CN106520712A - [Beta]-carotenoid ketolase mutant, recombinant expression vector, genetic engineering bacterium and application thereof - Google Patents
[Beta]-carotenoid ketolase mutant, recombinant expression vector, genetic engineering bacterium and application thereof Download PDFInfo
- Publication number
- CN106520712A CN106520712A CN201610903201.1A CN201610903201A CN106520712A CN 106520712 A CN106520712 A CN 106520712A CN 201610903201 A CN201610903201 A CN 201610903201A CN 106520712 A CN106520712 A CN 106520712A
- Authority
- CN
- China
- Prior art keywords
- seq
- sequence shown
- mutant
- amino acid
- beta carotene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
Abstract
The invention provides a [beta]-carotenoid ketolase mutant, which is obtained through a directed evolution means, nucleotide sequences for encoding the mutant, a recombinant expression vector containing a mutant gene, expression in saccharomyces cerevisiae and application of a genetic engineering bacterium in the synthesis of keto-carotenoids. According to the invention, a mutant strain with catalytic activity on [beta]-carotenoid enhanced is screened by virtue of a high-throughput screening method, and through gene sequencing analysis, mutant sites are subjected to combined mutation, so that the catalytic activity is further enhanced; and the screened mutant strain is applied to the production of saccharomyces cerevisiae keto-carotenoids.
Description
Technical field
The invention belongs to genetic engineering and enzyme engineering field, and in particular to one kind is derived from by orthogenesis means
The beta carotene assimilation enzyme mutant of haematococcus pluvialis bacterial strain, the nucleotide sequence for encoding it, the restructuring containing the mutant gene
Expression vector, and the expression and its application in ketone group carotenogenesis in saccharomyces cerevisiae.
Background technology
Ketone group carotenoid is the important natural colouring matter of the class being present in plant, algae, marine bacteria and fungi,
Belong to C40 isoprenoid compounds, containing on many conjugated double bonds and end hexatomic ring containing unsaturated ketone group, can be with
Single line oxygen is quenched effectively, with very strong oxidation resistance.Therefore there is various physiology and trophic function, can be widely applied to
The every profession and trades such as food, medicine, health products and cosmetics.These carotenoid in the market are mostly by chemical method
Synthesis, and other impurity compounds during chemical synthesis, can be introduced, biological safety is reduced, in addition some classes in chemical synthesis
The configuration of carrotene is big with natural configuration difference, reduces BA.And red ball is given birth to from the microorganism such as rain of natural product
Content, high cost are extracted in algae, phaffiafhodozyma, is difficult at present to be mass produced.Excavate in carotenogenesis approach
Gene, and using these genes, to produce, carotenoid is not only economical but also safety by biological method.Beta carotene assimilation enzyme
It is the key enzyme in ketone group carotenoid (echinenone, canthaxanthin, pot marigold flavine, astaxanthin etc.) route of synthesis.In β-Hu
In the presence of radish element assimilation enzyme, beta carotene can be changed into echinenone and canthaxanthin, it is also possible to by zeaxanthin Jing gold small cups
Hua Huangzhi generates astaxanthin.But these zymolyte effects in vegetative bacteria source are not single-minded, enzyme activity is relatively low.
(3) content of the invention
It is an object of the invention to provide a kind of beta carotene assimilation enzyme mutant obtained by orthogenesis means and
Its application in the middle of carotenogenesis.
The purpose of the present invention also with a kind of beta carotene assimilation enzyme mutant base obtained by orthogenesis means is provided
Because of assimilation enzyme and its application of coding.
SEQ ID in the beta carotene assimilation enzyme gene expressed in saccharomyces cerevisiae Jing after codon optimization such as sequence table
NO:Shown in 15, SEQ ID NO in its amino acid sequence such as sequence table:Shown in 16.The present invention provides above-mentioned oriented evolution and obtains
Beta carotene assimilation enzyme mutant, the nucleotide sequence of the mutator is one of following nucleotide sequences：
(1) SEQ ID NO in sequence table:1 nucleotide sequence；
(2) SEQ ID NO in sequence table:2 nucleotide sequence；
(3) SEQ ID NO in sequence table:3 nucleotide sequence；
(4) SEQ ID NO in sequence table:4 nucleotide sequence；
(5) SEQ ID NO in sequence table:5 nucleotide sequence；
(6) SEQ ID NO in sequence table:6 nucleotide sequence；
(7) SEQ ID NO in sequence table:7 nucleotide sequence；
The beta carotene assimilation enzyme mutant encoded by mutator, the amino of the beta carotene assimilation enzyme mutant
One of following amino acid sequences during acid sequence：
(1) SEQ ID NO in sequence table:8 amino acid sequence；
(2) SEQ ID NO in sequence table:9 amino acid sequence；
(3) SEQ ID NO in sequence table:10 amino acid sequence；
(4) SEQ ID NO in sequence table:11 amino acid sequence；
(5) SEQ ID NO in sequence table:12 amino acid sequence；
(6) SEQ ID NO in sequence table:13 amino acid sequence；
(7) SEQ ID NO in sequence table:14 amino acid sequence；
It is any to SEQ ID NO：In amino acid sequence shown in 14, amino acid is through lacking, inserting or replace one or several
Amino acid and with sequence SEQ ID NO：14 sequences in amino acid levels with least 70% homology, and there is β-carrot
Plain assimilation enzymatic activity, i.e., with for example by beta carotene be transformed into canthaxanthin or by luteole be transformed into astaxanthin work
Property, still fall within protection scope of the present invention.
