CN107987138A - Gal4 Thermo-sensitive mutants, recombinant expression carrier, temperature regulation system and its application - Google Patents
Gal4 Thermo-sensitive mutants, recombinant expression carrier, temperature regulation system and its application Download PDFInfo
- Publication number
- CN107987138A CN107987138A CN201711403958.5A CN201711403958A CN107987138A CN 107987138 A CN107987138 A CN 107987138A CN 201711403958 A CN201711403958 A CN 201711403958A CN 107987138 A CN107987138 A CN 107987138A
- Authority
- CN
- China
- Prior art keywords
- ser
- leu
- thr
- asn
- ile
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
- C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
- C07K14/395—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
- C12P5/007—Preparation of hydrocarbons or halogenated hydrocarbons containing one or more isoprene units, i.e. terpenes
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Chemical & Material Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention provides Gal4 Thermo-sensitive mutants, and temperature regulation system and its application are built in saccharomyces cerevisiae using its mutant.The temperature control manipulation built using Gal4 Thermo-sensitive mutants is simple, without adding derivant/inhibitor, realizes the finely regulating to metabolic fluxes.Be conducive to the production of other materials big to cytotoxicity.
Description
Technical field
The invention belongs to genetic engineering and enzyme engineering field, and in particular to a kind of orthogenesis transformation yeast transcriptional activation egg
White Gal4, and the expression system using the structure temperature regulation and control of improved Gal4 mutains and its application.
Background technology
With the development of metabolic engineering and synthetic biology, by saccharomyces cerevisiae expressing heterologous gene produce
Chemicals becomes more and more popular.But the protease in approach is overexpressed and the intermediate accumulation of exogenous metabolism approach, often
Toxic action is often caused on host cell so as to influence cell growth.Therefore exploitation accuracy controlling foreign gene expression to close weight
Will.
Galactolipin regulating networks are a common efficient systems for being used for gene expression in saccharomyces cerevisiae at present, at this
Gal4 can identify the upstream activating sequence (UASg) of GAL gene promoters in a system, activate the transcription of said gene.In addition this
The transcription of GAL4 is subject to the close adjusting of extraneous carbon source in a system, and yeast cells is grown in the culture environment of no galactolipin
When, Gal80 can be specifically bound with Gal4, the combination of Gal4 albumen and GAL gene promoter areas be prevented, so as to suppress GAL
The expression of gene.But since the derivant can be consumed during the fermentation, it is necessary to add frequently, and price is costly,
Therefore this strategy is in large scale fermentation and uneconomical.There is research by knocking out GAL80, the transcription of GAL4 is only subject to high Portugal
Grape Glyco inhabiting, low glucose induction.And controllable isoprenoid height is successfully constructed in saccharomyces cerevisiae using the system
Imitate route of synthesis.But using glucose carry out the expression regulation of long approach in practical operation it is not rigorous, usually occur
Leakage expression.And the complex process in high density fermentation, gene expression are difficult to realize artificial control.Therefore albumen work is passed through
Journey means further transform Gal4, it is become one kind without the help of derivant/inhibitor, but by perceiving temperature
Changing to realize the regulation and control finer to metabolic pathway for degree medium exchange, finally makes the growth of thalline and the accumulation phase of product
Coordination is of great significance.
The content of the invention
The Gal4 protein mutants of temperature sensitive type are obtained the purpose of the present invention is the method by orthogenesis, to realize
In saccharomyces cerevisiae build temperature regulation system for the purpose of and apply it to metabolism product production in.
To achieve these goals, the present invention uses following technical scheme：
The present invention provides Gal4 Thermo-sensitive mutants, the nucleotide sequence of the mutant is selected from following sequence：
SEQ ID NO in sequence table:6 amino acid sequence；
SEQ ID NO in sequence table:7 amino acid sequence；
SEQ ID NO in sequence table:8 amino acid sequence；
SEQ ID NO in sequence table:9 amino acid sequence；
SEQ ID NO in sequence table:10 amino acid sequence.
SEQ ID NO wherein in sequence table:6 amino acid sequence names Gal4M9, bright relative to wild type its 69th
Propylhomoserin becomes proline, and the 356th alanine becomes threonine；SEQ ID NO in sequence table:7 amino acid sequence life
Name Gal4M61, relative to wild type, its 385th valine becomes aspartic acid；SEQ ID NO in sequence table:8 amino
Acid sequence names Gal4M63, and relative to wild type, its 63rd arginine becomes glycine, and the 194th asparagine becomes
Aspartic acid；SEQ ID NO in sequence table:9 amino acid sequence name Gal4M153, relative to wild type its 196th
Phenylalanine becomes leucine, and the 297th glutamic acid becomes glycine, and the 361st becomes serine for leucine；Sequence
SEQ ID NO in table:10 amino acid sequence name Gal4M414, relative to wild type, its 208th serine becomes dried meat
Propylhomoserin.
Further, the nucleotide sequence for encoding Gal4 Thermo-sensitive mutants is selected from one sequence：
SEQ ID NO:Nucleotide sequence shown in 1；
SEQ ID NO:Nucleotide sequence shown in 2；
SEQ ID NO:Nucleotide sequence shown in 3；
SEQ ID NO:Nucleotide sequence shown in 4；
SEQ ID NO:Nucleotide sequence shown in 5；
SEQ ID NO:Nucleotide sequence shown in 6.
It is any to pass through missing to amino acid in above-mentioned shown amino acid sequence, be inserted into or replace one or several amino acid simultaneously
There is the sequence of at least 70% homology, and the Gal4 with temperature sensitizing effect with above-mentioned several sequences in amino acid levels,
I.e. in 30 DEG C of activity, 25 DEG C of low temperature or the high mutant protein of following activity still fall within protection scope of the present invention.
The GAL4 gene sources of the wild type used in the present invention are in saccharomyces cerevisiae BY4741 (ATCC201388)
(GenBank：NM_001184062.1) and No. NCBI of amino acid sequence is DAA11189.1.Use using lycopene as color
The high-throughput screening method of instruction, realizes Gal4 orthogenesis so as to obtain temperature sensitive type mutant strain.
The present invention also provides the preparation method of above-mentioned Gal4 Thermo-sensitive mutants, specifically include：
GAL4 gene mutation bodies storehouse is established by fallibility round pcr first；
Then GAL4 mutation libraries are screened as instruction using the color change of lycopene：
The specific method of orthogenesis：Gene in lycopene route of synthesis is placed under GAL1-10 promoters, is made kind
The synthetic quantity of Lycopene and Gal4 activating transcription factors are closely related, after saccharomyces cerevisiae GAL4 genes itself are knocked out, will be unable to
The transcription of gene under GAL promoters is activated, is synthesized at this time without related lycopene, as heterogenous expression Gal4, lycopene is opened
Begin to synthesize；
Choosing 30 DEG C of activity reduces or still loses completely, 21 DEG C of temperature sensitive type Gal4 albumen for recovering or partly recovering function.
The present invention also provides a kind of recombinant expression carrier, the recombinant expression carrier, which includes, encodes above-mentioned amino acid sequence
Row.The expression vector comprising temperature sensitive type Gal4M9 albumen builds to obtain by the following method in one embodiment of the invention：With
ACT1 promoter SEQ ID NO:11 sequences are replaced in saccharomyces cerevisiae integrating vector PUMRI-15, are obtained containing ACT1 promoters
The integrated expression plasmid PUMRI-P of saccharomyces cerevisiaeACT1, then by the SEQ ID NO in the present invention:3 sequences are inserted into integrated table
Up to plasmid PUMRI-PACT1In, obtain PUMRI-PACT1-GAL4M9。
The present invention also provides genetic engineering bacterium, the genetic engineering bacterium is converted to the micro- life of host by above-mentioned recombinant expression carrier
Obtained in thing.Specifically, the genetic engineering office of the present invention is saccharomyces cerevisiae engineered yeast.
The present invention also provides temperature regulation system is built in saccharomyces cerevisiae using above-mentioned Gal4 Thermo-sensitive mutants
Method, knocks out GAL80 genes on S. cerevisiae chromosomal, GAL systems is no longer controlled by galactolipin, further use HIS3 first
Label knocks out GAL4；Then by expression vector PUMRI-PACT1- GAL4M9 is incorporated into yeast chromosomal, and structure is temperature sensitive
GAL systems.
Gal4 Thermo-sensitive mutants the present invention also provides above-mentioned structure build temperature regulation system in saccharomyces cerevisiae.
Further, the present invention gives Gal4 Thermo-sensitive mutants and temperature regulation system is built in saccharomyces cerevisiae in class
Application in carrotene synthesis.
Gene in carotenogenesis approach is placed in GAL1-GAL10 promoters, the wine of structure production carotenoid
Brewer yeast engineered strain, realizes the growth phase of engineered strain and the regulation and control stage by stage in Product formation stage of production carotenoid.
Further, the carotenoid is astaxanthin or lycopene.
Before yeast growth reaches stationary phase, it is placed at 30 DEG C and cultivates, in this stage, the biomass of yeast cells increases
Add, and the related gene of carotenogenesis is suppressed and does not express；After stationary phase is reached, yeast is placed in 24 DEG C of continuation
Culture, related gene start to express.In order to improve the yield of astaxanthin, the optimum time point of this project temperature change as much as possible
For the logarithmic growth middle and later periods.
The beneficial effect of patent of the present invention includes：
(1) realize a kind of simple and effective high-throughput screening method by the use of lycopene as indicator, obtain Gal4 temperature
Quick type mutant, and temperature regulation system and its application are built in saccharomyces cerevisiae using its mutant.It is temperature sensitive using Gal4
The temperature control manipulation of type mutation construction is simple, without adding derivant/inhibitor, realizes the finely regulating to metabolic fluxes.
Be conducive to the production of other materials big to cytotoxicity.
(2) for the problem that the contradiction between cell growth and product accumulation, long route of synthesis metabolic regulation is solved, is made thin
Intracellular growth is mutually coordinated with product accumulation, and the reference of theoretical and method is provided for the regulation and control of other long metabolic pathways.
(3) regulation and control are sensitive to temperature-responsive, and when temperature goes to low temperature, foreign gene is expressed rapidly.Be conducive to highly dense
In degree fermentation
Operation.
Brief description of the drawings
Fig. 1 is the policy map for GAL4 orthogenesis；
Fig. 2 is pUMRI-PACT1- GALM9 plasmid maps；
Fig. 3 is the Yield mapping of the lycopene bacterial strain of temperature sensitive type；
Fig. 4 is the fluorescence proof diagram of temperature regulation system sensitiveness, and wherein A is 21 DEG C of cultures for 30 DEG C of cultures 72h, B
72h；
Fig. 5 is the metabolic regulation schematic diagram that temperature regulation system controls carotenoid production.
Embodiment
Technical scheme is further elaborated with specific embodiment below in conjunction with the accompanying drawings, but the present invention
Protection domain is not limited to that
Embodiment 1 obtains the basic procedure of temperature sensitive type GAL4 orthogenesis
The orthogenesis reconstruction flow of GAL4 is as shown in Figure 1.Using NotI/SalI by digestion p416XWP-PERG9- GAL4,
It is spare to recycle carrier framework.With ERG9-F2 (GAAGAGCAGAAGCGGAAAAC) and GAL4D-R1
(TTGTGAAAACTTGTAAGAGC) it is primer, p416XW-PERG9- GAL4 carries out part functional domains before GAL4 for template
Fallibility PCR amplification.Due to Mn2+The base mispairing rate of PCR processes can be increased, when carrying out fallibility PCR using Taq enzyme, in body
A certain amount of MnCl is added in system2To increase the gene mutation rate during PCR.Error-prone PCR systems are：
The p416XW-P of NotI/SacI digestionsERG9The fallibility PCR product both ends of-GAL4 carrier frameworks and GAL4 respectively have
The homology segment of about 50bp, by its cotransformation to knocked out GAL80 and GAL4 and be overexpressed tHMG1, crtE03M,
In the host strain of crtYB11M, crtI, the mutant library of GAL4 can be established.When mutant Gal4 is active, can activate
The lycopene approach of silence, bacterial strain is once existing red on tablet, and when Gal4 is inactive or active low, bacterium colony is once existing
White or light color.Therefore GAL4 mutation libraries are screened as instruction using the color change of bacterial strain lycopene.Choose
30 DEG C of nonfunctionals, bacterium colony once show white, then go to 21 DEG C of recovery activation functions, the bacterium colony of color burn is required temperature
The bacterium colony of quick type, in order to verify that further verification confirms the Thermo-sensitive of Gal4 saltant types, it is necessary to by the plasmid extraction in yeast, turns
Change and expanded into Escherichia coli, is sequenced, and be incorporated into new brewing yeast cell again and further verified.
The acquisition of 2 temperature sensitive type Gal4 mutant of embodiment
The Gal4 mutant of 5 plants of temperature sensitive types is obtained by the method for embodiment 1.Matter is carried out from 5 plants of temperature sensitive type yeast
Grain extracting, is transformed into Escherichia coli and expands, and is sequenced.The sequence analysis of mutant such as table 1 below：
Table 1 is mutated the sequence analysis table of figure
Embodiment 3 includes the structure of the saccharomyces cerevisiae expression of temperature sensitive type GAL4 mutant
Use PACT1F (TTATCGGATCCTCAAAACCCTTAAAAAC) and PACT1R
(CCCGAATTCTGTTAATTCAGTAAATTTTCGATCT) PCR expands from saccharomyces cerevisiae BY4741 (ATCC201388) genome
Increase and ACT1 promoters, then with BamHI and EcoRI double digestions, fragment and same double digestion after obtained digestion
PUMRI-15 plasmids (Zhou et al.2015) connection does conversion and constructs PUMRI-PACT1Plasmid.Then by embodiment 2 these
Mutant NotI and SacI double digestions, obtain mutator and the PUMRI-P after same NotI and SacI double digestionsACT1Plasmid
Connection conversion, constructs the saccharomyces cerevisiae expression PUMRI-P containing temperature sensitive type GAL4 mutantACT1-GAL4M9
(GAL4M61, GAL4M63, GAL4M153 or GAL4M414).pUMRI-PACT1- GALM9 plasmid maps are as shown in Figure 2.
Embodiment 4 produces the regulator control system structure of lycopene temperature sensitive type
The knockout box that a HIS3 strikes GAL4, GAL4-HisF1 are built first
(GCCTTTTTCTGTTTTATGAGCTACTAGTACACTCTATATTTTT) and GAL4-HisXF1
(CTATCCGTAATCATGGTCGGCTACATAAGAACACCTTTGG) from PUG23 (GenBank:AF298783.1 table) is amplified
Up to the fragment 1 of HIS3, with GAL4-CyF (AACCCAGAATCCCCTATACTAA) and GAL4-HISR1
(AAAATATAGAGTGTACTAGTAGCTCATAAAACAGAAAAAGGC) amplified from saccharomyces cerevisiae BY4741 genomes
It is fragment 2 to swim homology arm, with GAL4-His-XR1 (CCAAAGGTGTTCTTATGTAGCCGACCATGATTACGGATAG) and
GAL4-XinF1 (AATTGGATCTCCCAAGAGTA) amplifies downstream homology arm from saccharomyces cerevisiae BY4741 genomes
3 fragments are done Overlap extension PCR and obtain HIS and strike GAL4 fragment SEQ ID NO by fragment 3:12.Fragment is transferred to wine brewing ferment
GAL4 is knocked out in female BY4741.With pESC-LEU (GenBank:AF063849.1 it is) template, with marker-F
(ATTTACCGGCGCACTCTCGCCCGAACGACCTCAAAATGTCTGTGCGGTATTTCACA CCG) and marker-R
(TTTATAACGTTCGCTGCACTGGGGGCCAAGCACAGGGCAAGATTGTACTGAGAGTG CAC) carries out PCR for primer, will
PCR fragment is transferred to above-mentioned bacterial strain, Leu is marked polishing, while GAL80 is knocked out.Then by pUMRI-10-LYC01 (Xie
Et al.2015) linearized with SfiI after be transformed into and knock out structure in GAL80 and GAL4 saccharomyces cerevisiaes BY4741 and have tomato
The bacterial strain of red pigment silence pathway gene, the expression vector comprising temperature sensitive type GAL4 mutant for then building embodiment 3 are used
It is incorporated into after the linearisation of SfiI enzymes on the chromosome of above-mentioned bacterial strains, has obtained the bacterial strain of production 5 plants of temperature sensitive types of lycopene, find
By temperature from when going to 21 degree for 30 degree, induce the yield of lycopene of generation best.Fig. 3 is exactly the production tomato red of 5 plants of temperature sensitive types
The Yield mapping of plain bacterium.The bacterial strain effect of wherein Gal4M9 controls is best.
The Fluorescent Characterization regulation of temperature system of embodiment 5
With EGFP-F (GCGGAATTCATGTCTAAAGGTGAAGAATTAT) and EGFP-R1
(CCTTAGATCTTTATTTGTACAATTCATCCATACC) with PUG23 (GenBank:AF298783.1) it is template PCR amplifications
Go out EGFP fragments, then with EcoRI and BglII double digestions and equally with the pUMRI-11 (GenBank of the two enzyme digestions:
KM216413) plasmid connection converts, and clone obtains pUMRI-11-EGFP.PUMRI-11-EGFP SfiI enzymes are linearized,
Then the fragment of this linearisation is gone in embodiment 4 in knockout GAL80 and the GAL4 bacterial strain built by way of electricity turns,
Then the PUMRI-P again built embodiment 3ACT1- GAL4M9 plasmids are linearized with SfiI, are gone in above-mentioned yeast, are constructed
By temperature control Gal4M9 activity, and Gal4M9 controls the regulator control system of EGFP expression, if Fig. 4 is the fluorescence table that temperature regulates and controls
Sign figure, in 30 degree cultures, less fluorescence, is hardly expressed, and when going to 21 degree, fluorescence is substantially very bright.
6 temperature regulation system of embodiment is applied in production is metabolized
If Fig. 5 is the metabolic regulation schematic diagram that temperature regulation system controls carotenoid to produce.By chemical activators approach
In gene be placed under GAL promoters, it is other structure flows as described in Example 4, can build temperature with the GalM9 of temperature sensitive type
The chemical activators system of regulation and control, the regulator control system are not limited to the production of carotenoid, the gene in other products approach
It is placed in this this regulator control system, the regulation and control of similar temperature-responsive can also be built, therefore also in the protection model of the present invention
Enclose.
SEQUENCE LISTING
<110>Zhejiang University
<120>Gal4 Thermo-sensitive mutants, recombinant expression carrier, temperature regulation system and its application
<130> 2017
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 2646
<212> DNA
<213>Artificial sequence
<400> 1
atgaagctac tgtcttctat cgaacaagca tgcgatattt gccgacttaa aaagctcaag 60
tgctccaaag aaaaaccgaa gtgcgccaag tgtctgaaga acaactggga gtgtcgctac 120
tctcccaaaa ccaaaaggtc tccgctgact agggcacatc tgacagaagt ggaatcaagg 180
ctagaaagac tggaacagct atttccactg atttttcctc gagaagacct tgacatgatt 240
ttgaaaatgg attctttaca ggatataaaa gcattgttaa caggattatt tgtacaagat 300
aatgtgaata aagatgccgt cacagataga ttggcttcag tggagactga tatgcctcta 360
acattgagac agcatagaat aagtgcgaca tcatcatcgg aagagagtag taacaaaggt 420
caaagacagt tgactgtatc gattgactcg gcagctcatc atgataactc cacaattccg 480
ttggatttta tgcccaggga tgctcttcat ggatttgatt ggtctgaaga ggatgacatg 540
tcggatggct tgcccttcct gaaaacggac cccaacaata atgggttctt tggcgacggt 600
tctctcttat gtattcttcg atctattggc tttaaaccgg aaaattacac gaactctaac 660
gttaacaggc tcccgaccat gattacggat agatacacgt tggcttctag atccacaaca 720
tcccgtttac ttcaaagtta tctcaataat tttcacccct actgccctat cgtgcactca 780
ccgacgctaa tgatgttgta taataaccag attgaaatcg cgtcgaagga tcaatggcaa 840
atccttttta actgcatatt agccattgga gcctggtgta tagaggggga atctactgat 900
atagatgttt tttactatca aaatgctaaa tctcatttga cgagcaaggt cttcgagtca 960
ggttccataa ttttggtgac agccctacat cttctgtcgc gatatacaca gtggaggcag 1020
aaaacaaata ctagctataa ttttcacagc ttttccataa gaatgaccat atcattgggc 1080
ttgaataggg acctcccctc gtccttcagt gatagcagca ttctggaaca aagacgccga 1140
atttggtggt ctgtctactc ttgggagatc caattgtccc tgctttatgg tcgatccatc 1200
cagctttctc agaatacaat ctccttccct tcttctgtcg acgatgtgca gcgtaccaca 1260
acaggtccca ccatatatca tggcatcatt gaaacagcaa ggctcttaca agttttcaca 1320
aaaatctatg aactagacaa aacagtaact gcagaaaaaa gtcctatatg tgcaaaaaaa 1380
tgcttgatga tttgtaatga gattgaggag gtttcgagac aggcaccaaa gtttttacaa 1440
atggatattt ccaccaccgc tctaaccaat ttgttgaagg aacacccttg gctatccttt 1500
acaagattcg aactgaagtg gaaacagttg tctcttatca tttatgtatt aagagatttt 1560
ttcactaatt ttacccagaa aaagtcacaa ctagaacagg atcaaaatga tcatcaaagt 1620
tatgaagtta aacgatgctc catcatgtta agcgatgcag cacaaagaac tgttatgtct 1680
gtaagtagct atatggacaa tcataatgtc accccatatt ttgcctggaa ttgttcttat 1740
tacttgttca atgcagtcct agtacccata aagactctac tctcaaactc aaaatcgaat 1800
gctgagaata acgagaccgc acaattatta caacaaatta acactgttct gatgctatta 1860
aaaaaactgg ccacttttaa aatccagact tgtgaaaaat acattcaagt actggaagag 1920
gtatgtgcgc cgtttctgtt atcacagtgt gcaatcccat taccgcatat cagttataac 1980
aatagtaatg gtagcgccat taaaaatatt gtcggttctg caactatcgc ccaataccct 2040
actcttccgg aggaaaatgt caacaatatc agtgttaaat atgtttctcc tggctcagta 2100
gggccttcac ctgtgccatt gaaatcagga gcaagtttca gtgatctagt caagctgtta 2160
tctaaccgtc caccctctcg taactctcca gtgacaatac caagaagcac accttcgcat 2220
cgctcagtca cgccttttct agggcaacag caacagctgc aatcattagt gccactgacc 2280
ccgtctgctt tgtttggtgg cgccaatttt aatcaaagtg ggaatattgc tgatagctca 2340
ttgtccttca ctttcactaa cagtagcaac ggtccgaacc tcataacaac tcaaacaaat 2400
tctcaagcgc tttcacaacc aattgcctcc tctaacgttc atgataactt catgaataat 2460
gaaatcacgg ctagtaaaat tgatgatggt aataattcaa aaccactgtc acctggttgg 2520
acggaccaaa ctgcgtataa cgcgtttgga atcactacag ggatgtttaa taccactaca 2580
atggatgatg tatataacta tctattcgat gatgaagata ccccaccaaa cccaaaaaaa 2640
gagtaa 2646
<210> 2
<211> 2646
<212> DNA
<213>Artificial sequence
<400> 2
atgaagctac tgtcttctat cgaacaagca tgcgatattt gccgacttaa aaagctcaag 60
tgctccaaag aaaaaccgaa gtgcgccaag tgtctgaaga acaactggga gtgtcgctac 120
tctcccaaaa ccaaaaggtc tccgctgact agggcacatc tgacagaagt ggaatcaagg 180
ctagaaagac tggaacagct atttctactg atttttcctc gagaagacct tgacatgatt 240
ttgaaaatgg attctttaca ggatataaaa gcattgttaa caggattatt tgtacaagat 300
aatgtgaata aagatgccgt cacagataga ttggcttcag tggagactga tatgcctcta 360
acattgagac agcatagaat aagtgcgaca tcatcatcgg aagagagtag taacaaaggt 420
caaagacagt tgactgtatc gattgactcg gcagctcatc atgataactc cacaattccg 480
ttggatttta tgcccaggga tgctcttcat ggatttgatt ggtctgaaga ggatgacatg 540
tcggatggct tgcccttcct gaaaacggac cccaacaata atgggttctt tggcgacggt 600
tctctcttat gtattcttcg atctattggc tttaaaccgg aaaattacac gaactctaac 660
gttaacaggc tcccgaccat gattacggat agatacacgt tggcttctag atccacaaca 720
tcccgtttac ttcaaagtta tctcaataat tttcacccct actgccctat cgtgcactca 780
ccgacgctaa tgatgttgta taataaccag attgaaatcg cgtcgaagga tcaatggcaa 840
atccttttta actgcatatt agccattgga gcctggtgta tagaggggga atctactgat 900
atagatgttt tttactatca aaatgctaaa tctcatttga cgagcaaggt cttcgagtca 960
ggttccataa ttttggtgac agccctacat cttctgtcgc gatatacaca gtggaggcag 1020
aaaacaaata ctagctataa ttttcacagc ttttccataa gaatggccat atcattgggc 1080
ttgaataggg acctcccctc gtccttcagt gatagcagca ttctggaaca aagacgccga 1140
atttggtggt ctgactactc ttgggagatc caattgtccc tgctttatgg tcgatccatc 1200
cagctttctc agaatacaat ctccttccct tcttctgtcg acgatgtgca gcgtaccaca 1260
acaggtccca ccatatatca tggcatcatt gaaacagcaa ggctcttaca agttttcaca 1320
aaaatctatg aactagacaa aacagtaact gcagaaaaaa gtcctatatg tgcaaaaaaa 1380
tgcttgatga tttgtaatga gattgaggag gtttcgagac aggcaccaaa gtttttacaa 1440
atggatattt ccaccaccgc tctaaccaat ttgttgaagg aacacccttg gctatccttt 1500
acaagattcg aactgaagtg gaaacagttg tctcttatca tttatgtatt aagagatttt 1560
ttcactaatt ttacccagaa aaagtcacaa ctagaacagg atcaaaatga tcatcaaagt 1620
tatgaagtta aacgatgctc catcatgtta agcgatgcag cacaaagaac tgttatgtct 1680
gtaagtagct atatggacaa tcataatgtc accccatatt ttgcctggaa ttgttcttat 1740
tacttgttca atgcagtcct agtacccata aagactctac tctcaaactc aaaatcgaat 1800
gctgagaata acgagaccgc acaattatta caacaaatta acactgttct gatgctatta 1860
aaaaaactgg ccacttttaa aatccagact tgtgaaaaat acattcaagt actggaagag 1920
gtatgtgcgc cgtttctgtt atcacagtgt gcaatcccat taccgcatat cagttataac 1980
aatagtaatg gtagcgccat taaaaatatt gtcggttctg caactatcgc ccaataccct 2040
actcttccgg aggaaaatgt caacaatatc agtgttaaat atgtttctcc tggctcagta 2100
gggccttcac ctgtgccatt gaaatcagga gcaagtttca gtgatctagt caagctgtta 2160
tctaaccgtc caccctctcg taactctcca gtgacaatac caagaagcac accttcgcat 2220
cgctcagtca cgccttttct agggcaacag caacagctgc aatcattagt gccactgacc 2280
ccgtctgctt tgtttggtgg cgccaatttt aatcaaagtg ggaatattgc tgatagctca 2340
ttgtccttca ctttcactaa cagtagcaac ggtccgaacc tcataacaac tcaaacaaat 2400
tctcaagcgc tttcacaacc aattgcctcc tctaacgttc atgataactt catgaataat 2460
gaaatcacgg ctagtaaaat tgatgatggt aataattcaa aaccactgtc acctggttgg 2520
acggaccaaa ctgcgtataa cgcgtttgga atcactacag ggatgtttaa taccactaca 2580
atggatgatg tatataacta tctattcgat gatgaagata ccccaccaaa cccaaaaaaa 2640
gagtaa 2646
<210> 3
<211> 2646
<212> DNA
<213>Artificial sequence
<400> 3
atgaagctac tgtcttctat cgaacaagca tgcgatattt gccgacttaa aaagctcaag 60
tgctccaaag aaaaaccgaa gtgcgccaag tgtctgaaga acaactggga gtgtcgctac 120
tctcccaaaa ccaaaaggtc tccgctgact agggcacatc tgacagaagt ggaatcaagg 180
ctagaaggac tggaacagct atttctactg atttttcctc gagaagacct tgacatgatt 240
ttgaaaatgg attctttaca ggatataaaa gcattgttaa caggattatt tgtacaagat 300
aatgtgaata aagatgccgt cacagataga ttggcttcag tggagactga tatgcctcta 360
acattgagac agcatagaat aagtgcgaca tcatcatcgg aagagagtag taacaaaggt 420
caaagacagt tgactgtatc gattgactcg gcagctcatc atgataactc cacaattccg 480
ttggatttta tgcccaggga tgctcttcat ggatttgatt ggtctgaaga ggatgacatg 540
tcggatggct tgcccttcct gaaaacggac cccaacaatg atgggttctt tggcgacggt 600
tctctcttat gtattcttcg atctattggc tttaaaccgg aaaattacac gaactctaac 660
gttaacaggc tcccgaccat gattacggat agatacacgt tggcttctag atccacaaca 720
tcccgtttac ttcaaagtta tctcaataat tttcacccct actgccctat cgtgcactca 780
ccgacgctaa tgatgttgta taataaccag attgaaatcg cgtcgaagga tcaatggcaa 840
atccttttta actgcatatt agccattgga gcctggtgta tagaggggga atctactgat 900
atagatgttt tttactatca aaatgctaaa tctcatttga cgagcaaggt cttcgagtca 960
ggttccataa ttttggtgac agccctacat cttctgtcgc gatatacaca gtggaggcag 1020
aaaacaaata ctagctataa ttttcacagc ttttccataa gaatggccat atcattgggc 1080
ttgaataggg acctcccctc gtccttcagt gatagcagca ttctggaaca aagacgccga 1140
atttggtggt ctgtctactc ttgggagatc caattgtccc tgctttatgg tcgatccatc 1200
cagctttctc agaatacaat ctccttccct tcttctgtcg acgatgtgca gcgtaccaca 1260
acaggtccca ccatatatca tggcatcatt gaaacagcaa ggctcttaca agttttcaca 1320
aaaatctatg aactagacaa aacagtaact gcagaaaaaa gtcctatatg tgcaaaaaaa 1380
tgcttgatga tttgtaatga gattgaggag gtttcgagac aggcaccaaa gtttttacaa 1440
atggatattt ccaccaccgc tctaaccaat ttgttgaagg aacacccttg gctatccttt 1500
acaagattcg aactgaagtg gaaacagttg tctcttatca tttatgtatt aagagatttt 1560
ttcactaatt ttacccagaa aaagtcacaa ctagaacagg atcaaaatga tcatcaaagt 1620
tatgaagtta aacgatgctc catcatgtta agcgatgcag cacaaagaac tgttatgtct 1680
gtaagtagct atatggacaa tcataatgtc accccatatt ttgcctggaa ttgttcttat 1740
tacttgttca atgcagtcct agtacccata aagactctac tctcaaactc aaaatcgaat 1800
gctgagaata acgagaccgc acaattatta caacaaatta acactgttct gatgctatta 1860
aaaaaactgg ccacttttaa aatccagact tgtgaaaaat acattcaagt actggaagag 1920
gtatgtgcgc cgtttctgtt atcacagtgt gcaatcccat taccgcatat cagttataac 1980
aatagtaatg gtagcgccat taaaaatatt gtcggttctg caactatcgc ccaataccct 2040
actcttccgg aggaaaatgt caacaatatc agtgttaaat atgtttctcc tggctcagta 2100
gggccttcac ctgtgccatt gaaatcagga gcaagtttca gtgatctagt caagctgtta 2160
tctaaccgtc caccctctcg taactctcca gtgacaatac caagaagcac accttcgcat 2220
cgctcagtca cgccttttct agggcaacag caacagctgc aatcattagt gccactgacc 2280
ccgtctgctt tgtttggtgg cgccaatttt aatcaaagtg ggaatattgc tgatagctca 2340
ttgtccttca ctttcactaa cagtagcaac ggtccgaacc tcataacaac tcaaacaaat 2400
tctcaagcgc tttcacaacc aattgcctcc tctaacgttc atgataactt catgaataat 2460
gaaatcacgg ctagtaaaat tgatgatggt aataattcaa aaccactgtc acctggttgg 2520
acggaccaaa ctgcgtataa cgcgtttgga atcactacag ggatgtttaa taccactaca 2580
atggatgatg tatataacta tctattcgat gatgaagata ccccaccaaa cccaaaaaaa 2640
gagtaa 2646
<210> 4
<211> 2646
<212> DNA
<213>Artificial sequence
<400> 4
atgaagctac tgtcttctat cgaacaagca tgcgatattt gccgacttaa aaagctcaag 60
tgctccaaag aaaaaccgaa gtgcgccaag tgtctgaaga acaactggga gtgtcgctac 120
tctcccaaaa ccaaaaggtc tccgctgact agggcacatc tgacagaagt ggaatcaagg 180
ctagaaagac tggaacagct atttctactg atttttcctc gagaagacct tgacatgatt 240
ttgaaaatgg attctttaca ggatataaaa gcattgttaa caggattatt tgtacaagat 300
aatgtgaata aagatgccgt cacagataga ttggcttcag tggagactga tatgcctcta 360
acattgagac agcatagaat aagtgcgaca tcatcatcgg aagagagtag taacaaaggt 420
caaagacagt tgactgtatc gattgactcg gcagctcatc atgataactc cacaattccg 480
ttggatttta tgcccaggga tgctcttcat ggatttgatt ggtctgaaga ggatgacatg 540
tcggatggct tgcccttcct gaaaacggac cccaacaata atgggctctt tggcgacggt 600
tctctcttat gtattcttcg atctattggc tttaaaccgg aaaattacac gaactctaac 660
gttaacaggc tcccgaccat gattacggat agatacacgt tggcttctag atccacaaca 720
tcccgtttac ttcaaagtta tctcaataat tttcacccct actgccctat cgtgcactca 780
ccgacgctaa tgatgttgta taataaccag attgaaatcg cgtcgaagga tcaatggcaa 840
atccttttta actgcatatt agccattgga gcctggtgta tagagggggg atctactgat 900
atagatgttt tttactatca aaatgctaaa tctcatttga cgagcaaggt cttcgagtca 960
ggttccataa ttttggtgac agccctacat cttctgtcgc gatatacaca gtggaggcag 1020
aaaacaaata ctagctataa ttttcacagc ttttccataa gaatggccat atcattgggc 1080
tcgaataggg acctcccctc gtccttcagt gatagcagca ttctggaaca aagacgccga 1140
atttggtggt ctgtctactc ttgggagatc caattgtccc tgctttatgg tcgatccatc 1200
cagctttctc agaatacaat ctccttccct tcttctgtcg acgatgtgca gcgtaccaca 1260
acaggtccca ccatatatca tggcatcatt gaaacagcaa ggctcttaca agttttcaca 1320
aaaatctatg aactagacaa aacagtaact gcagaaaaaa gtcctatatg tgcaaaaaaa 1380
tgcttgatga tttgtaatga gattgaggag gtttcgagac aggcaccaaa gtttttacaa 1440
atggatattt ccaccaccgc tctaaccaat ttgttgaagg aacacccttg gctatccttt 1500
acaagattcg aactgaagtg gaaacagttg tctcttatca tttatgtatt aagagatttt 1560
ttcactaatt ttacccagaa aaagtcacaa ctagaacagg atcaaaatga tcatcaaagt 1620
tatgaagtta aacgatgctc catcatgtta agcgatgcag cacaaagaac tgttatgtct 1680
gtaagtagct atatggacaa tcataatgtc accccatatt ttgcctggaa ttgttcttat 1740
tacttgttca atgcagtcct agtacccata aagactctac tctcaaactc aaaatcgaat 1800
gctgagaata acgagaccgc acaattatta caacaaatta acactgttct gatgctatta 1860
aaaaaactgg ccacttttaa aatccagact tgtgaaaaat acattcaagt actggaagag 1920
gtatgtgcgc cgtttctgtt atcacagtgt gcaatcccat taccgcatat cagttataac 1980
aatagtaatg gtagcgccat taaaaatatt gtcggttctg caactatcgc ccaataccct 2040
actcttccgg aggaaaatgt caacaatatc agtgttaaat atgtttctcc tggctcagta 2100
gggccttcac ctgtgccatt gaaatcagga gcaagtttca gtgatctagt caagctgtta 2160
tctaaccgtc caccctctcg taactctcca gtgacaatac caagaagcac accttcgcat 2220
cgctcagtca cgccttttct agggcaacag caacagctgc aatcattagt gccactgacc 2280
ccgtctgctt tgtttggtgg cgccaatttt aatcaaagtg ggaatattgc tgatagctca 2340
ttgtccttca ctttcactaa cagtagcaac ggtccgaacc tcataacaac tcaaacaaat 2400
tctcaagcgc tttcacaacc aattgcctcc tctaacgttc atgataactt catgaataat 2460
gaaatcacgg ctagtaaaat tgatgatggt aataattcaa aaccactgtc acctggttgg 2520
acggaccaaa ctgcgtataa cgcgtttgga atcactacag ggatgtttaa taccactaca 2580
atggatgatg tatataacta tctattcgat gatgaagata ccccaccaaa cccaaaaaaa 2640
gagtaa 2646
<210> 5
<211> 2646
<212> DNA
<213>Artificial sequence
<400> 5
atgaagctac tgtcttctat cgaacaagca tgcgatattt gccgacttaa aaagctcaag 60
tgctccaaag aaaaaccgaa gtgcgccaag tgtctgaaga acaactggga gtgtcgctac 120
tctcccaaaa ccaaaaggtc tccgctgact agggcacatc tgacagaagt ggaatcaagg 180
ctagaaagac tggaacagct atttctactg atttttcctc gagaagacct tgacatgatt 240
ttgaaaatgg attctttaca ggatataaaa gcattgttaa caggattatt tgtacaagat 300
aatgtgaata aagatgccgt cacagataga ttggcttcag tggagactga tatgcctcta 360
acattgagac agcatagaat aagtgcgaca tcatcatcgg aagagagtag taacaaaggt 420
caaagacagt tgactgtatc gattgactcg gcagctcatc atgataactc cacaattccg 480
ttggatttta tgcccaggga tgctcttcat ggatttgatt ggtctgaaga ggatgacatg 540
tcggatggct tgcccttcct gaaaacggac cccaacaata atgggttctt tggcgacggt 600
tctctcttat gtattcttcg acctattggc tttaaaccgg aaaattacac gaactctaac 660
gttaacaggc tcccgaccat gattacggat agatacacgt tggcttctag atccacaaca 720
tcccgtttac ttcaaagtta tctcaataat tttcacccct actgccctat cgtgcactca 780
ccgacgctaa tgatgttgta taataaccag attgaaatcg cgtcgaagga tcaatggcaa 840
atccttttta actgcatatt agccattgga gcctggtgta tagaggggga atctactgat 900
atagatgttt tttactatca aaatgctaaa tctcatttga cgagcaaggt cttcgagtca 960
ggttccataa ttttggtgac agccctacat cttctgtcgc gatatacaca gtggaggcag 1020
aaaacaaata ctagctataa ttttcacagc ttttccataa gaatggccat atcattgggc 1080
ttgaataggg acctcccctc gtccttcagt gatagcagca ttctggaaca aagacgccga 1140
atttggtggt ctgtctactc ttgggagatc caattgtccc tgctttatgg tcgatccatc 1200
cagctttctc agaatacaat ctccttccct tcttctgtcg acgatgtgca gcgtaccaca 1260
acaggtccca ccatatatca tggcatcatt gaaacagcaa ggctcttaca agttttcaca 1320
aaaatctatg aactagacaa aacagtaact gcagaaaaaa gtcctatatg tgcaaaaaaa 1380
tgcttgatga tttgtaatga gattgaggag gtttcgagac aggcaccaaa gtttttacaa 1440
atggatattt ccaccaccgc tctaaccaat ttgttgaagg aacacccttg gctatccttt 1500
acaagattcg aactgaagtg gaaacagttg tctcttatca tttatgtatt aagagatttt 1560
ttcactaatt ttacccagaa aaagtcacaa ctagaacagg atcaaaatga tcatcaaagt 1620
tatgaagtta aacgatgctc catcatgtta agcgatgcag cacaaagaac tgttatgtct 1680
gtaagtagct atatggacaa tcataatgtc accccatatt ttgcctggaa ttgttcttat 1740
tacttgttca atgcagtcct agtacccata aagactctac tctcaaactc aaaatcgaat 1800
gctgagaata acgagaccgc acaattatta caacaaatta acactgttct gatgctatta 1860
aaaaaactgg ccacttttaa aatccagact tgtgaaaaat acattcaagt actggaagag 1920
gtatgtgcgc cgtttctgtt atcacagtgt gcaatcccat taccgcatat cagttataac 1980
aatagtaatg gtagcgccat taaaaatatt gtcggttctg caactatcgc ccaataccct 2040
actcttccgg aggaaaatgt caacaatatc agtgttaaat atgtttctcc tggctcagta 2100
gggccttcac ctgtgccatt gaaatcagga gcaagtttca gtgatctagt caagctgtta 2160
tctaaccgtc caccctctcg taactctcca gtgacaatac caagaagcac accttcgcat 2220
cgctcagtca cgccttttct agggcaacag caacagctgc aatcattagt gccactgacc 2280
ccgtctgctt tgtttggtgg cgccaatttt aatcaaagtg ggaatattgc tgatagctca 2340
ttgtccttca ctttcactaa cagtagcaac ggtccgaacc tcataacaac tcaaacaaat 2400
tctcaagcgc tttcacaacc aattgcctcc tctaacgttc atgataactt catgaataat 2460
gaaatcacgg ctagtaaaat tgatgatggt aataattcaa aaccactgtc acctggttgg 2520
acggaccaaa ctgcgtataa cgcgtttgga atcactacag ggatgtttaa taccactaca 2580
atggatgatg tatataacta tctattcgat gatgaagata ccccaccaaa cccaaaaaaa 2640
gagtaa 2646
<210> 6
<211> 881
<212> PRT
<213>Artificial sequence
<400> 6
Met Lys Leu Leu Ser Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu
1 5 10 15
Lys Lys Leu Lys Cys Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu
20 25 30
Lys Asn Asn Trp Glu Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro
35 40 45
Leu Thr Arg Ala His Leu Thr Glu Val Glu Ser Arg Leu Glu Arg Leu
50 55 60
Glu Gln Leu Phe Pro Leu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile
65 70 75 80
Leu Lys Met Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu
85 90 95
Phe Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala
100 105 110
Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser
115 120 125
Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu
130 135 140
Thr Val Ser Ile Asp Ser Ala Ala His His Asp Asn Ser Thr Ile Pro
145 150 155 160
Leu Asp Phe Met Pro Arg Asp Ala Leu His Gly Phe Asp Trp Ser Glu
165 170 175
Glu Asp Asp Met Ser Asp Gly Leu Pro Phe Leu Lys Thr Asp Pro Asn
180 185 190
Asn Asn Gly Phe Phe Gly Asp Gly Ser Leu Leu Cys Ile Leu Arg Ser
195 200 205
Ile Gly Phe Lys Pro Glu Asn Tyr Thr Asn Ser Asn Val Asn Arg Leu
210 215 220
Pro Thr Met Ile Thr Asp Arg Tyr Thr Leu Ala Ser Arg Ser Thr Thr
225 230 235 240
Ser Arg Leu Leu Gln Ser Tyr Leu Asn Asn Phe His Pro Tyr Cys Pro
245 250 255
Ile Val His Ser Pro Thr Leu Met Met Leu Tyr Asn Asn Gln Ile Glu
260 265 270
Ile Ala Ser Lys Asp Gln Trp Gln Ile Leu Phe Asn Cys Ile Leu Ala
275 280 285
Ile Gly Ala Trp Cys Ile Glu Gly Glu Ser Thr Asp Ile Asp Val Phe
290 295 300
Tyr Tyr Gln Asn Ala Lys Ser His Leu Thr Ser Lys Val Phe Glu Ser
305 310 315 320
Gly Ser Ile Ile Leu Val Thr Ala Leu His Leu Leu Ser Arg Tyr Thr
325 330 335
Gln Trp Arg Gln Lys Thr Asn Thr Ser Tyr Asn Phe His Ser Phe Ser
340 345 350
Ile Arg Met Thr Ile Ser Leu Gly Leu Asn Arg Asp Leu Pro Ser Ser
355 360 365
Phe Ser Asp Ser Ser Ile Leu Glu Gln Arg Arg Arg Ile Trp Trp Ser
370 375 380
Val Tyr Ser Trp Glu Ile Gln Leu Ser Leu Leu Tyr Gly Arg Ser Ile
385 390 395 400
Gln Leu Ser Gln Asn Thr Ile Ser Phe Pro Ser Ser Val Asp Asp Val
405 410 415
Gln Arg Thr Thr Thr Gly Pro Thr Ile Tyr His Gly Ile Ile Glu Thr
420 425 430
Ala Arg Leu Leu Gln Val Phe Thr Lys Ile Tyr Glu Leu Asp Lys Thr
435 440 445
Val Thr Ala Glu Lys Ser Pro Ile Cys Ala Lys Lys Cys Leu Met Ile
450 455 460
Cys Asn Glu Ile Glu Glu Val Ser Arg Gln Ala Pro Lys Phe Leu Gln
465 470 475 480
Met Asp Ile Ser Thr Thr Ala Leu Thr Asn Leu Leu Lys Glu His Pro
485 490 495
Trp Leu Ser Phe Thr Arg Phe Glu Leu Lys Trp Lys Gln Leu Ser Leu
500 505 510
Ile Ile Tyr Val Leu Arg Asp Phe Phe Thr Asn Phe Thr Gln Lys Lys
515 520 525
Ser Gln Leu Glu Gln Asp Gln Asn Asp His Gln Ser Tyr Glu Val Lys
530 535 540
Arg Cys Ser Ile Met Leu Ser Asp Ala Ala Gln Arg Thr Val Met Ser
545 550 555 560
Val Ser Ser Tyr Met Asp Asn His Asn Val Thr Pro Tyr Phe Ala Trp
565 570 575
Asn Cys Ser Tyr Tyr Leu Phe Asn Ala Val Leu Val Pro Ile Lys Thr
580 585 590
Leu Leu Ser Asn Ser Lys Ser Asn Ala Glu Asn Asn Glu Thr Ala Gln
595 600 605
Leu Leu Gln Gln Ile Asn Thr Val Leu Met Leu Leu Lys Lys Leu Ala
610 615 620
Thr Phe Lys Ile Gln Thr Cys Glu Lys Tyr Ile Gln Val Leu Glu Glu
625 630 635 640
Val Cys Ala Pro Phe Leu Leu Ser Gln Cys Ala Ile Pro Leu Pro His
645 650 655
Ile Ser Tyr Asn Asn Ser Asn Gly Ser Ala Ile Lys Asn Ile Val Gly
660 665 670
Ser Ala Thr Ile Ala Gln Tyr Pro Thr Leu Pro Glu Glu Asn Val Asn
675 680 685
Asn Ile Ser Val Lys Tyr Val Ser Pro Gly Ser Val Gly Pro Ser Pro
690 695 700
Val Pro Leu Lys Ser Gly Ala Ser Phe Ser Asp Leu Val Lys Leu Leu
705 710 715 720
Ser Asn Arg Pro Pro Ser Arg Asn Ser Pro Val Thr Ile Pro Arg Ser
725 730 735
Thr Pro Ser His Arg Ser Val Thr Pro Phe Leu Gly Gln Gln Gln Gln
740 745 750
Leu Gln Ser Leu Val Pro Leu Thr Pro Ser Ala Leu Phe Gly Gly Ala
755 760 765
Asn Phe Asn Gln Ser Gly Asn Ile Ala Asp Ser Ser Leu Ser Phe Thr
770 775 780
Phe Thr Asn Ser Ser Asn Gly Pro Asn Leu Ile Thr Thr Gln Thr Asn
785 790 795 800
Ser Gln Ala Leu Ser Gln Pro Ile Ala Ser Ser Asn Val His Asp Asn
805 810 815
Phe Met Asn Asn Glu Ile Thr Ala Ser Lys Ile Asp Asp Gly Asn Asn
820 825 830
Ser Lys Pro Leu Ser Pro Gly Trp Thr Asp Gln Thr Ala Tyr Asn Ala
835 840 845
Phe Gly Ile Thr Thr Gly Met Phe Asn Thr Thr Thr Met Asp Asp Val
850 855 860
Tyr Asn Tyr Leu Phe Asp Asp Glu Asp Thr Pro Pro Asn Pro Lys Lys
865 870 875 880
Glu
<210> 7
<211> 881
<212> PRT
<213>Artificial sequence
<400> 7
Met Lys Leu Leu Ser Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu
1 5 10 15
Lys Lys Leu Lys Cys Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu
20 25 30
Lys Asn Asn Trp Glu Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro
35 40 45
Leu Thr Arg Ala His Leu Thr Glu Val Glu Ser Arg Leu Glu Arg Leu
50 55 60
Glu Gln Leu Phe Leu Leu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile
65 70 75 80
Leu Lys Met Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu
85 90 95
Phe Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala
100 105 110
Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser
115 120 125
Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu
130 135 140
Thr Val Ser Ile Asp Ser Ala Ala His His Asp Asn Ser Thr Ile Pro
145 150 155 160
Leu Asp Phe Met Pro Arg Asp Ala Leu His Gly Phe Asp Trp Ser Glu
165 170 175
Glu Asp Asp Met Ser Asp Gly Leu Pro Phe Leu Lys Thr Asp Pro Asn
180 185 190
Asn Asn Gly Phe Phe Gly Asp Gly Ser Leu Leu Cys Ile Leu Arg Ser
195 200 205
Ile Gly Phe Lys Pro Glu Asn Tyr Thr Asn Ser Asn Val Asn Arg Leu
210 215 220
Pro Thr Met Ile Thr Asp Arg Tyr Thr Leu Ala Ser Arg Ser Thr Thr
225 230 235 240
Ser Arg Leu Leu Gln Ser Tyr Leu Asn Asn Phe His Pro Tyr Cys Pro
245 250 255
Ile Val His Ser Pro Thr Leu Met Met Leu Tyr Asn Asn Gln Ile Glu
260 265 270
Ile Ala Ser Lys Asp Gln Trp Gln Ile Leu Phe Asn Cys Ile Leu Ala
275 280 285
Ile Gly Ala Trp Cys Ile Glu Gly Glu Ser Thr Asp Ile Asp Val Phe
290 295 300
Tyr Tyr Gln Asn Ala Lys Ser His Leu Thr Ser Lys Val Phe Glu Ser
305 310 315 320
Gly Ser Ile Ile Leu Val Thr Ala Leu His Leu Leu Ser Arg Tyr Thr
325 330 335
Gln Trp Arg Gln Lys Thr Asn Thr Ser Tyr Asn Phe His Ser Phe Ser
340 345 350
Ile Arg Met Ala Ile Ser Leu Gly Leu Asn Arg Asp Leu Pro Ser Ser
355 360 365
Phe Ser Asp Ser Ser Ile Leu Glu Gln Arg Arg Arg Ile Trp Trp Ser
370 375 380
Asp Tyr Ser Trp Glu Ile Gln Leu Ser Leu Leu Tyr Gly Arg Ser Ile
385 390 395 400
Gln Leu Ser Gln Asn Thr Ile Ser Phe Pro Ser Ser Val Asp Asp Val
405 410 415
Gln Arg Thr Thr Thr Gly Pro Thr Ile Tyr His Gly Ile Ile Glu Thr
420 425 430
Ala Arg Leu Leu Gln Val Phe Thr Lys Ile Tyr Glu Leu Asp Lys Thr
435 440 445
Val Thr Ala Glu Lys Ser Pro Ile Cys Ala Lys Lys Cys Leu Met Ile
450 455 460
Cys Asn Glu Ile Glu Glu Val Ser Arg Gln Ala Pro Lys Phe Leu Gln
465 470 475 480
Met Asp Ile Ser Thr Thr Ala Leu Thr Asn Leu Leu Lys Glu His Pro
485 490 495
Trp Leu Ser Phe Thr Arg Phe Glu Leu Lys Trp Lys Gln Leu Ser Leu
500 505 510
Ile Ile Tyr Val Leu Arg Asp Phe Phe Thr Asn Phe Thr Gln Lys Lys
515 520 525
Ser Gln Leu Glu Gln Asp Gln Asn Asp His Gln Ser Tyr Glu Val Lys
530 535 540
Arg Cys Ser Ile Met Leu Ser Asp Ala Ala Gln Arg Thr Val Met Ser
545 550 555 560
Val Ser Ser Tyr Met Asp Asn His Asn Val Thr Pro Tyr Phe Ala Trp
565 570 575
Asn Cys Ser Tyr Tyr Leu Phe Asn Ala Val Leu Val Pro Ile Lys Thr
580 585 590
Leu Leu Ser Asn Ser Lys Ser Asn Ala Glu Asn Asn Glu Thr Ala Gln
595 600 605
Leu Leu Gln Gln Ile Asn Thr Val Leu Met Leu Leu Lys Lys Leu Ala
610 615 620
Thr Phe Lys Ile Gln Thr Cys Glu Lys Tyr Ile Gln Val Leu Glu Glu
625 630 635 640
Val Cys Ala Pro Phe Leu Leu Ser Gln Cys Ala Ile Pro Leu Pro His
645 650 655
Ile Ser Tyr Asn Asn Ser Asn Gly Ser Ala Ile Lys Asn Ile Val Gly
660 665 670
Ser Ala Thr Ile Ala Gln Tyr Pro Thr Leu Pro Glu Glu Asn Val Asn
675 680 685
Asn Ile Ser Val Lys Tyr Val Ser Pro Gly Ser Val Gly Pro Ser Pro
690 695 700
Val Pro Leu Lys Ser Gly Ala Ser Phe Ser Asp Leu Val Lys Leu Leu
705 710 715 720
Ser Asn Arg Pro Pro Ser Arg Asn Ser Pro Val Thr Ile Pro Arg Ser
725 730 735
Thr Pro Ser His Arg Ser Val Thr Pro Phe Leu Gly Gln Gln Gln Gln
740 745 750
Leu Gln Ser Leu Val Pro Leu Thr Pro Ser Ala Leu Phe Gly Gly Ala
755 760 765
Asn Phe Asn Gln Ser Gly Asn Ile Ala Asp Ser Ser Leu Ser Phe Thr
770 775 780
Phe Thr Asn Ser Ser Asn Gly Pro Asn Leu Ile Thr Thr Gln Thr Asn
785 790 795 800
Ser Gln Ala Leu Ser Gln Pro Ile Ala Ser Ser Asn Val His Asp Asn
805 810 815
Phe Met Asn Asn Glu Ile Thr Ala Ser Lys Ile Asp Asp Gly Asn Asn
820 825 830
Ser Lys Pro Leu Ser Pro Gly Trp Thr Asp Gln Thr Ala Tyr Asn Ala
835 840 845
Phe Gly Ile Thr Thr Gly Met Phe Asn Thr Thr Thr Met Asp Asp Val
850 855 860
Tyr Asn Tyr Leu Phe Asp Asp Glu Asp Thr Pro Pro Asn Pro Lys Lys
865 870 875 880
Glu
<210> 8
<211> 881
<212> PRT
<213>Artificial sequence
<400> 8
Met Lys Leu Leu Ser Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu
1 5 10 15
Lys Lys Leu Lys Cys Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu
20 25 30
Lys Asn Asn Trp Glu Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro
35 40 45
Leu Thr Arg Ala His Leu Thr Glu Val Glu Ser Arg Leu Glu Gly Leu
50 55 60
Glu Gln Leu Phe Leu Leu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile
65 70 75 80
Leu Lys Met Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu
85 90 95
Phe Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala
100 105 110
Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser
115 120 125
Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu
130 135 140
Thr Val Ser Ile Asp Ser Ala Ala His His Asp Asn Ser Thr Ile Pro
145 150 155 160
Leu Asp Phe Met Pro Arg Asp Ala Leu His Gly Phe Asp Trp Ser Glu
165 170 175
Glu Asp Asp Met Ser Asp Gly Leu Pro Phe Leu Lys Thr Asp Pro Asn
180 185 190
Asn Asp Gly Phe Phe Gly Asp Gly Ser Leu Leu Cys Ile Leu Arg Ser
195 200 205
Ile Gly Phe Lys Pro Glu Asn Tyr Thr Asn Ser Asn Val Asn Arg Leu
210 215 220
Pro Thr Met Ile Thr Asp Arg Tyr Thr Leu Ala Ser Arg Ser Thr Thr
225 230 235 240
Ser Arg Leu Leu Gln Ser Tyr Leu Asn Asn Phe His Pro Tyr Cys Pro
245 250 255
Ile Val His Ser Pro Thr Leu Met Met Leu Tyr Asn Asn Gln Ile Glu
260 265 270
Ile Ala Ser Lys Asp Gln Trp Gln Ile Leu Phe Asn Cys Ile Leu Ala
275 280 285
Ile Gly Ala Trp Cys Ile Glu Gly Glu Ser Thr Asp Ile Asp Val Phe
290 295 300
Tyr Tyr Gln Asn Ala Lys Ser His Leu Thr Ser Lys Val Phe Glu Ser
305 310 315 320
Gly Ser Ile Ile Leu Val Thr Ala Leu His Leu Leu Ser Arg Tyr Thr
325 330 335
Gln Trp Arg Gln Lys Thr Asn Thr Ser Tyr Asn Phe His Ser Phe Ser
340 345 350
Ile Arg Met Ala Ile Ser Leu Gly Leu Asn Arg Asp Leu Pro Ser Ser
355 360 365
Phe Ser Asp Ser Ser Ile Leu Glu Gln Arg Arg Arg Ile Trp Trp Ser
370 375 380
Val Tyr Ser Trp Glu Ile Gln Leu Ser Leu Leu Tyr Gly Arg Ser Ile
385 390 395 400
Gln Leu Ser Gln Asn Thr Ile Ser Phe Pro Ser Ser Val Asp Asp Val
405 410 415
Gln Arg Thr Thr Thr Gly Pro Thr Ile Tyr His Gly Ile Ile Glu Thr
420 425 430
Ala Arg Leu Leu Gln Val Phe Thr Lys Ile Tyr Glu Leu Asp Lys Thr
435 440 445
Val Thr Ala Glu Lys Ser Pro Ile Cys Ala Lys Lys Cys Leu Met Ile
450 455 460
Cys Asn Glu Ile Glu Glu Val Ser Arg Gln Ala Pro Lys Phe Leu Gln
465 470 475 480
Met Asp Ile Ser Thr Thr Ala Leu Thr Asn Leu Leu Lys Glu His Pro
485 490 495
Trp Leu Ser Phe Thr Arg Phe Glu Leu Lys Trp Lys Gln Leu Ser Leu
500 505 510
Ile Ile Tyr Val Leu Arg Asp Phe Phe Thr Asn Phe Thr Gln Lys Lys
515 520 525
Ser Gln Leu Glu Gln Asp Gln Asn Asp His Gln Ser Tyr Glu Val Lys
530 535 540
Arg Cys Ser Ile Met Leu Ser Asp Ala Ala Gln Arg Thr Val Met Ser
545 550 555 560
Val Ser Ser Tyr Met Asp Asn His Asn Val Thr Pro Tyr Phe Ala Trp
565 570 575
Asn Cys Ser Tyr Tyr Leu Phe Asn Ala Val Leu Val Pro Ile Lys Thr
580 585 590
Leu Leu Ser Asn Ser Lys Ser Asn Ala Glu Asn Asn Glu Thr Ala Gln
595 600 605
Leu Leu Gln Gln Ile Asn Thr Val Leu Met Leu Leu Lys Lys Leu Ala
610 615 620
Thr Phe Lys Ile Gln Thr Cys Glu Lys Tyr Ile Gln Val Leu Glu Glu
625 630 635 640
Val Cys Ala Pro Phe Leu Leu Ser Gln Cys Ala Ile Pro Leu Pro His
645 650 655
Ile Ser Tyr Asn Asn Ser Asn Gly Ser Ala Ile Lys Asn Ile Val Gly
660 665 670
Ser Ala Thr Ile Ala Gln Tyr Pro Thr Leu Pro Glu Glu Asn Val Asn
675 680 685
Asn Ile Ser Val Lys Tyr Val Ser Pro Gly Ser Val Gly Pro Ser Pro
690 695 700
Val Pro Leu Lys Ser Gly Ala Ser Phe Ser Asp Leu Val Lys Leu Leu
705 710 715 720
Ser Asn Arg Pro Pro Ser Arg Asn Ser Pro Val Thr Ile Pro Arg Ser
725 730 735
Thr Pro Ser His Arg Ser Val Thr Pro Phe Leu Gly Gln Gln Gln Gln
740 745 750
Leu Gln Ser Leu Val Pro Leu Thr Pro Ser Ala Leu Phe Gly Gly Ala
755 760 765
Asn Phe Asn Gln Ser Gly Asn Ile Ala Asp Ser Ser Leu Ser Phe Thr
770 775 780
Phe Thr Asn Ser Ser Asn Gly Pro Asn Leu Ile Thr Thr Gln Thr Asn
785 790 795 800
Ser Gln Ala Leu Ser Gln Pro Ile Ala Ser Ser Asn Val His Asp Asn
805 810 815
Phe Met Asn Asn Glu Ile Thr Ala Ser Lys Ile Asp Asp Gly Asn Asn
820 825 830
Ser Lys Pro Leu Ser Pro Gly Trp Thr Asp Gln Thr Ala Tyr Asn Ala
835 840 845
Phe Gly Ile Thr Thr Gly Met Phe Asn Thr Thr Thr Met Asp Asp Val
850 855 860
Tyr Asn Tyr Leu Phe Asp Asp Glu Asp Thr Pro Pro Asn Pro Lys Lys
865 870 875 880
Glu
<210> 9
<211> 881
<212> PRT
<213>Artificial sequence
<400> 9
Met Lys Leu Leu Ser Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu
1 5 10 15
Lys Lys Leu Lys Cys Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu
20 25 30
Lys Asn Asn Trp Glu Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro
35 40 45
Leu Thr Arg Ala His Leu Thr Glu Val Glu Ser Arg Leu Glu Arg Leu
50 55 60
Glu Gln Leu Phe Leu Leu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile
65 70 75 80
Leu Lys Met Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu
85 90 95
Phe Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala
100 105 110
Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser
115 120 125
Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu
130 135 140
Thr Val Ser Ile Asp Ser Ala Ala His His Asp Asn Ser Thr Ile Pro
145 150 155 160
Leu Asp Phe Met Pro Arg Asp Ala Leu His Gly Phe Asp Trp Ser Glu
165 170 175
Glu Asp Asp Met Ser Asp Gly Leu Pro Phe Leu Lys Thr Asp Pro Asn
180 185 190
Asn Asn Gly Leu Phe Gly Asp Gly Ser Leu Leu Cys Ile Leu Arg Ser
195 200 205
Ile Gly Phe Lys Pro Glu Asn Tyr Thr Asn Ser Asn Val Asn Arg Leu
210 215 220
Pro Thr Met Ile Thr Asp Arg Tyr Thr Leu Ala Ser Arg Ser Thr Thr
225 230 235 240
Ser Arg Leu Leu Gln Ser Tyr Leu Asn Asn Phe His Pro Tyr Cys Pro
245 250 255
Ile Val His Ser Pro Thr Leu Met Met Leu Tyr Asn Asn Gln Ile Glu
260 265 270
Ile Ala Ser Lys Asp Gln Trp Gln Ile Leu Phe Asn Cys Ile Leu Ala
275 280 285
Ile Gly Ala Trp Cys Ile Glu Gly Gly Ser Thr Asp Ile Asp Val Phe
290 295 300
Tyr Tyr Gln Asn Ala Lys Ser His Leu Thr Ser Lys Val Phe Glu Ser
305 310 315 320
Gly Ser Ile Ile Leu Val Thr Ala Leu His Leu Leu Ser Arg Tyr Thr
325 330 335
Gln Trp Arg Gln Lys Thr Asn Thr Ser Tyr Asn Phe His Ser Phe Ser
340 345 350
Ile Arg Met Ala Ile Ser Leu Gly Ser Asn Arg Asp Leu Pro Ser Ser
355 360 365
Phe Ser Asp Ser Ser Ile Leu Glu Gln Arg Arg Arg Ile Trp Trp Ser
370 375 380
Val Tyr Ser Trp Glu Ile Gln Leu Ser Leu Leu Tyr Gly Arg Ser Ile
385 390 395 400
Gln Leu Ser Gln Asn Thr Ile Ser Phe Pro Ser Ser Val Asp Asp Val
405 410 415
Gln Arg Thr Thr Thr Gly Pro Thr Ile Tyr His Gly Ile Ile Glu Thr
420 425 430
Ala Arg Leu Leu Gln Val Phe Thr Lys Ile Tyr Glu Leu Asp Lys Thr
435 440 445
Val Thr Ala Glu Lys Ser Pro Ile Cys Ala Lys Lys Cys Leu Met Ile
450 455 460
Cys Asn Glu Ile Glu Glu Val Ser Arg Gln Ala Pro Lys Phe Leu Gln
465 470 475 480
Met Asp Ile Ser Thr Thr Ala Leu Thr Asn Leu Leu Lys Glu His Pro
485 490 495
Trp Leu Ser Phe Thr Arg Phe Glu Leu Lys Trp Lys Gln Leu Ser Leu
500 505 510
Ile Ile Tyr Val Leu Arg Asp Phe Phe Thr Asn Phe Thr Gln Lys Lys
515 520 525
Ser Gln Leu Glu Gln Asp Gln Asn Asp His Gln Ser Tyr Glu Val Lys
530 535 540
Arg Cys Ser Ile Met Leu Ser Asp Ala Ala Gln Arg Thr Val Met Ser
545 550 555 560
Val Ser Ser Tyr Met Asp Asn His Asn Val Thr Pro Tyr Phe Ala Trp
565 570 575
Asn Cys Ser Tyr Tyr Leu Phe Asn Ala Val Leu Val Pro Ile Lys Thr
580 585 590
Leu Leu Ser Asn Ser Lys Ser Asn Ala Glu Asn Asn Glu Thr Ala Gln
595 600 605
Leu Leu Gln Gln Ile Asn Thr Val Leu Met Leu Leu Lys Lys Leu Ala
610 615 620
Thr Phe Lys Ile Gln Thr Cys Glu Lys Tyr Ile Gln Val Leu Glu Glu
625 630 635 640
Val Cys Ala Pro Phe Leu Leu Ser Gln Cys Ala Ile Pro Leu Pro His
645 650 655
Ile Ser Tyr Asn Asn Ser Asn Gly Ser Ala Ile Lys Asn Ile Val Gly
660 665 670
Ser Ala Thr Ile Ala Gln Tyr Pro Thr Leu Pro Glu Glu Asn Val Asn
675 680 685
Asn Ile Ser Val Lys Tyr Val Ser Pro Gly Ser Val Gly Pro Ser Pro
690 695 700
Val Pro Leu Lys Ser Gly Ala Ser Phe Ser Asp Leu Val Lys Leu Leu
705 710 715 720
Ser Asn Arg Pro Pro Ser Arg Asn Ser Pro Val Thr Ile Pro Arg Ser
725 730 735
Thr Pro Ser His Arg Ser Val Thr Pro Phe Leu Gly Gln Gln Gln Gln
740 745 750
Leu Gln Ser Leu Val Pro Leu Thr Pro Ser Ala Leu Phe Gly Gly Ala
755 760 765
Asn Phe Asn Gln Ser Gly Asn Ile Ala Asp Ser Ser Leu Ser Phe Thr
770 775 780
Phe Thr Asn Ser Ser Asn Gly Pro Asn Leu Ile Thr Thr Gln Thr Asn
785 790 795 800
Ser Gln Ala Leu Ser Gln Pro Ile Ala Ser Ser Asn Val His Asp Asn
805 810 815
Phe Met Asn Asn Glu Ile Thr Ala Ser Lys Ile Asp Asp Gly Asn Asn
820 825 830
Ser Lys Pro Leu Ser Pro Gly Trp Thr Asp Gln Thr Ala Tyr Asn Ala
835 840 845
Phe Gly Ile Thr Thr Gly Met Phe Asn Thr Thr Thr Met Asp Asp Val
850 855 860
Tyr Asn Tyr Leu Phe Asp Asp Glu Asp Thr Pro Pro Asn Pro Lys Lys
865 870 875 880
Glu
<210> 10
<211> 881
<212> PRT
<213>Artificial sequence
<400> 10
Met Lys Leu Leu Ser Ser Ile Glu Gln Ala Cys Asp Ile Cys Arg Leu
1 5 10 15
Lys Lys Leu Lys Cys Ser Lys Glu Lys Pro Lys Cys Ala Lys Cys Leu
20 25 30
Lys Asn Asn Trp Glu Cys Arg Tyr Ser Pro Lys Thr Lys Arg Ser Pro
35 40 45
Leu Thr Arg Ala His Leu Thr Glu Val Glu Ser Arg Leu Glu Arg Leu
50 55 60
Glu Gln Leu Phe Leu Leu Ile Phe Pro Arg Glu Asp Leu Asp Met Ile
65 70 75 80
Leu Lys Met Asp Ser Leu Gln Asp Ile Lys Ala Leu Leu Thr Gly Leu
85 90 95
Phe Val Gln Asp Asn Val Asn Lys Asp Ala Val Thr Asp Arg Leu Ala
100 105 110
Ser Val Glu Thr Asp Met Pro Leu Thr Leu Arg Gln His Arg Ile Ser
115 120 125
Ala Thr Ser Ser Ser Glu Glu Ser Ser Asn Lys Gly Gln Arg Gln Leu
130 135 140
Thr Val Ser Ile Asp Ser Ala Ala His His Asp Asn Ser Thr Ile Pro
145 150 155 160
Leu Asp Phe Met Pro Arg Asp Ala Leu His Gly Phe Asp Trp Ser Glu
165 170 175
Glu Asp Asp Met Ser Asp Gly Leu Pro Phe Leu Lys Thr Asp Pro Asn
180 185 190
Asn Asn Gly Phe Phe Gly Asp Gly Ser Leu Leu Cys Ile Leu Arg Pro
195 200 205
Ile Gly Phe Lys Pro Glu Asn Tyr Thr Asn Ser Asn Val Asn Arg Leu
210 215 220
Pro Thr Met Ile Thr Asp Arg Tyr Thr Leu Ala Ser Arg Ser Thr Thr
225 230 235 240
Ser Arg Leu Leu Gln Ser Tyr Leu Asn Asn Phe His Pro Tyr Cys Pro
245 250 255
Ile Val His Ser Pro Thr Leu Met Met Leu Tyr Asn Asn Gln Ile Glu
260 265 270
Ile Ala Ser Lys Asp Gln Trp Gln Ile Leu Phe Asn Cys Ile Leu Ala
275 280 285
Ile Gly Ala Trp Cys Ile Glu Gly Glu Ser Thr Asp Ile Asp Val Phe
290 295 300
Tyr Tyr Gln Asn Ala Lys Ser His Leu Thr Ser Lys Val Phe Glu Ser
305 310 315 320
Gly Ser Ile Ile Leu Val Thr Ala Leu His Leu Leu Ser Arg Tyr Thr
325 330 335
Gln Trp Arg Gln Lys Thr Asn Thr Ser Tyr Asn Phe His Ser Phe Ser
340 345 350
Ile Arg Met Ala Ile Ser Leu Gly Leu Asn Arg Asp Leu Pro Ser Ser
355 360 365
Phe Ser Asp Ser Ser Ile Leu Glu Gln Arg Arg Arg Ile Trp Trp Ser
370 375 380
Val Tyr Ser Trp Glu Ile Gln Leu Ser Leu Leu Tyr Gly Arg Ser Ile
385 390 395 400
Gln Leu Ser Gln Asn Thr Ile Ser Phe Pro Ser Ser Val Asp Asp Val
405 410 415
Gln Arg Thr Thr Thr Gly Pro Thr Ile Tyr His Gly Ile Ile Glu Thr
420 425 430
Ala Arg Leu Leu Gln Val Phe Thr Lys Ile Tyr Glu Leu Asp Lys Thr
435 440 445
Val Thr Ala Glu Lys Ser Pro Ile Cys Ala Lys Lys Cys Leu Met Ile
450 455 460
Cys Asn Glu Ile Glu Glu Val Ser Arg Gln Ala Pro Lys Phe Leu Gln
465 470 475 480
Met Asp Ile Ser Thr Thr Ala Leu Thr Asn Leu Leu Lys Glu His Pro
485 490 495
Trp Leu Ser Phe Thr Arg Phe Glu Leu Lys Trp Lys Gln Leu Ser Leu
500 505 510
Ile Ile Tyr Val Leu Arg Asp Phe Phe Thr Asn Phe Thr Gln Lys Lys
515 520 525
Ser Gln Leu Glu Gln Asp Gln Asn Asp His Gln Ser Tyr Glu Val Lys
530 535 540
Arg Cys Ser Ile Met Leu Ser Asp Ala Ala Gln Arg Thr Val Met Ser
545 550 555 560
Val Ser Ser Tyr Met Asp Asn His Asn Val Thr Pro Tyr Phe Ala Trp
565 570 575
Asn Cys Ser Tyr Tyr Leu Phe Asn Ala Val Leu Val Pro Ile Lys Thr
580 585 590
Leu Leu Ser Asn Ser Lys Ser Asn Ala Glu Asn Asn Glu Thr Ala Gln
595 600 605
Leu Leu Gln Gln Ile Asn Thr Val Leu Met Leu Leu Lys Lys Leu Ala
610 615 620
Thr Phe Lys Ile Gln Thr Cys Glu Lys Tyr Ile Gln Val Leu Glu Glu
625 630 635 640
Val Cys Ala Pro Phe Leu Leu Ser Gln Cys Ala Ile Pro Leu Pro His
645 650 655
Ile Ser Tyr Asn Asn Ser Asn Gly Ser Ala Ile Lys Asn Ile Val Gly
660 665 670
Ser Ala Thr Ile Ala Gln Tyr Pro Thr Leu Pro Glu Glu Asn Val Asn
675 680 685
Asn Ile Ser Val Lys Tyr Val Ser Pro Gly Ser Val Gly Pro Ser Pro
690 695 700
Val Pro Leu Lys Ser Gly Ala Ser Phe Ser Asp Leu Val Lys Leu Leu
705 710 715 720
Ser Asn Arg Pro Pro Ser Arg Asn Ser Pro Val Thr Ile Pro Arg Ser
725 730 735
Thr Pro Ser His Arg Ser Val Thr Pro Phe Leu Gly Gln Gln Gln Gln
740 745 750
Leu Gln Ser Leu Val Pro Leu Thr Pro Ser Ala Leu Phe Gly Gly Ala
755 760 765
Asn Phe Asn Gln Ser Gly Asn Ile Ala Asp Ser Ser Leu Ser Phe Thr
770 775 780
Phe Thr Asn Ser Ser Asn Gly Pro Asn Leu Ile Thr Thr Gln Thr Asn
785 790 795 800
Ser Gln Ala Leu Ser Gln Pro Ile Ala Ser Ser Asn Val His Asp Asn
805 810 815
Phe Met Asn Asn Glu Ile Thr Ala Ser Lys Ile Asp Asp Gly Asn Asn
820 825 830
Ser Lys Pro Leu Ser Pro Gly Trp Thr Asp Gln Thr Ala Tyr Asn Ala
835 840 845
Phe Gly Ile Thr Thr Gly Met Phe Asn Thr Thr Thr Met Asp Asp Val
850 855 860
Tyr Asn Tyr Leu Phe Asp Asp Glu Asp Thr Pro Pro Asn Pro Lys Lys
865 870 875 880
Glu
<210> 11
<211> 473
<212> DNA
<213>Artificial sequence
<400> 11
tcaaaaccct taaaaacata tgcctcaccc taacatattt tccaattaac cctcaatatt 60
tctctgtcac ccggcctcta ttttccattt tcttctttac ccgccacgcg tttttttctt 120
tcaaattttt ttcttccttc ttctttttct tccacgtcct cttgcataaa taaataaacc 180
gttttgaaac caaactcgcc tctctctctc ctttttgaaa tatttttggg tttgtttgat 240
cctttccttc ccaatctctc ttgtttaata tatattcatt tatatcacgc tctcttttta 300
tcttcctttt tttcctctct cttgtattct tccttcccct ttctactcaa accaagaaga 360
aaaagaaaag gtcaatcttt gttaaagaat aggatcttct actacatcag cttttagatt 420
tttcacgctt actgcttttt tcttcccaag atcgaaaatt tactgaatta aca 473
<210> 12
<211> 1941
<212> DNA
<213>Artificial sequence
<400> 12
aacccagaat cccctatact aaacttacaa ggccacggtt cttcggtaaa cgggattaaa 60
tggcatccca caaagcgcaa tgttttgctc tcgtgcggag atgactgcca ggtgctctat 120
tgggacttga acagctcctt tatggaaatt aacgctgcag gtagcaaatc ccccagtatt 180
catggaactt ccttggagga ccctgacggc gacacagaga tgacagacgg tggcgcagga 240
tccggtttaa acgaggatcc cttaagttta aacaacaaca gcaagcaggt gtgcaagaca 300
ctagagactc ctaacatgat gtatgccaat aaaacacaag agataaacaa cattgcatgg 360
aggccccaga ggggcgattg gtttgggtgc gtgagcggca agaagtttca aaacgtccgc 420
gtcctttgag acagcattcg cccagtattt tttttattct acaaaccttc tataatttca 480
aagtatttac ataattctgt atcagtttaa tcaccataat atcgttttct ttgtttagtg 540
caattaattt ttcctattgt tacttcgggc ctttttctgt tttatgagct actagtacac 600
tctatatttt tttatgcctc ggtaatgatt ttcatttttt tttttcccct agcggatgac 660
tctttttttt tcttagcgat tggcattatc acataatgaa ttatacatta tataaagtaa 720
tgtgatttct tcgaagaata tactaaaaaa tgagcaggca agataaacga aggcaaagat 780
gacagagcag aaagccctag taaagcgtat tacaaatgaa accaagattc agattgcgat 840
ctctttaaag ggtggtcccc tagcgataga gcactcgatc ttcccagaaa aagaggcaga 900
agcagtagca gaacaggcca cacaatcgca agtgattaac gtccacacag gtatagggtt 960
tctggaccat atgatacatg ctctggccaa gcattccggc tggtcgctaa tcgttgagtg 1020
cattggtgac ttacacatag acgaccatca caccactgaa gactgcggga ttgctctcgg 1080
tcaagctttt aaagaggccc tactggcgcg tggagtaaaa aggtttggat caggatttgc 1140
gcctttggat gaggcacttt ccagagcggt ggtagatctt tcgaacaggc cgtacgcagt 1200
tgtcgaactt ggtttgcaaa gggagaaagt aggagatctc tcttgcgaga tgatcccgca 1260
ttttcttgaa agctttgcag aggctagcag aattaccctc cacgttgatt gtctgcgagg 1320
caagaatgat catcaccgta gtgagagtgc gttcaaggct cttgcggttg ccataagaga 1380
agccacctcg cccaatggta ccaacgatgt tccctccacc aaaggtgttc ttatgtagcc 1440
gaccatgatt acggatagat acacgttggc ttctagatcc acaacatccc gtttacttca 1500
aagttatctc aataattttc acccctactg ccctatcgtg cactcaccga cgctaatgat 1560
gttgtataat aaccagattg aaatcgcgtc gaaggatcaa tggcaaatcc tttttaactg 1620
catattagcc attggagcct ggtgtataga gggggaatct actgatatag atgtttttta 1680
ctatcaaaat gctaaatctc atttgacgag caaggtcttc gagtcaggtt ccataatttt 1740
ggtgacagcc ctacatcttc tgtcgcgata tacacagtgg aggcagaaaa caaatactag 1800
ctataatttt cacagctttt ccataagaat ggccatatca ttgggcttga atagggacct 1860
cccctcgtcc ttcagtgata gcagcattct ggaacaaaga cgccgaattt ggtggtctgt 1920
ctactcttgg gagatccaat t 1941
Claims (10)
1.Gal4 Thermo-sensitive mutants, it is characterised in that：The nucleotide sequence of the mutant is selected from following sequence：
SEQ ID NO in sequence table:6 amino acid sequence；
SEQ ID NO in sequence table:7 amino acid sequence；
SEQ ID NO in sequence table:8 amino acid sequence；
SEQ ID NO in sequence table:9 amino acid sequence；
SEQ ID NO in sequence table:10 amino acid sequence.
2. Gal4 Thermo-sensitive mutants according to claim 1, it is characterised in that the core of coding Gal4 Thermo-sensitive mutants
Nucleotide sequence is selected from one sequence：
SEQ ID NO:Nucleotide sequence shown in 1；
SEQ ID NO:Nucleotide sequence shown in 2；
SEQ ID NO:Nucleotide sequence shown in 3；
SEQ ID NO:Nucleotide sequence shown in 4；
SEQ ID NO:Nucleotide sequence shown in 5；
SEQ ID NO:Nucleotide sequence shown in 6.
3. the preparation method of Gal4 Thermo-sensitive mutants as claimed in claim 1, it is characterised in that
Gal4 Thermo-sensitive mutants storehouse is established by fallibility round pcr first；
Then Gal4 mutation libraries are screened as instruction using the color change of lycopene：
Gene in lycopene route of synthesis is placed under GAL1-10 promoters, the synthetic quantity and Gal4 for making lycopene turn
It is closely related to record activity factor, after saccharomyces cerevisiae GAL4 genes itself are knocked out, will be unable to turn of gene under activation GAL promoters
Record, synthesizes, as heterogenous expression Gal4, lycopene starts to synthesize without related lycopene at this time；
Choosing 30 DEG C of activity reduces or still loses completely, 21 DEG C of temperature sensitive type Gal4 albumen for recovering or partly recovering function.
4. recombinant expression carrier, it is characterised in that the recombinant expression carrier includes the amino acid sequence described in coding claim 1
Row.
5. genetic engineering bacterium, it is characterised in that the genetic engineering bacterium as the recombinant expression carrier described in claim 4 convert to
Obtained in host microorganism.
6. the side of temperature regulation system is built in saccharomyces cerevisiae using Gal4 Thermo-sensitive mutants as claimed in claim 1
Method, it is characterised in that GAL80 genes on S. cerevisiae chromosomal are knocked out first, GAL systems is no longer controlled by galactolipin, into
One step knocks out GAL4 genes with HIS3 labels；Then the recombinant expression carrier described in claim 4 is incorporated into yeast chromosomal
In, build temperature sensitive GAL systems.
7.Gal4 Thermo-sensitive mutants build temperature regulation system in saccharomyces cerevisiae, it is characterised in that the system is using power
Profit requires 6 method to build.
8. Gal4 Thermo-sensitive mutants as claimed in claim 7 build temperature regulation system in carotenoids in saccharomyces cerevisiae
Application in element synthesis.
9. Gal4 Thermo-sensitive mutants according to claim 8 build temperature regulation system in class Hu trailing plants in saccharomyces cerevisiae
Application in Bu Su synthesis, it is characterised in that the gene in carotenogenesis approach is placed in GAL1-GAL10 promoters,
The saccharomyces cerevisiae engineered yeast strain of structure production carotenoid, the growth phase and product for realizing the engineered strain of production carotenoid close
Into the regulation and control stage by stage in stage.
10. Gal4 Thermo-sensitive mutants according to claim 9 build temperature regulation system in class Hu in saccharomyces cerevisiae
Application in radish element synthesis, it is characterised in that the carotenoid is astaxanthin or lycopene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711403958.5A CN107987138B (en) | 2017-12-22 | 2017-12-22 | Gal4 temperature-sensitive mutant, recombinant expression vector, temperature regulation system and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711403958.5A CN107987138B (en) | 2017-12-22 | 2017-12-22 | Gal4 temperature-sensitive mutant, recombinant expression vector, temperature regulation system and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107987138A true CN107987138A (en) | 2018-05-04 |
| CN107987138B CN107987138B (en) | 2020-09-04 |
Family
ID=62041374
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711403958.5A Active CN107987138B (en) | 2017-12-22 | 2017-12-22 | Gal4 temperature-sensitive mutant, recombinant expression vector, temperature regulation system and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107987138B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109929034A (en) * | 2019-03-15 | 2019-06-25 | 杭州贤至生物科技有限公司 | CP4-EPSPS monoclonal antibody and preparation method thereof |
| CN110982721A (en) * | 2019-12-09 | 2020-04-10 | 东莞市东阳光生物合成药有限公司 | Method for improving yield of saccharomyces cerevisiae metabolites |
| CN111196845A (en) * | 2020-01-10 | 2020-05-26 | 扬州大学 | Gal4 protein mutant and application thereof |
| CN112608936A (en) * | 2020-11-24 | 2021-04-06 | 宜昌东阳光生化制药有限公司 | Promoter for regulating and controlling expression of yeast exogenous gene, regulation and control method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH0678767A (en) * | 1992-09-07 | 1994-03-22 | Green Cross Corp:The | Mutant type gal4, its dna and method for enhancing expression of foreign protein with the same mutant type gal4 |
| CN106399139A (en) * | 2016-10-17 | 2017-02-15 | 浙江大学 | Method for improving isoprene synthesis capability of saccharomyces cerevisiae |
| CN106520712A (en) * | 2016-10-17 | 2017-03-22 | 浙江大学 | [Beta]-carotenoid ketolase mutant, recombinant expression vector, genetic engineering bacterium and application thereof |
| US20170198310A1 (en) * | 2015-03-10 | 2017-07-13 | Indian Institute Of Science Education And Research | Increase Production of Isoprenoids in Saccharomyces Cerevisiae by Carotenoid Optimization and Screening |
-
2017
- 2017-12-22 CN CN201711403958.5A patent/CN107987138B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH0678767A (en) * | 1992-09-07 | 1994-03-22 | Green Cross Corp:The | Mutant type gal4, its dna and method for enhancing expression of foreign protein with the same mutant type gal4 |
| US20170198310A1 (en) * | 2015-03-10 | 2017-07-13 | Indian Institute Of Science Education And Research | Increase Production of Isoprenoids in Saccharomyces Cerevisiae by Carotenoid Optimization and Screening |
| CN106399139A (en) * | 2016-10-17 | 2017-02-15 | 浙江大学 | Method for improving isoprene synthesis capability of saccharomyces cerevisiae |
| CN106520712A (en) * | 2016-10-17 | 2017-03-22 | 浙江大学 | [Beta]-carotenoid ketolase mutant, recombinant expression vector, genetic engineering bacterium and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| GHADIYARAM CHAKSHUSMATHI，等: "Design of temperature-sensitive mutants solely from amino acid sequence", 《PNAS》 * |
| KAJARI MONDAL，等: "Design and Isolation of Temperature-sensitive Mutants of Gal4 in Yeast and Drosophila", 《JOURNAL OF MOLECULAR BIOLOGY》 * |
| 谢文平: "代谢工程改造酿酒酵母生物合成类胡萝卜素的研究", 《中国博士学位论文全文数据库》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109929034A (en) * | 2019-03-15 | 2019-06-25 | 杭州贤至生物科技有限公司 | CP4-EPSPS monoclonal antibody and preparation method thereof |
| CN110982721A (en) * | 2019-12-09 | 2020-04-10 | 东莞市东阳光生物合成药有限公司 | Method for improving yield of saccharomyces cerevisiae metabolites |
| CN110982721B (en) * | 2019-12-09 | 2022-04-26 | 宜昌东阳光生化制药有限公司 | Method for improving yield of saccharomyces cerevisiae metabolites |
| CN111196845A (en) * | 2020-01-10 | 2020-05-26 | 扬州大学 | Gal4 protein mutant and application thereof |
| CN112608936A (en) * | 2020-11-24 | 2021-04-06 | 宜昌东阳光生化制药有限公司 | Promoter for regulating and controlling expression of yeast exogenous gene, regulation and control method and application thereof |
| CN112608936B (en) * | 2020-11-24 | 2023-06-09 | 宜昌东阳光生化制药有限公司 | Promoter for regulating and controlling expression of exogenous gene of yeast, regulating and controlling method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107987138B (en) | 2020-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107987138A (en) | Gal4 Thermo-sensitive mutants, recombinant expression carrier, temperature regulation system and its application | |
| CN105087406B (en) | A kind of restructuring yeast strains and its construction method and application | |
| CN105420134B (en) | A kind of restructuring yeast strains and its construction method and application | |
| CN104962488B (en) | A kind of restructuring yeast strains and its construction method and application | |
| CN109666683B (en) | Acetyl coenzyme A acetyltransferase gene RKAcaT2 and application thereof | |
| CN106566779A (en) | Recombinant yeast strain, construction method and application thereof | |
| CN109777815B (en) | HMG-CoA synthetase gene RKHMGCS and application thereof | |
| CN109536518A (en) | A kind of Phytoene dehydrogenase gene RKcrtI and its application | |
| CN109988722B (en) | Recombinant saccharomyces cerevisiae strain, application thereof and method for producing tyrosol and/or salidroside | |
| CN110982721B (en) | Method for improving yield of saccharomyces cerevisiae metabolites | |
| CN111321087A (en) | Yarrowia lipolytica gene engineering bacterium for producing β -carotene and application thereof | |
| CN111434773A (en) | Recombinant yeast for high-yield sandalwood oil and construction method and application thereof | |
| Jeong et al. | Genetic engineering system for syngas-utilizing acetogen, Eubacterium limosum KIST612 | |
| CN111454854A (en) | Rhodosporidium toruloides gene engineering strain for producing astaxanthin | |
| CN109943493A (en) | Realize the mutant strain and its construction method of general enzymatic functional diversity | |
| Zhu et al. | Efficient utilization of carbon to produce aromatic valencene in Saccharomyces cerevisiae using mannitol as the substrate | |
| KR101262999B1 (en) | Recombinant yeast by overexpression of pyruvate decarboxylase and alcohol dehydrogenase for improving productivity of bioethanol and Method for producing ethanol using the same | |
| CN112608936B (en) | Promoter for regulating and controlling expression of exogenous gene of yeast, regulating and controlling method and application thereof | |
| CN114277040B (en) | Construction method and application of efficient synthesis beta-carotene strain | |
| CN113249240B (en) | Saccharomyces cerevisiae for high yield of hydroxytyrosol and construction method thereof | |
| CN106399139B (en) | A method of improving saccharomyces cerevisiae isoprene synthesis capability | |
| CN112391360B (en) | Flavone 3 beta-hydroxylase reductase mutant and application thereof | |
| Štagoj et al. | A novel GAL recombinant yeast strain for enhanced protein production | |
| CN114736918A (en) | Recombinant escherichia coli for producing salidroside through integrated expression and application thereof | |
| CN114606146B (en) | Yeast for producing D-limonene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |