed medium at 5% inoculation amount, and cultured at 30 ℃ and 250rpm for 9-12 hours to prepare secondary seed. The secondary seeds were then transferred to a 50L fermentor for fermentation at 1% inoculum size.

3) Fermentation study on 50L tank

Fermentation test 1(YLK-GAL-BT 2): the initial glucose concentration in the early stage of fermentation is 20g/L, after the basic carbon source is completely consumed, the fed-batch of glucose is carried out after the dissolved oxygen rebound is monitored on line, and the content of glucose in the system is controlled to be not more than 1 g/L. The pH value is controlled between 5 and 6 by adopting ammonia water in the fermentation process. Controlling the dissolved oxygen at 30% after glucose supplementation, correlating the dissolved oxygen with the stirring speed, fermenting to 25-30h, supplementing galactose with the final concentration of 0.4g/l, replacing ethanol as a carbon source, and continuing fermenting to 84 h.

Fermentation test 2(YLK-Cu-BT 2): the initial glucose concentration in the early stage of fermentation is 20g/L, after the basic carbon source is completely consumed, the fed-batch of glucose is carried out after the dissolved oxygen rebound is monitored on line, and the content of glucose in the system is controlled to be not more than 1 g/L. The pH value is controlled between 5 and 6 by adopting ammonia water in the fermentation process. Controlling the dissolved oxygen at 30% after supplementing glucose, correlating the dissolved oxygen with the stirring speed, fermenting to 25-30h, supplementing CuSO4 solution with the final concentration of 10 μ M, replacing ethanol as carbon source, and continuing fermenting to 84 h.

Fermentation run 3(YLK-pHXT1-BT 2): the initial glucose concentration in the early stage of fermentation is 20g/L, after the basic carbon source is completely consumed, the fed-batch of glucose is carried out after the dissolved oxygen rebounding is monitored on line, and the content of glucose in the system is controlled not to exceed 1-2 g/L. The pH value is controlled between 5 and 6 by ammonia water in the fermentation process. Controlling the dissolved oxygen at 30% after glucose supplementation, correlating the dissolved oxygen with the stirring speed, fermenting to 20-30h, replacing ethanol as a carbon source, and continuing to ferment to 84 h.

Fermentation run 4(YLK-pHXT1-BT 2): the initial glucose concentration in the early stage of fermentation is 100g/L, after the basic carbon source is completely consumed, the fed-batch of glucose is carried out after the dissolved oxygen rebounding is monitored on line, and the content of glucose in the system is controlled not to exceed 1-2 g/L. The pH value is controlled between 5 and 6 by ammonia water in the fermentation process. Controlling the dissolved oxygen at 30% after glucose supplementation, correlating the dissolved oxygen with the stirring speed, fermenting to 20-30h, replacing ethanol as a carbon source, and continuing to ferment to 84 h. See table 7 below:

table 7:

and (4) analyzing results:

1) comparative experiments 1, 2 and 3 show that galactose and Cu²⁺And three regulation modes of glucose have larger difference on the synthesis effect of the beta-carotene. Wherein the YLK-GAL-BT2 engineering bacteria has low late galactose consumption induction efficiency, so that the final yield of beta-carotene is the lowest and is only 2.04 g/l; and then the engineering bacteria YLK-Cu-BT2 induced by copper ions, the optimal effect is the engineering bacteria YLK-pHXT1-BT2, and the yield is 3.23 g/l.

2) Comparison tests 3 and 4 show that the accumulation time of the early-stage pigment is shifted backwards along with the increase of the early-stage basic sugar concentration, which indicates that the YLK-pHXT1-BT2 engineering bacteria are strictly regulated and controlled by the glucose concentration, and the two stages of thallus growth and product expression can be organically separated without adding an inducer. From the results, the growth of the thallus and the accumulation of the pigment are relatively lagged in the initial stage of the fermentation with the 10% of the basic sugar concentration, but the final biomass or pigment yield is obviously superior to 2%, the yield of the beta-carotene reaches 3.84g/l, which is 1.88 times of that of the galactose-induced YLK-GAL-BT2 engineering bacteria, and the yield of the copper ion-induced YLK-Cu-BT2 engineering bacteria is 1.46 times.

SEQUENCE LISTING

<110> Yichangdong sunshine Biochemical pharmacy Co., Ltd

<120> promoter for regulating expression of yeast foreign gene, regulation method and use thereof

<130> RYP2010898.8

<160> 27

<170> PatentIn version 3.5

<210> 1

<211> 1124

<212> DNA

<213> Saccharomyces

<400> 1

ttgcaggtct catctggaat ataattcccc cctcctgaag caaatttttc ctttgagccg 60

gaatttttga tattccgagt tctttttttc cattcgcgga ggttattcca ttcctaaacg 120

agtggccaca atgaaacttc aattcatatc gaccgactat ttttctccga accaaaaaaa 180

tagcagggcg agattggagc tgcggaaaaa agaggaaaaa attttttcgt agttttcttg 240

tgcaaattag ggtgtaaggt ttctagggct tattggttca agcagaagag acaacaattg 300

taggtcctaa attcaaggcg gatgtaagga gtattggttt cgaaagtttt tccgaagcgg 360

catggcaggg actacttgcg catgcgctcg gattatcttc atttttgctt gcaaaaacgt 420

agaatcatgg taaattacat gaagaattct cttttttttt tttttttttt tttttttacc 480

tctaaagagt gttgaccaac tgaaaaaacc cttcttcaag agagttaaac taagactaac 540

catcataact tccaaggaat taatcgatat cttgcactcc tgatttttct tcaaagagac 600

agcgcaaagg attatgacac tgttgcattg agtcaaaagt ttttccgaag tgacccagtg 660

ctcttttttt ttttccgtga aggactgaca aatatgcgca caagatccaa tacgtaatgg 720

aaattcggaa aaactaggaa gaaatgctgc agggcattgc cgtgccgatc ttttgtcttt 780

cagatatatg agaaaaagaa tattcatcaa gtgctgatag aagaatacca ctcatatgac 840

gtgggcagaa gacagcaaac gtaaacatga gctgctgcga catttgatgg cttttatccg 900

acaagccagg aaactccacc attatctaat gtagcaaaat atttcttaac acccgaagtt 960

gcgtgtcccc ctcacgtttt taatcatttg aattagtata ttgaaattat atataaaggc 1020

aacaatgtcc ccataatcaa ttccatctgg ggtctcatgt tctttcccca ccttaaaatc 1080

tataaagata tcataatcgt caactagttg atatacgtaa aatc 1124

<210> 2

<211> 58

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 2

agcatgaggt cgctccaatt cagcttcttt gaaaagataa tgtatgatta tgctttca 58

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 3

tatcaaggcc gatgctgtac 20

<210> 4

<211> 51

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 4

aatgatcgac atttatgacg cgggcaggtt ttagagctag aaatagcaag t 51

<210> 5

<211> 51

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 5

gctctaaaac ctgcccgcgt cataaatgtc gatcatttat ctttcactgc g 51

<210> 6

<211> 51

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 6

aatgatcaag atccatgaat cggttaggtt ttagagctag aaatagcaag t 51

<210> 7

<211> 51

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 7

gctctaaaac ctaaccgatt catggatctt gatcatttat ctttcactgc g 51

<210> 8

<211> 51

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 8

aatgatcgcg tatacaatct cgatagtgtt ttagagctag aaatagcaag t 51

<210> 9

<211> 51

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 9

gctctaaaac actatcgaga ttgtatacgc gatcatttat ctttcactgc g 51

<210> 10

<211> 51

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 10

aatgatctga agctgaaaat ctggggagtt ttagagctag aaatagcaag t 51

<210> 11

<211> 51

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 11

gctctaaaac tccccagatt ttcagcttca gatcatttat ctttcactgc g 51

<210> 12

<211> 78

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 12

tttcttcatt taccggcgca ctctcgcccg aacgacctca aaatgtctgc ttgcaggtct 60

catctggaat ataattcc 78

<210> 13

<211> 83

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 13

ggagctgcat taggcacggt tgagaccgaa gatctcttgt tgtagtccat gattttacgt 60

atatcaacta gttgacgatt atg 83

<210> 14

<211> 72

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 14

tttcttcatt taccggcgca ctctcgcccg aacgacctca aaatgtctgc gtattccaat 60

gagaatcgct ag 72

<210> 15

<211> 70

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 15

ggagctgcat taggcacggt tgagaccgaa gatctcttgt tgtagtccat ctttgtatag 60

cccttaaatg 70

<210> 16

<211> 60

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 16

aggggcgatt ggtttgggtg cgtgagcggc aagaagtttc gtaagccgat cccattaccg 60

<210> 17

<211> 70

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 17

agaagacagt agcttcatct ttcaggaggc ttgcttctct gtcagtttgt ttttcttaat 60

atctatttcg 70

<210> 18

<211> 975

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 18

gaattcatgt tgacatcttc taaatctatt gaatcttttc caaagaatgt ccagccatac 60

ggtaagcact accagaacgg attggagcca gtcggtaagt cacaggaaga cattttgttg 120

gaaccattcc attatttgtg ctctaatcca ggtaaggatg tcagaactaa gatgattgag 180

gcttttaatg catggttaaa agttccaaaa gacgatttaa ttgttataac tagagttatt 240

gagatgttgc attctgcttc tttgttgatt gatgatgtcg aagacgactc agtcttgaga 300

aggggtgttc cagctgctca ccacatttac ggtacaccac agacaattaa ttgtgctaat 360

tacgtttatt ttttggcttt gaaagaaatt gctaaattga ataaaccaaa tatgattaca 420

atttatactg atgaattaat taacttgcat agaggtcaag gtatggaatt gttttggaga 480

gatactttaa cttgtccaac agaaaaagaa tttttggaca tggttaatga taagactggt 540

ggtttgttga ggttggcagt caagttgatg caggaggctt ctcagtcagg tactgactac 600

acaggtttgg tctctaaaat tggtattcat tttcaagtta gagatgatta tatgaattta 660

cagtctaaga attatgctga caacaagggt ttctgcgagg acttgacaga gggtaagttt 720

tcattcccaa ttatacattc tattagatca gatccatcta acagacaatt gttgaatatt 780

ttgaaacaac gttcttcttc tattgagttg aaacaattcg ctttgcaatt gttggaaaat 840

acaaatactt ttcaatattg tagagatttt ttgagagttt tggagaagga ggctagggag 900

gagattaagt tgttgggtgg taatataatg ttggaaaaaa ttatggatgt tttatctgtt 960

aatgaataaa gatct 975

<210> 19

<211> 1761

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 19

gaattcatgt ctgatcagaa aaaacacatt gttgttattg gtgctggtat aggaggtaca 60

gctactgcag ctagattggc aagagagggt ttcagagtta ctgtcgtcga aaagaatgat 120

ttttctggag gaagatgttc atttattcat catgatggtc atagatttga tcaaggtcct 180

tcattgtatt tgatgccaaa attgttcgag gacgctttcg ctgacttgga cgagagaatt 240

ggtgaccatt tagatttgtt gaggtgtgat aataattata aagttcattt tgatgacggt 300

gatgctgttc aattgtcttc tgatttgact aagatgaaag gagagttgga caggattgag 360

ggtccattgg gtttcggtag gttcttagat ttcatgaaag aaactcatgt tcactatgaa 420

caaggtactt ttatagctat aaaaagaaat ttcgaaacaa tttgggattt gattagatta 480

caatatgtcc cagaaatatt tagattgcat ttgtttggta aaatttatga cagagcttca 540

aaatattttc agactaagaa gatgagaatg gcttttacat ttcaaactat gtatatgggt 600

atgtctccat acgacgctcc tgctgtttat tcattgttgc aatatactga atttgcagag 660

ggtatttggt atcctagagg tggttttaac atggttgttc aaaagttgga atctattgca 720

tctaaaaagt atggtgcaga gtttagatat caatctccag ttgcaaaaat taatactgtt 780

gataaggata agagagttac aggtgtcact ttggagtcag gtgaggttat agaagctgac 840

gctgtcgtct gcaatgctga cttggtctac gcttaccacc atttgttgcc accatgtaat 900

tggactaaga aaactttggc atctaagaaa ttgacttcat cttctatttc tttttactgg 960

tctatgtcta caaaggttcc acaattagat gttcacaata tctttttagc agaggcttat 1020

aaagaatcat ttgatgaaat ttttaacgac ttcggtttgc cttctgaagc atctttctac 1080

gtcaacgtcc catcaagaat tgacgagtct gctgctccac ctaacaagga ctctattatt 1140

gtcttagtcc caattggtca tatgaaatct aaaactggta attctgcaga agagaactac 1200

cctgagttgg tcaacagagc tagaaaaatg gttttggaag ttattgaaag aagattgggt 1260

gtcaataatt tcgcaaattt aattgaacac gaggaagtca acgacccatc tgtttggcag 1320

tctaagttta atttgtggag aggttctatt ttaggtttgt cacacgatgt tttccaagtc 1380

ttgtggttta gaccatcaac taaagattct actaataggt acgataactt gttctttgtt 1440

ggtgcttcta ctcacccagg tacaggtgtt ccaattgtct tggctggttc aaagttaaca 1500

tctgatcaag tttgcaaatc attcggtcag aacccattac caaggaagtt acaagactct 1560

caaaagaaat atgctccaga acagacaaga aaaacagaat cacattggat ttactactgc 1620

ttggcttgtt acttcgttac attcttattc ttttatttct tcccaagaga tgatactact 1680

acaccagctt cttttattaa tcaattgtta cctaacgttt ttcaaggtca aaattcaaat 1740

gatattagaa tttaaagatc t 1761

<210> 20

<211> 1839

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 20

ggatccatgt caatattaac atacttggaa tttcatttat actatacatt gccagttttg 60

gcagctttgt gctggttatt aaaacctttt cattctcagc aagataattt gaagtataaa 120

ttcttgatgt tgatggctgc atctacagca tcaatttggg ataactatat tgtttatcat 180

agagcatggt ggtactgccc aacttgcgtt gtcgcagtca ttggttacgt cccattggaa 240

gaatacatgt tttttattat tatgactttg atgactgttg ctttttctaa ctttgttatg 300

agatggcatt tgcatacttt ctttataaga ccaaacacat catggaagca aactttattg 360

gttagattgg ttcctgtctc agctttgtta gctattactt accatgcatg gcatttgaca 420

ttgccaaata aaccatcttt ctacggttca tgcatattat ggtacgcttg cccagtcttg 480

gcaattttgt ggttgggtgc tggtgaatat attttaagaa gaccagttgc agttttgttg 540

tctattgtca ttccatcagt ttatttatgt tgggctgata ttgttgctat atctgcaggt 600

acttggcata tatctttgag aacatcaact ggaaagatgg ttgtcccaga cttgcctgtc 660

gaggaatgtt tgttctttac tttgattaat acagttttgg tctttgctac atgtgctatt 720

gatcgtgctc aagctatttt gcatttgtac aaatcttcag ttcagaacca aaaccctaaa 780

caagctattt ctttgttcca acacgttaag gagttagctt gggcattctg cttgcctgac 840

cagatgttga acaacgaatt gttcgatgat ttgactattt catgggatat tttgagaaaa 900

gcatctaaat cattctatac agcatcagct gtttttcctt cttatgttag acaagatttg 960

ggtgtcttgt acgcattctg cagggcaact gacgatttgt gcgacgacga gtcaaagtct 1020

gtccaagaga ggagagacca attggacttg actagacaat ttgtcagaga tttgttttct 1080

caaaaaacat cagcaccaat tgttattgac tgggaattgt atcaaaacca attgcctgca 1140

tcttgtattt cagcttttag ggcatttact agattaagac acgttttgga ggttgatcca 1200

gttgaagaat tgttggatgg ttataaatgg gatttggaaa gaagaccaat tttggatgaa 1260

caagacttgg aggcttactc agcttgcgtt gcatcttctg tcggtgagat gtgtacaaga 1320

gtcattttag ctcaagatca aaaagagaat gatgcttgga taatagatag agcaagggag 1380

atgggtttgg ttttacaata cgtcaatatt gcaagagata ttgttactga ctctgaaact 1440

ttaggtagat gttatttgcc tcaacagtgg ttgaggaagg aggagacaga acaaattcaa 1500

caaggaaacg cacgttcttt gggtgaccag aggttgttgg gattatcttt gaagttggtc 1560

ggtaaggctg acgcaataat ggtcagagct aaaaaaggta ttgataagtt gccagcaaac 1620

tgccaaggtg gtgttagagc agcttgccag gtttacgctg caataggttc agtcttgaaa 1680

caacagaaaa ctacatatcc tactcgtgct catttgaaag gttcagaaag agcaaaaatt 1740

gctttattgt ctgtttataa tttgtaccag tctgaggaca agccagttgc tttgaggcag 1800

gcaagaaaga ttaaatcttt ctttgttgat taaaagctt 1839

<210> 21

<211> 38

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 21

cccggatcca aaaatggacc aattggtgaa aactgaag 38

<210> 22

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 22

cccgtcgact taggatttaa tgcaggtgac g 31

<210> 23

<211> 68

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 23

cttatgatgg ttttttggaa ttattattat cctaccatca agcgtctgac ccagctgaat 60

tggagcga 68

<210> 24

<211> 79

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 24

cgcggaaaaa agtaaacagc tattgctact caaatgaggt ttgcagaagc gcagctggat 60

cttcgagcgt cccaaaacc 79

<210> 25

<211> 90

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 25

tgtagataat gaatctgacc atctaaattt cttagttttt cagcagcttg ttccgaagtt 60

aaatctcttt cggttagagc ggatcttagc 90

<210> 26

<211> 89

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 26

gcattttcta gctcagcatc agtgatctta gggtacttga ccttgtagaa ctcattggca 60

agggcttctt gaccaaacct ctggcgaag 89

<210> 27

<211> 1224

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 27

tttcttcatt taccggcgca ctctcgcccg aacgacctca aaatgtctgc ttgcaggtct 60

catctggaat ataattcccc cctcctgaag caaatttttc ctttgagccg gaatttttga 120

tattccgagt tctttttttc cattcgcgga ggttattcca ttcctaaacg agtggccaca 180

atgaaacttc aattcatatc gaccgactat ttttctccga accaaaaaaa tagcagggcg 240

agattggagc tgcggaaaaa agaggaaaaa attttttcgt agttttcttg tgcaaattag 300

ggtgtaaggt ttctagggct tattggttca agcagaagag acaacaattg taggtcctaa 360

attcaaggcg gatgtaagga gtattggttt cgaaagtttt tccgaagcgg catggcaggg 420

actacttgcg catgcgctcg gattatcttc atttttgctt gcaaaaacgt agaatcatgg 480

taaattacat gaagaattct cttttttttt tttttttttt tttttttacc tctaaagagt 540

gttgaccaac tgaaaaaacc cttcttcaag agagttaaac taagactaac catcataact 600

tccaaggaat taatcgatat cttgcactcc tgatttttct tcaaagagac agcgcaaagg 660

attatgacac tgttgcattg agtcaaaagt ttttccgaag tgacccagtg ctcttttttt 720

ttttccgtga aggactgaca aatatgcgca caagatccaa tacgtaatgg aaattcggaa 780

aaactaggaa gaaatgctgc agggcattgc cgtgccgatc ttttgtcttt cagatatatg 840

agaaaaagaa tattcatcaa gtgctgatag aagaatacca ctcatatgac gtgggcagaa 900

gacagcaaac gtaaacatga gctgctgcga catttgatgg cttttatccg acaagccagg 960

aaactccacc attatctaat gtagcaaaat atttcttaac acccgaagtt gcgtgtcccc 1020

ctcacgtttt taatcatttg aattagtata ttgaaattat atataaaggc aacaatgtcc 1080

ccataatcaa ttccatctgg ggtctcatgt tctttcccca ccttaaaatc tataaagata 1140

tcataatcgt caactagttg atatacgtaa aatcatggac tacaacaaga gatcttcggt 1200

ctcaaccgtg cctaatgcag ctcc 1224

Claims (20)

1. A GAL regulatory system for expression of a foreign gene, wherein the GAL80 promoter is replaced with an HXT1 promoter.

2. The GAL regulatory system of claim 1, further comprising a GAL promoter,

preferably, the exogenous gene is operably linked to the GAL promoter,

preferably, the GAL promoter is one or more promoters selected from GAL1, GAL7, GAL2, or GAL 10.

3. The GAL regulatory system of claim 1, wherein the GAL10 gene, GAL1 gene, and/or GAL7 gene are silenced, preferably wherein the GAL10 gene, GAL1 gene, and/or GAL7 gene is knocked out.

4. The GAL regulatory system of claim 1, wherein the HXT1 promoter has the nucleotide sequence shown in SEQ ID No.1, or a nucleotide sequence that remains functionally identical to the nucleotide sequence shown in SEQ ID No.1 by addition, deletion, substitution of one or more bases.

5. A yeast cell comprising the GAL regulatory system for exogenous gene expression of any one of claims 1 to 4.

6. The yeast cell of claim 5, wherein the yeast is Saccharomyces cerevisiae.

7. The yeast cell according to claim 5 or 6, wherein the exogenous gene is a gene involved in the synthesis of a target product, preferably the target product is a terpenoid, preferably the terpenoid is selected from the group consisting of monoterpenes, sesquiterpenes and diterpenes, more preferably from the group consisting of β -carotene, lutein, canthaxanthin, astaxanthin, lycopene, artenadiene, artemisinin, taxadiene, paclitaxel, dammarenediol, α -santalene, tanshinone, squalene and ginsenosides.

8. The yeast cell according to claim 7, wherein the gene involved in the synthesis of the target product is operably linked to a GAL promoter, preferably the GAL promoter is selected from the group consisting of GAL1, GAL7, GAL2 and GAL10 promoters.

9. The yeast cell of claim 7, wherein the target product is β -carotene, wherein the tmgh 1 gene is operably linked to the pGAL1 promoter, the BtcrtE gene is operably linked to the GAL10 promoter, the btcryb gene is operably linked to the GAL1 promoter, and the BtcrtI gene is operably linked to the GAL10 promoter;

preferably, the GAL1 gene, GAL7 gene, and GAL10 gene are silenced;

preferably, the BtcrtE gene has the sequence of SEQ ID NO: 18, or a nucleotide sequence which has the same function with the nucleotide sequence shown in SEQ ID NO.18 through addition, deletion and substitution of one or more bases;

preferably, the BtcrtI gene has the amino acid sequence of SEQ ID NO: 19, or a nucleotide sequence which has the same function with the nucleotide sequence shown in SEQ ID NO.19 through addition, deletion and substitution of one or more bases;

preferably, the btcrtbb gene has SEQ ID NO: 20, or a nucleotide sequence which has the same function with the nucleotide sequence shown in SEQ ID NO.20 through addition, deletion and substitution of one or more bases.

10. The yeast cell according to claim 5 or 6, which is YLK-pHXT1-BT2 strain, which is classified and named Saccharomyces cerevisiae HEC-YLK9I-07, and is preserved in China Center for Type Culture Collection (CCTCC) at 11/18/2020 with the preservation number of CCTCC NO: m2020754.

11. A method for regulating expression of an exogenous gene in yeast, the method comprising expressing the exogenous gene using the GAL regulatory system of any one of claims 1-4 or using the yeast cell of any one of claims 5-10.

12. The method of claim 11, further comprising the step of adjusting the glucose concentration in the culture system.

13. The method according to claim 12, wherein the initial concentration of glucose in the culture system is in the range of 1% to 15%, preferably in the range of 2% to 10%, more preferably 10%.

14. The GAL regulatory system of any of claims 1-4, or the use of a yeast cell of any of claims 5-10 to regulate expression of a foreign gene.

15. The GAL regulatory system of any one of claims 1-4, or the use of a yeast cell of any one of claims 5-10, in the biosynthesis of a target product, preferably the target product is a terpenoid, preferably the terpenoid is selected from the group consisting of a monoterpene, a sesquiterpene, and a diterpene, more preferably from the group consisting of β -carotene, lutein, canthaxanthin, astaxanthin, lycopene, artenadiene, artemisinin, taxadiene, paclitaxel, dammarenediol, α -santalene, tanshinone, squalene, and ginsenoside.

16. A method for synthesizing β -carotene using yeast, said method comprising the step of producing β -carotene using the yeast cell of any one of claims 5 to 10 by fermentation.

17. The method according to claim 16, wherein the GAL regulatory system of the yeast cell replaces the GAL80 promoter with the HXT1 promoter and the beta-carotene synthesis pathway-related gene is expressed under the control of GAL1, GAL7, GAL2 or GAL10 promoter,

preferably, the tmgh 1 gene is operably linked to the pGAL1 promoter, the BtcrtE gene is operably linked to the GAL10 promoter, the btcryb gene is operably linked to the GAL1 promoter, and the BtcrtI gene is operably linked to the GAL10 promoter;

preferably, the GAL1 gene, GAL7 gene, and GAL10 gene are silenced;

preferably, the BtcrtE gene has the sequence of SEQ ID NO: 18, or a nucleotide sequence which has the same function with the nucleotide sequence shown in SEQ ID NO.18 through addition, deletion and substitution of one or more bases;

preferably, the BtcrtI gene has the amino acid sequence of SEQ ID NO: 19, or a nucleotide sequence which has the same function with the nucleotide sequence shown in SEQ ID NO.19 through addition, deletion and substitution of one or more bases;

preferably, the btcrtbb gene has SEQ ID NO: 20, or a nucleotide sequence which has the same function with the nucleotide sequence shown in SEQ ID NO.20 through addition, deletion and substitution of one or more bases.

18. The method according to claim 17, wherein the yeast cell is YLK-pHXT1-BT2 strain, which is classified and named as Saccharomyces cerevisiae HEC-YLK9I-07, and is preserved in China Center for Type Culture Collection (CCTCC) at 11/18/2020 with the preservation number of CCTCC NO: m2020754.

19. The method according to any one of claims 16 to 18, characterized in that it is performed by liquid fermentation, the liquid medium comprising 20-120g/L glucose, 5-9g/L ammonium sulfate, 1-4g/L yeast powder, 1-4g/L peptone, 10-40g/L corn steep liquor, 3-7g/L potassium dihydrogen phosphate, 1-4g/L magnesium sulfate, 0.5-3g/L zinc sulfate, 1150-2500 mg/L vitamin B, 3150-250mg/L vitamin B, 6150-250mg vitamin B.

20. The method according to any one of claims 16 to 18, characterized in that the pH of the medium is controlled between 5 and 6 during fermentation, preferably the different carbon sources are supplemented in stages during fermentation, preferably glucose is supplemented to maintain a concentration of not less than 2g/L for a fermentation time of not more than 20-30 hours, preferably ethanol is exchanged for carbon source after 20-30 hours of fermentation, preferably dissolved oxygen is controlled between 25-35% during fermentation.

Images