Wherein, the SEQ ID NO in sequence table:8 amino acid sequences encoded beta carotene assimilation enzyme is named as
OBKT-M1, relative to wild type SEQ ID NO:16 amino acid its 165th Histidine mutagenesis are into arginine；Sequence
SEQ ID NO in table:9 amino acid sequences encoded beta carotene assimilation enzyme is named as OBKT-M2, relative to wild type its
The valine mutation of the 264th is into aspartic acid；SEQ ID NO in sequence table:10 amino acid sequences encoded β-carrot
Plain assimilation enzyme is named as OBKT-M3, and relative to wild type, its 298th phenylalanine becomes threonine；SEQ in sequence table
ID NO:11 amino acid sequences encoded beta carotene assimilation enzyme is named as OBKT-M12, and which is relative to wild type the 165th
Histidine mutagenesis into arginine, the valine mutation of the 264th into aspartic acid；SEQ ID NO in sequence table:12
Amino acid sequences encoded beta carotene assimilation enzyme is named as OBKT-M13, and which is dashed forward relative to the histidine of wild type the 165th
Become arginine, the phenylalanine of the 298th and become threonine；SEQ ID NO in sequence table:13 amino acid sequence is compiled
The beta carotene assimilation enzyme of code is named as OBKT-M23, relative to wild type its 264th valine mutation into asparagus fern ammonia
Acid, the phenylalanine of the 298th become threonine；SEQ ID NO in sequence table:13 amino acid sequences encoded β-Hu Luo
Bu Su assimilation enzymes are named as OBKTM, relative to wild type its 165th Histidine mutagenesis into arginine, the figured silk fabrics of the 264th
Histidine mutations become threonine into the phenylalanine of aspartic acid, the 298th.
The invention further relates to include the recombinant expressed load of saccharomyces cerevisiae of the beta carotene assimilation enzyme gene of the present invention
Body.The expression vector builds by the following method and obtains：By SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ
ID NO:4、SEQ ID NO:5、SEQ ID NO:6 or SEQ ID NO:Beta carotene assimilation enzyme gene shown in 7
ObktM1, ObktM2, ObktM3, ObktM12, ObktM13, ObktM23, ObktM are inserted into saccharomyces cerevisiae integrating vector
PUMRI-11 (No. NCBI：KM216413 in), obtain comprising ObktM1, ObktM2, ObktM3, ObktM12, ObktM13,
Saccharomyces cerevisiae integrated expression plasmid PUMRI-11-ObktM1, the PUMRI-11-ObktM2 of ObktM23, ObktM gene,
PUMRI-11-ObktM3, PUMRI-11-ObktM12, PUMRI-11-ObktM13, PUMRI-11-ObktM23, PUMRI-11-
ObktM.
The invention further relates to the engineered strain of beta carotene assimilation enzyme gene is expressed accordingly, by the wine brewing ferment
Female integrated plasmid is transformed in saccharomyces cerevisiae so that described beta carotene assimilation enzyme gene table in transgenic Saccharomyces
Reach.
Present invention also offers the method that ketonization carotenoid is produced using beta carotene assimilation enzyme.Will be described
Beta carotene assimilation enzyme is expressed in the specific bacterial strain for producing beta carotene.
The invention further relates to produce the carotenoid that culture yeasts bacterial strain and extracting are produced under conditions of carotenoid
The step of.
Compared with prior art, the present invention has advantages below：
The present invention is with haematococcus pluvialis source and basis carries out the beta-carotenone after codon optimization in saccharomyces cerevisiae
It is research object to change enzyme OBKT, using fallibility round pcr, using saccharomyces cerevisiae expression system, establishes beta carotene assimilation enzyme
Mutation library, filters out the mutant strain improved to beta carotene catalysis activity by high-throughput screening method, and passes through gene sequencing
Catastrophe point is combined mutation by analysis, further improves catalysis activity, and by the saccharomyces cerevisiae of the mutant strain application for screening
In the production of ketonization carotenoid.
Description of the drawings
Fig. 1 is the plasmid map for orthogenesis.
Policy maps of the Fig. 2 for orthogenesis beta carotene assimilation enzyme.
Fig. 3 is the expression activitiy figure of beta carotene assimilation enzyme mutant and wild type.
Fig. 4 is the Wine brewing yeast strain carotenoid HPLC com-parison and analysis figures containing OBTKM Yu wild type.
Specific embodiment
With reference to specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in
This：
The molecular cloning of 1 beta carotene assimilation enzyme mutant gene of embodiment and expression
1.1 materials and methods
1.1.1 reagent and culture medium prescription
High-fidelity enzyme dna polymerase Prime STARTMIn HS DNA polymeras, T4DNA ligases, DNA are restricted
Enzyme cutting is purchased from Takara companies, and Easy Taq archaeal dna polymerases are purchased from Beijing Quanshijin Biotechnology Co., Ltd, DNA
Marker (1kb DNAL ladder) (Thermo Scientific), PCR primer purification kit, DNA gel purified reagent
Box (Axygen, Hangzhou) equimolecular biological reagent box is used for the operation such as gene cloning；PCR primer synthesizes and is sequenced service by upper
Marine growth Engineering Co., Ltd or Bo Shang biotech firms provide.
Without amino yeast nitrogen base (Yeast nitrogen base without amino acids, YNB) (green enlightening medical treatment
Apparatus, Shanghai) for the preparation of synthetic media；Astaxanthin standard items are new by Zhejiang and provide into Co., Ltd, canthaxanthin mark
Quasi- product are purchased from Aladdin company, and the standard items of beta carotene are purchased from Sigma-Aldrich companies；0.22 μm of cellulose mixture pin
Formula filter is purchased from Shanghai bioengineering Co., Ltd；Other reagents and medicine for not doing specified otherwise are domestic pure analysis pure.
100mg/mL ampicillins (Ampicillin)：Weigh 1g ampicillins to be placed in 15mL centrifuge tubes, with going out
Bacterium water constant volume to 10mL be sufficiently mixed dissolving after, using aseptic 0.22 μm of syringe filter filtration sterilization, be dispensed into 1.5mL from
Heart pipe is preserved after -20 DEG C.Working concentration is 100 μ g/mL.
50mg/ml kanamycins：
0.1mol/L CaCl2-MgCl2Solution (MgCl containing 80mmol/L2, 20mmol/L CaCl2)：Weigh MgCl2·
6H2O16.26g, CaCl22.22g, deionized water dissolve and are settled to 1L, 121 DEG C of sterilizing 15min, cool down after 4 DEG C of refrigerators
Preserve.
Glycerine-CaCl2Solution (the CaCl containing 0.1mol/L2With 20% glycerine)：Weigh CaCl211.1g with 20% it is sweet
Oil solution dissolves and constant volume is to 1L, 121 DEG C of sterilizing 15min, cools down after 4 DEG C of Refrigerator stores.
1mol/L sorbierites：182.17g sorbierites are weighed, plus deionized water constant volume are to 1L, 121 DEG C of autoclaving 15min,
Cooling is after 4 DEG C of Refrigerator stores.
Luria-Bertani (LB) culture medium：NaCl 10g/L, peptone 10g/L, yeast extract 5g/L, 1mol/L
NaOH is adjusted to pH=7.2, the agar powder of solid LB media addition 2%, 121 DEG C of sterilizing 15min.
Yeast Extract Peptone Dextrose (YPD) culture mediums：Yeast extract 10g/L, peptone 20g/
The agar powder of L, glucose 20g/L, solid YPD culture medium addition 2%, 115 DEG C of sterilizing 15min.
10 × amino acid liquid storage (10 × Dropout Solution, 10 × DO)：Following various amino acid are weighed, are mixed,
It is dissolved in aqua sterilisa so as to final concentration of：L-Adenine hemisulfate salt 200mg/L, L-Arginine HCl
200mg/L, L-Histidine HCl monohydrate 200mg/L, L-Isoleucine 300mg/L, L-Leucine
1000mg/L, L-Lysine HCl 300mg/L, L-Methionine 200mg/L, L-Phenylalanine 500mg/L, L-
Threonine 2000mg/L, L-Tryptophan 200mg/L, L-Tyrosine 300mg/L, L-Uracil 200mg/L,
L-Valine 1500mg/L.When preparing above-mentioned amino acid liquid storage, according to required for screening different choice mark, disappearance is corresponding
Amino acid.Span amino acid mother liquor is deposited in 4 DEG C of refrigerators using 0.22 μm of syringe filter filtration sterilization.
10 × glucose solution (20g/L)：Weigh 20g glucose, the constant volume that adds water to 1L, 115 DEG C sterilizing 15min, 4 DEG C of ice
Case is preserved.
10 × galactose solution (20g/L)：Weigh 20g galactolipins, the constant volume that adds water to 1L, 115 DEG C sterilizing 15min, 4 DEG C of ice
Case is preserved.
Synthetic Defined culture mediums：YNB 1.7g are weighed, anhydrous slufuric acid ammonia 5g, agar powder 20g (make flat board
Shi Tianjia), 10 × DO 100mL, add water and are settled to 900mL, 115 DEG C of sterilizing 15min.It is to be cooled to after room temperature, according to experiment need
10 × glucose of 100mL to be added, or 10 × galactose solution, are configured to corresponding SD or SG culture mediums.If culture medium
In lack corresponding nutrient content in DO and then mark behind, such as SD-URA indicates the SD culture mediums without bird pyrimidine.
1.1.2 it is prepared by bacillus coli DH 5 alpha competence
Colibacillary MgCl2-CaCl2Competent cell preparation method and conversion are with reference to molecular cloning protocols handbook.If nothing
Special instruction, escherichia coli plasmid extracting, DNA gel recovery, the connection of DNA fragmentation, RNA extractings etc. are according to corresponding reagent
The specification of box is operated.
Escherichia coli cloning after conversion is identified using the method for bacterium solution PCR.The picking single bacterium colony from flat board, connects
Plant in the LB test tubes containing corresponding antibiotic.Thalline grow to slight mist it is flower-shaped after, take bacterium solution as template, using Easy Taq
Archaeal dna polymerase carries out the checking of bacterium solution PCR.Selecting positive colony correspondence test tube carries out plasmid extraction, and carries out DNA to cloning section
Sequencing identification.
1.1.3 the preparation and conversion of saccharomyces cerevisiae Electroporation-competent cells
Yeast Electroporation-competent cells manufacturing process is as follows：
(1) from flat board, picking yeast colony is inoculated in the YPD culture mediums of 5mL, 30 DEG C of culture 12h.Turn 50 μ l cultures
To in 50mL YPD culture mediums, 30 DEG C of incubated overnights make cell concentration to OD to thing600=2 or so.
(2) bacterium solution is transferred in 50mL centrifuge tubes, 3000 × g centrifugation 5min, removes supernatant.
(3) using the aqua sterilisa re-suspended cell of 30mL precoolings on ice, supernatant is removed in 3000 × g centrifugation 5min centrifugations.
(4) using 20mL precoolings on ice 1M sorbitol washes cell precipitation, 3000 × g centrifugation 5min, centrifugation go
Clearly.
(5) using the sorbierite re-suspended cell of 200 μ l-500 μ l 1M, and it is transferred in the 1.5mL centrifuge tubes of precooling, i.e.,
Make competent yeast cells.Yeast electricity conversion every time should prepare fresh competent cell to ensure enough conversion ratios.
Yeast conversion step is as follows：
(1) 2-5 μ l plasmids or linearized fragment are taken, is added in the 1.5mL centrifuge tubes of precooling.
(2) if using the electric revolving cup of 2mm, the competent cell of 40 μ l is added toward centrifuge tube；If the electricity using 1mm turns
Cup, adds the competent cell of 20 μ l.Cell is transferred in electric revolving cup after gently blowing and beating mixing with rifle with DNA in centrifuge tube,
Precooling 5min on ice.
(3) water of electricity conversion cup periphery is wiped clean with blotting paper, is shocked by electricity under the electric shock intensity of 750V/mm.
(4) 1mL YPD culture mediums are added toward the electric revolving cup after electric shock, gently suspension cell, is transferred to 1.5mL centrifuge tubes
In, recovery 2h is stood in 30 DEG C of incubators.
(5) cell after recovering is cleaned with aqua sterilisa twice, is taken appropriate cell and is applied to corresponding agar plate.30℃
Incubator culture occurs for 2-3 days to single bacterium colony.
1.2 obtain beta carotene mutator by fallibility PCR
First by the Obkt genes (No. NCBI synthesized Jing after codon optimization:KP866870) it is cloned into p416XWP-PCYC1
On plasmid, then with p416XWP-PCYC1- Obkt t are template, with PCYC1F2 (ACACACACTAAATTAATAGAATTCAAC)
With ADH1tR2 (CAACCTTGATTGGAGACTTGAC) as primer, using Taq archaeal dna polymerases, by the method for fallibility PCR
Obtain Obkt mutant libraries.Due to Mn2+The base mispairing rate of PCR processes can be increased, when fallibility PCR is carried out using Taq enzyme,
A certain amount of MnCl is added in system2With the gene mutation rate during increase PCR.Error-prone PCR systems are：
PCR reaction conditions are：95 DEG C of 3min of denaturation, subsequently into temperature cycles, denaturation, 95 DEG C of 30s；Annealing, 54
℃30s；Extend 72 DEG C, 1min, totally 30 circulations, last 72 DEG C of extensions 5min, final temperature is 4 DEG C.
With linearizing p416XWP-P after fallibility PCR primer is cleanedCYC1Plasmid (carries out double enzymes with NotI and SacI
Cut), the method turned by electricity proceeds to the YXWP-77 of the product beta carotene containing tHMG1, crtE, crtYB, crtI gene jointly
In bacterial strain, it is coated on the flat board of SD-URA defects, cultivates 3 days；Then, by dithering, picking color reddens intensification
Bacterial strain.Positive mutants strain plasmid is extracted with saccharomyces cerevisiae extracts kit, the plasmid of extraction is gone in bacillus coli DH 5 alpha and is expanded
Increase, sequencing.
The sequencing results of mutant are as shown in table 1 below
The structure of saccharomyces cerevisiae expression of the embodiment 2 comprising beta carotene assimilation enzyme mutant and linearisation
2.1 expression vector establishment
By NotI the and SacI double digestions of the plasmid containing Positive mutants strain obtained in embodiment 1.2, beta carotene is obtained
PUMRI-11 plasmids (No. NCBI after assimilation enzyme mutant gene and same NotI and SacI double digestions：KM216413) connection is converted.
Double digestion system：20 μ l of total system
Gene/plasmid:17μl
10×buffer:2μl
NotI enzymes：0.5μl
SacI enzymes：0.5μl
Digestion condition:37 DEG C are placed, 1.5-2 hour of digestion
Linked system:
Gene：5.5 μ l, 3 μ l of plasmid, 10 × T4DNA ligase buffer, 1 μ l, T4DNA ligases；0.5μl.
The conversion of competent cell:The connection product of 10 μ l is added in the competent cell of 100 μ l thawed on ice, is used
Liquid-transfering gun is gently mixed, ice bath 20-40min；42 DEG C of thermal shock 90s, are put in ice rapidly, ice bath 5min；Addition 1ml LB cultures
Base, 37 DEG C, 220rpm concussion and cultivates 50min, in 1200rpm centrifugation 1min, remove supernatant, remaining 200 μ l mix be coated on card that
On the LB flat boards of resistance, the positive colony obtained in 37 DEG C of overnight incubations is used for plasmid extraction.
The expression vector linearisation of 2.2 restructuring
Recombinant vector contains DPP1 homology arms, contains SfiI sites at homology arm, is linearized by SfiI enzymatic cleavage methods.
Digestion system：50 μ l of total system, 43.5 μ l of plasmid, 10 × G buffer, 5 μ l, 1.5 μ l of SfiI enzymes.
Digestion condition：Place 2-3 hour of 50 DEG C of digestions
Beta carotene assimilation enzyme mutant strain is incorporated into embodiment 3 dyeing enterprising one of the saccharomyces cerevisiae for producing beta carotene
Step is demonstrate,proved
The linearizing plasmid that obtains recombinating in embodiment 2 is incorporated into product beta carotene according to the method in embodiment 1.1.3
S. cerevisiae chromosomal on, be coated on the YPD flat boards containing G418 resistances.Mutant OBKTM1, OBKTM2, OBKTM3 show
Show active raising, promote conversion of the beta carotene to astaxanthin.It is as shown in Figure 3 with wild type result of the comparison.
Embodiment 4 further improves the vigor of beta carotene assimilation enzyme by combinatorial mutagenesis
Embodiment 1.2 is obtained into three catastrophe points and is combined mutation, obtain the mutant containing two catastrophe points
OBKTM12 (H165R/V264D), OBKTM13 (H165R/F298Y), OBKTM23 (V264D/F298Y) and contain three points
Mutant OBKTM (H165R/V264D/F298Y), these mutant are built into integrating vector according to embodiment 2, are gone to
Produce in the saccharomyces cerevisiae of beta carotene.The vigor of combinatorial mutagenesis is higher than simple point mutation, and preferred three point mutation bodies OBKTM lives
Property highest, first improves 2.5 times than wild type, and precursor beta carotene is converted into echinenone and canthaxanthin, so as to β-carrot
The yield of element have dropped 50%, and concrete outcome is as shown in Figure 3.All kinds of Hus of Wine brewing yeast strain containing OBKTM Yu wild type gene
Radish element composition liquid phase analysis are as shown in Figure 4.For do rite-directed mutagenesis primer and for PCR sequencing primer GAL10F and
ADH1tR2 is as shown in table 2
Embodiment 5 is incorporated into ObktM mutant and beta carotene hydroxylase in saccharomyces cerevisiae to produce astaxanthin
With PUMRI-11-ObktM as template Obkt-F1 (BamHI) (CAGGGATCCATGCACGTTGCTTCTGCT) and
Obkt-R(SalI)(GGAAGTCGACTTAAGCCAAAGCTGGAACCA is primer amplification containing BamHI and SalI restriction enzyme sites
ObktM genes, and used BamHI and SalI double digestions, then with the same carrier with after BamHI and SalI double digestions
PIMRI-11-OcrtZ connection conversions are cloned, and are operated the recombinant plasmid pUMRI-11-OcrtZ- for obtaining with embodiment 2
ObktM and build before pUMRI-11-OcrtZ-Obkt (Zhou et al., 2015) with after SfiI linearisations each
Go in the saccharomyces cerevisiae containing beta carotene.Obtain bacterial strain and find that the astaxanthin containing OBKTM mutation is produced Jing after HPLC analyses
Amount is than improve 48% containing wild type.
Embodiment 6 is extracted carotenoid from brewing yeast cell and the yield of carotenoid is analyzed by HPLC
The saccharomyces cerevisiae engineered yeast picking single bacterium colony of carotenoid will be produced into 5mlYPD test tubes, 30 DEG C of 220rpm is carried out
Incubated overnight, it is 0.05 to be then transferred in 50mlYPD culture mediums to whole OD.30 DEG C of 220rpm is cultivated 84 hours.Carotenoids
The extracting of element takes hot acid method to carry out, and method of operating is as follows：
(1) after taking fermentation, in 15mL centrifuge tubes, 4000 × g centrifugation 1min remove supernatant to culture 1mL.
(2) supernatant is removed in the cell precipitation pure aqueous suspensions of 5mL, 4000 × g centrifugation 1min.
(3) with 1mL 3M hydrochloric acid suspension cells, in boiling water bath, 3min carries out clasmatosis, is placed in ice-water bath immediately after
Cooling 3-5min, removes supernatant after centrifugation.
(4) precipitated using 5mL pure water re-suspended cell, 4000 × g centrifugation 1min outwell supernatant to remove what is wherein remained
Hydrochloric acid.
(5) 4mL acetone being added in centrifuge tube, covering tightly centrifuge tube, vortex oscillation makes cell precipitation thoroughly disperse, extracts which
In carotenoid.
(6) the above-mentioned centrifuge tube containing extract is placed in into ultrasound 10min in ultrasonic cleaning instrument, thoroughly extracts class therein
Carrotene.
(7) 4 DEG C, supernatant is filtered by 4000 × g centrifugation 2min with 0.45 μm of organic system pin type filter, and filtrate can
Determine for total carotinoid and HPLC is analyzed.
2mL bacterium solution is taken to 2mL centrifuge tube in while bacterium solution is used to and extract carotenoid collecting, 12000 × g is centrifuged
1min, removes culture medium, and add water washing one time, then supernatant is centrifuged.The centrifuge tube that carrier is precipitated is positioned over into 90 DEG C of baking ovens
Middle process 8h or so is obtaining dry mycelium.The carotenoid obtained according to extracting and the dry weight of thalline calculate carotenoid
Per dry wt content (mg/g DCW).
Using following condition, carotenoid composition and content in saccharomyces cerevisiae are detected by HPLC.Liquid phase analysis instrument is
The LC-20AT of Shimadzu, chromatographic column be Amethyst C18-H reversed-phase columns (4.6 × 150mm, 5 μm, Sepax Technologies,
Inc).40 DEG C of column temperature, Detection wavelength 470nm.Using gradient elution, it is acetonitrile and water (90 that mobile phase is A pumps:10), B pumps are first
Alcohol and isopropanol (60:40), flow velocity is 1mL/min, and elution requirement is as follows：0-15min, B pump mobile phase is raised to 90% from 0；15-
30min keeps the mobile phase 90% of B pumps；30-35min B pumps mobile phases drop to 0 from 90%.The following is various carotenoid to protect
Stay the time：Astaxanthin, 7.6min；Canthaxanthin, 11.5min；Echinenone, 17.6min；Beta carotene, 24.5min.
Claims (10)
1. a kind of beta carotene assimilation enzyme mutant, it is characterised in that：Encode the core of the beta carotene assimilation enzyme mutant
Nucleotide sequence is selected from following mutation sequence：
SEQ ID NO:Nucleotide sequence shown in 1；
SEQ ID NO:Nucleotide sequence shown in 2；
SEQ ID NO:Nucleotide sequence shown in 3；
SEQ ID NO:Nucleotide sequence shown in 4；
SEQ ID NO:Nucleotide sequence shown in 5；
SEQ ID NO:Nucleotide sequence shown in 6；
SEQ ID NO:Nucleotide sequence shown in 7.
2. beta carotene assimilation enzyme mutant according to claim 1, it is characterised in that the beta carotene assimilation enzyme
The amino acid sequence of mutant is selected from following nucleotide sequences：
SEQ ID NO:Amino acid sequence shown in 8；
SEQ ID NO:Amino acid sequence shown in 9；
SEQ ID NO:Amino acid sequence shown in 10；
SEQ ID NO:Amino acid sequence shown in 11；
SEQ ID NO:Amino acid sequence shown in 12；
SEQ ID NO:Amino acid sequence shown in 13；
SEQ ID NO:Amino acid sequence shown in 14.
3. beta carotene assimilation enzyme mutant according to claim 2, it is characterised in that the beta carotene assimilation enzyme
The amino acid sequence of mutant is SEQ ID NO:Amino acid sequence shown in 14.
4. recombinant expression carrier, it is characterised in that the recombinant expression carrier includes the nucleotide sequence described in claim 1.
5. recombinant expression carrier according to claim 4, it is characterised in that the carrier is fermented glutinous rice yeast integrated plasmid.
6. genetic engineering bacterium, it is characterised in that the genetic engineering bacterium is recombinant expressed by described in claim 3-4 any one
Carrier converts into host microorganism acquisition.
7. genetic engineering bacterium according to claim 6, it is characterised in that the host microorganism is fermented glutinous rice yeast.
8. application of the genetic engineering bacterium as claimed in claims 6 or 7 in ketonization carotenoid is prepared.
9. the method for preparing ketonization carotenoid, it is characterised in that by the β-carrot described in claim 1-3 any one
Plain assimilation enzyme mutant is expressed in the bacterial strain for producing beta carotene.
10. the method for preparing ketonization carotenoid according to claim 9, it is characterised in that produce beta carotene
Bacterial strain is the genetic engineering bacterium described in claim 6 or 7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610903201.1A CN106520712B (en) | 2016-10-17 | 2016-10-17 | Beta carotene assimilation enzyme mutant, recombinant expression carrier, genetic engineering bacterium and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610903201.1A CN106520712B (en) | 2016-10-17 | 2016-10-17 | Beta carotene assimilation enzyme mutant, recombinant expression carrier, genetic engineering bacterium and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106520712A true CN106520712A (en) | 2017-03-22 |
| CN106520712B CN106520712B (en) | 2019-07-23 |
Family
ID=58331930
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610903201.1A Active CN106520712B (en) | 2016-10-17 | 2016-10-17 | Beta carotene assimilation enzyme mutant, recombinant expression carrier, genetic engineering bacterium and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106520712B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107987138A (en) * | 2017-12-22 | 2018-05-04 | 浙江大学 | Gal4 Thermo-sensitive mutants, recombinant expression carrier, temperature regulation system and its application |
| CN108977414A (en) * | 2018-08-16 | 2018-12-11 | 中国科学院昆明植物研究所 | The artificial synthesized mutant and its coded sequence of a kind of beta carotene assimilation enzyme and application |
| CN112852764A (en) * | 2020-08-12 | 2021-05-28 | 中国科学院天津工业生物技术研究所 | Mutant protein of ketonizing enzyme and application |
| WO2024001460A1 (en) * | 2022-06-30 | 2024-01-04 | 武汉合生科技有限公司 | Method and carrier for biosynthesis of astaxanthin |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060141558A1 (en) * | 2004-12-29 | 2006-06-29 | Xiao-Song Tang | Bioproduction of astaxanthin using mutant carotenoid ketolase and carotenoid hydroxylase genes |
| JP2007502605A (en) * | 2003-08-18 | 2007-02-15 | サンジーン ゲーエムベーハー | Method for producing ketocarotenoids in genetically modified non-human organisms |
| WO2007120426A1 (en) * | 2006-03-30 | 2007-10-25 | E. I. Du Pont De Nemours And Company | Mutant carotenoid ketolases |
| CN105316357A (en) * | 2015-10-14 | 2016-02-10 | 华东理工大学 | Method for producing astaxanthin by using transgenic microalgae |
-
2016
- 2016-10-17 CN CN201610903201.1A patent/CN106520712B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2007502605A (en) * | 2003-08-18 | 2007-02-15 | サンジーン ゲーエムベーハー | Method for producing ketocarotenoids in genetically modified non-human organisms |
| US20060141558A1 (en) * | 2004-12-29 | 2006-06-29 | Xiao-Song Tang | Bioproduction of astaxanthin using mutant carotenoid ketolase and carotenoid hydroxylase genes |
| WO2007120426A1 (en) * | 2006-03-30 | 2007-10-25 | E. I. Du Pont De Nemours And Company | Mutant carotenoid ketolases |
| CN105316357A (en) * | 2015-10-14 | 2016-02-10 | 华东理工大学 | Method for producing astaxanthin by using transgenic microalgae |
Non-Patent Citations (1)
| Title |
|---|
| 汤晓玲等: "通过定向进化策略提高酯酶立体选择性的研究", 《高校化学工程学报》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107987138A (en) * | 2017-12-22 | 2018-05-04 | 浙江大学 | Gal4 Thermo-sensitive mutants, recombinant expression carrier, temperature regulation system and its application |
| CN107987138B (en) * | 2017-12-22 | 2020-09-04 | 浙江大学 | Gal4 temperature-sensitive mutant, recombinant expression vector, temperature regulation system and application thereof |
| CN108977414A (en) * | 2018-08-16 | 2018-12-11 | 中国科学院昆明植物研究所 | The artificial synthesized mutant and its coded sequence of a kind of beta carotene assimilation enzyme and application |
| CN108977414B (en) * | 2018-08-16 | 2020-09-04 | 中国科学院昆明植物研究所 | Artificially synthesized mutant of beta-carotene ketolase and coding sequence and application thereof |
| CN112852764A (en) * | 2020-08-12 | 2021-05-28 | 中国科学院天津工业生物技术研究所 | Mutant protein of ketonizing enzyme and application |
| WO2024001460A1 (en) * | 2022-06-30 | 2024-01-04 | 武汉合生科技有限公司 | Method and carrier for biosynthesis of astaxanthin |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106520712B (en) | 2019-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| León et al. | Metabolic engineering of ketocarotenoids biosynthesis in the unicelullar microalga Chlamydomonas reinhardtii | |
| CN107641621B (en) | Glycosidase composition and method for preparing icariin by enzyme method | |
| CN106520712A (en) | [Beta]-carotenoid ketolase mutant, recombinant expression vector, genetic engineering bacterium and application thereof | |
| CN109666683B (en) | Acetyl coenzyme A acetyltransferase gene RKAcaT2 and application thereof | |
| CN105861538B (en) | A kind of recombinant plasmid and restructuring yeast strains and its construction method and application | |
| CN113621630B (en) | 3-ketoacyl-CoA thiolase gene RkACAA1-1 and application thereof | |
| CN107586795B (en) | Method for producing phloretin by fermentation of saccharomyces cerevisiae | |
| CN113652440B (en) | 3-ketoacyl coenzyme A thiolase gene RKACAA1-2 and application thereof | |
| CN111575310B (en) | Recombinant saccharomyces cerevisiae expressing caveolin and application thereof | |
| CN112029752B (en) | Ulva lactuca polysaccharide lyase as well as coding gene and application thereof | |
| CN112410355A (en) | Acyl-coenzyme A oxidase 2 gene RKACOX2 and application thereof | |
| CN113621631A (en) | Mevalonate kinase gene RKMK and application thereof | |
| CN105316357A (en) | Method for producing astaxanthin by using transgenic microalgae | |
| CN115851779B (en) | Glucose-6-phosphate dehydrogenase gene RkZWF1 and application thereof | |
| CN106754607A (en) | A kind of recombinant bacterial strain and its construction method for producing tyrosol | |
| CN107460203B (en) | Recombinant bacterium for producing salidroside and analogues thereof, construction method and application | |
| CN109943493A (en) | Realize the mutant strain and its construction method of general enzymatic functional diversity | |
| CA2498800A1 (en) | Sqs gene | |
| CN106801028B (en) | Engineering bacterium for producing high-content zeaxanthin or astaxanthin and application thereof | |
| CN108373980A (en) | A kind of S. cervisiae, its construction method and its application in fermentation prepares lycopene | |
| CN112608936B (en) | Promoter for regulating and controlling expression of exogenous gene of yeast, regulating and controlling method and application thereof | |
| CN115176024A (en) | Astaxanthin high-producing strain of phaffia rhodozyma | |
| CN104278015B (en) | One plant height effect is overexpressed the phaffia rhodozyma bacterial strain of endogenous chemical activators enzyme gene | |
| CN109055417B (en) | Recombinant microorganism, preparation method thereof and application thereof in production of coenzyme Q10 | |
| CN104962530A (en) | Enzyme fusion expression protein and application of enzyme fusion expression protein to astaxanthin production |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |