CN112029752B - Ulva lactuca polysaccharide lyase as well as coding gene and application thereof - Google Patents

Ulva lactuca polysaccharide lyase as well as coding gene and application thereof Download PDF

Info

Publication number
CN112029752B
CN112029752B CN201910475251.8A CN201910475251A CN112029752B CN 112029752 B CN112029752 B CN 112029752B CN 201910475251 A CN201910475251 A CN 201910475251A CN 112029752 B CN112029752 B CN 112029752B
Authority
CN
China
Prior art keywords
gly
asp
thr
asn
lys
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910475251.8A
Other languages
Chinese (zh)
Other versions
CN112029752A (en
Inventor
王鹏
张京良
徐锡明
高健
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ocean University of China
Original Assignee
Ocean University of China
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ocean University of China filed Critical Ocean University of China
Priority to CN201910475251.8A priority Critical patent/CN112029752B/en
Priority to PCT/CN2019/096475 priority patent/WO2020244031A1/en
Priority to JP2021521492A priority patent/JP7241368B2/en
Publication of CN112029752A publication Critical patent/CN112029752A/en
Application granted granted Critical
Publication of CN112029752B publication Critical patent/CN112029752B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/12—Disaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/07—Bacillus
    • C12R2001/125—Bacillus subtilis ; Hay bacillus; Grass bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

The invention provides an ulva polysaccharide lyase, and a coding gene and application thereof, wherein the amino acid sequence of the ulva polysaccharide lyase is shown as (i) or (ii): (i) the amino acid sequence is shown as SEQ ID NO. 1; (ii) the amino acid sequence in (i) is substituted, deleted or added with one or more amino acids and has ulva polysaccharide lyase activity. The ulva polysaccharide lyase prepared by the invention realizes the construction of a new ulva polysaccharide lyase recombinant vector and the efficient expression of escherichia coli, and realizes the large-scale production of the ulva polysaccharide lyase, the ulva polysaccharide lyase has high activity, high purity and excellent physicochemical property, can efficiently degrade green algae polysaccharide to prepare green algae oligosaccharide, can be widely applied to the fields of food, medicine, chemical industry, polysaccharide structure analysis and the like, and has wide market application prospect.

Description

Ulva lactuca polysaccharide lyase as well as coding gene and application thereof
Technical Field
The invention belongs to the technical field of biology, and particularly relates to ulva polysaccharide lyase and a coding gene and application thereof.
Background
Ulvan is a highly sulfated polysaccharide extracted from ulva cell walls, and mainly consists of rhamnose sulfate, glucuronic acid, xylose and iduronic acid. Research shows that the ulva polysaccharide has multiple physiological activities of oxidation resistance, anticoagulation, tumor resistance, immunoregulation and the like, and has wide application value in the fields of food, medicine and the like. However, the ulva polysaccharide with high molecular weight is not easy to absorb and has high viscosity, so that the development and application of the ulva polysaccharide are limited.
At present, methods for degrading ulva polysaccharide mainly comprise: acid degradation, microwave-assisted degradation, ascorbic acid-hydrogen peroxide combined degradation and enzymatic degradation. The acid method is simple and easy to degrade, but can cause sulfate group to fall off, destroy the structure of oligosaccharide, and has complex product, difficult separation and purification and environmental pollution. Although the microwave-assisted method and the ascorbic acid and hydrogen peroxide combined method can better retain the oligosaccharide structure, the yield is low, the cost is high, and the requirements of large-scale production are not met. The enzymatic degradation has better substrate specificity, efficient and stable reaction process, mild reaction condition, complete preservation and good uniformity of active groups of enzymatic products, easy separation and purification, high yield and excellent quality, and has remarkable advantages compared with a physical chemical method.
According to the knowledge of the inventor through data review and literature search, the ulva polysaccharide lyase can eliminate the bond between rhamnose sulfate and glucuronic acid in the broken ulva polysaccharide sugar chain through beta, and the ulva polysaccharide lyase can be divided into three families according to degradation characteristics and sequence similarity: polysaccharide lyases family 24, 25, 28. Lahaye et al (Carbohydr Res,1997) discovered the first marine bacterium capable of degrading ulva polysaccharides. The ulva polysaccharide lyase producing strain is mainly derived from Alteromonas (Alteromonas), Pseudoalteromonas (Pseudomonas), Marine flavobacterium (Marine flavobacterium) and the like. CN105624067 discloses a method for producing rhamnan sulfate from pseudoalteromonas marine bacteria, wherein the rhamnan sulfate can be degraded to produce oligosaccharide, the molecular weight is 110.6kDa, but the enzyme activity of the fermentation liquid is low and is only 3.5U/mL. At present, the ulva polysaccharide lyase produced by wild bacteria fermentation has a plurality of problems: the enzyme activity is low, no coding gene is obtained, and recombinant expression, molecular modification and the like cannot be carried out; the recombinant expression of engineering bacteria becomes a new idea for developing and applying ulva polysaccharide lyase, and Collen et al (Journal of Biological Chemistry,2011,286) find from Nonbabens ulvanivorans which can use ulva to grow and use a large intestine system to express an endo-type ulva polysaccharide lyase with molecular weight of 46kDa (JN104480), and the lyase belongs to polysaccharide lyase 28 family. Kopel (Journal of Biological Chemistry,2016) et al expressed ulva polysaccharide lyase (WP _032096165.1) from Alteromonas sp.LOR recombinantly using E.coli, with the expressed protein having a molecular weight of 111kDa, belonging to the polysaccharide lyase 24 family. Foran (Algal Research,2017) et al, belonging to the family 25 of polysaccharide lyases, recombinantly expressed in E.coli a ulvan polysaccharide lyase (WP _052010178.1) derived from Alteromonas sp.LOR. However, the number of members in the recombinant expression enzyme families is small, and in order to better develop and utilize ulva polysaccharide, new ulva polysaccharide lyase is discovered, more ulva polysaccharide lyase genes are discovered, and the engineering expression of the ulva polysaccharide lyase genes is realized, so that the method has important research prospects and significance.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides an ulva polysaccharide lyase, and a coding gene and application thereof. The ulva polysaccharide lyase belongs to a polysaccharide lyase 25 family, the similarity of an enzyme protein sequence and an existing enzyme sequence is lower, the ulva polysaccharide lyase belongs to a novel ulva polysaccharide lyase, the activity of the enzyme is up to 230U/mL, and the ulva polysaccharide lyase has good temperature stability and pH stability and good research and application prospects.
The technical problem to be solved by the invention is to provide a novel ulva polysaccharide lyase and a gene thereof.
The technical problem to be solved by the invention is to provide a recombinant expression preparation method of the ulva polysaccharide lyase.
The technical problem to be finally solved by the invention is to provide the application of the ulva polysaccharide lyase.
In order to solve the technical problems, the invention adopts the following technical scheme:
an ulva polysaccharide lyase, wherein the amino acid sequence of the ulva polysaccharide lyase is shown in (i) or (ii):
(i) the amino acid sequence is shown as SEQ ID NO. 1;
(ii) the amino acid sequence in (i) is substituted, deleted or added with one or more amino acids and has ulva polysaccharide lyase activity.
Further, the shiver 33939: at least one of A at position 112H, V at position 141T, F at position 162H, Q at position 200Y, S at position 220C and C at position 232H.
The nucleotide sequence of the ulva polysaccharide lyase coding gene is shown as SEQ ID No.2, and the amino acid sequence of the ulva polysaccharide lyase coding gene is shown as SEQ ID No. 1.
A recombinant vector comprises the encoding gene of the ulva polysaccharide lyase. The recombinant vector plasmid is an escherichia coli plasmid or a bacillus subtilis plasmid, and is preferably an escherichia coli plasmid pProEX-HTa.
A cell transformed with a host cell comprising the recombinant vector, wherein the host cell is Escherichia coli or Bacillus subtilis, preferably Escherichia coli BL21(DE 3).
A method of preparing the ulva polysaccharide lyase, the preparation method comprising the steps of:
1) cloning and analysis of ulva polysaccharide lyase gene: extracting Alteromonas colwelliana genome with the preservation number of CCTCC M2012132, designing a primer according to genome sequence and functional gene analysis, and obtaining an ulva polysaccharide lyase gene by PCR (polymerase chain reaction) by taking the extracted genome DNA as a template;
2) constructing an ulva polysaccharide lyase recombinant vector: carrying out double-enzyme digestion on the nucleotide sequence of the obtained ulva polysaccharide lyase gene, and then connecting the obtained ulva polysaccharide lyase gene with an escherichia coli plasmid pProEX-HTa to obtain a recombinant vector;
3) constructing ulva polysaccharide lyase recombinant cells: converting the ulva polysaccharide lyase recombinant vector into escherichia coli BL21(DE3) to obtain escherichia coli ulva polysaccharide lyase recombinant cells;
4) expression and purification of ulva polysaccharide lyase: inoculating cells of the recombinant vector containing the ulva polysaccharide lyase gene into a bioreactor for culture, carrying out induced expression, collecting an expression product, and purifying by affinity chromatography to obtain the active protein of the hyaluronic acid lyase. The hyaluronic acid lyase can also be obtained by ion exchange and gel filtration purification.
A composition contains the ulva polysaccharide lyase. The composition further comprises an adjuvant or carrier acceptable in food or pharmaceutical products.
The ulva polysaccharide lyase gene or recombinant vector or recombinant cell is applied to preparation of ulva polysaccharide lyase.
The ulva polysaccharide lyase is applied to preparation of green alga oligosaccharides by catalytic degradation of green alga polysaccharides.
The composition is applied to preparing green alga oligosaccharides by catalyzing and degrading green alga polysaccharides.
The green algae polysaccharide comprises ulva polysaccharide, enteromorpha polysaccharide or monostroma nitidum polysaccharide.
Compared with the prior art, the ulva polysaccharide lyase and the gene thereof provided by the invention have the following beneficial effects:
the invention obtains the marine bacterium Alteromonas colwelliana A321 ulva polysaccharide lyase gene by designing a homologous primer, the coding region of the gene is 1314bp in length, and the ulva polysaccharide lyase of 437 amino acids is coded and belongs to a polysaccharide lyase 25 family, and the enzyme gene sequence is obviously different from the existing ulva polysaccharide lyase and belongs to a new ulva polysaccharide lyase.
The technical scheme of the invention can realize the construction of the new ulva polysaccharide lyase recombinant vector and the efficient expression of escherichia coli, realize the large-scale production of the ulva polysaccharide lyase, the enzyme activity of the ulva polysaccharide lyase is up to 230U/mL, is obviously improved compared with the enzyme activity (0.19U/mL) of a wild strain, is obviously higher than the enzyme activity of the public reported ulva polysaccharide lyase, has high purity and excellent physicochemical property, can efficiently degrade green alga polysaccharide to prepare green alga oligosaccharides, and can be widely applied to the fields of food, medicine, chemical industry, polysaccharide structure analysis and the like.
Preservation information: the bacterium Alteromonas colwelliana a321, which was deposited at the chinese type culture collection on 23/4/2012, addresses: the preservation number of Alteromonas colwelliana A321 in Wuhan, Wuhan university is: CCTCC NO. M2012132.
Drawings
Embodiments of the invention are described in further detail below with reference to the attached drawing figures, wherein:
FIG. 1: an electropherogram of the ulva polysaccharide lyase gene in 1% agarose gel. Left side M is marker and right side 1 is sample.
FIG. 2: an alignment chart of an ulva polysaccharide lyase amino acid sequence. Wherein:
ALT 3695: the ulva polysaccharide lyase has an amino acid sequence (SEQ. ID. NO. 1);
WP _ 052010178.1: ulvan lyase (Alteromonas sp.lor), family PL 25;
WP _ 033186995.1: ulvan lyase (Pseudoalteromonas sp.plsv), family PL 25;
AMA 19991: ulvan lyase (Alteromonas sp.lor), family PL 24;
WP _ 038530530.1: ulvan lyase (Marine flavobacterium), family PL 28.
FIG. 3: recombinant vector pProEX-HTa-ALT 3695.
FIG. 4: SDS-PAGE electrophoresis pattern of purified ulva polysaccharide lyase. Left side M is standard protein molecular weight, right side 1 is purified ulva polysaccharide lyase protein.
FIG. 5: influence of temperature on ulva polysaccharide lyase. The abscissa is different temperatures and the ordinate is relative enzyme activity.
FIG. 6: ulva polysaccharide lyase temperature stability. The abscissa is different time, and the ordinate is relative enzyme activity.
FIG. 7: effect of pH on ulva polysaccharide lyase. The abscissa is different pH values and the ordinate is relative enzyme activity.
FIG. 8: ulva polysaccharide lyase pH stability. The abscissa is different pH values and the ordinate is relative enzyme activity.
FIG. 9: mass spectrum of ulva oligosaccharide. The abscissa is m/z and the ordinate is ion current intensity.
FIG. 10: ultraviolet scanning atlas of ulva oligosaccharide. The abscissa is wavelength and the ordinate is absorbance.
Detailed Description
The invention provides a novel ulva polysaccharide lyase, which realizes the high-enzyme activity recombinant expression of the novel ulva polysaccharide lyase.
"Ulva lactucase lyase activity" as used herein is defined in units of enzyme activity. Measuring enzyme activity by using an ultraviolet method, taking 4mL of ulva polysaccharide with the mass volume fraction of 0.1% as a substrate (pH 8, 20mM Tris-HCl), adding 0.1mL of enzyme solution, preserving the temperature for 5min at 35 ℃, immediately boiling for 5min to terminate the reaction, taking the added inactivated enzyme solution as a blank control, and detecting an absorption value under 235nm by using an ultraviolet spectrophotometer. Under experimental conditions, the amount of enzyme required to degrade ulvan every 1min to produce 1. mu. mol of unsaturated double bonds was defined as 1 enzyme activity unit (U). The enzyme activity unit of the fermentation liquor is defined as: enzyme activity units (U/mL) per mL of fermentation broth.
The amino acids in the various amino acid sequences presented herein are identified by their well known three-letter or one-letter abbreviations, e.g., lysine, Lys, K. The nucleotides present in the various DNA fragments are indicated by standard one-letter designations conventionally used in the art.
The invention includes fragments of ulva polysaccharide lyase. As used herein refers to a protein or polypeptide that substantially retains the same biological function or activity of the ulvan lyase of the present invention. A protein or polypeptide fragment of the invention may be (i) a protein or polypeptide having one or more conserved or non-conserved amino acid residues (preferably conserved amino acid residues) substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a protein or polypeptide having a substituent group in one or more amino acid residues, or (iii) a protein or polypeptide having an additional amino acid sequence fused to the sequence of the protein or polypeptide (e.g., a leader or secretory sequence or a sequence used to purify the polypeptide or a pro-protein sequence, or a fusion protein). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the definitions herein.
For the purposes herein, amino acid substitutions may be made at any amino acid so long as the resulting protein exhibits ulvan lyase activity. Amino acid substitutions include conservative substitutions that do not eliminate enzymatic activity. Substitutions that alter the properties of the protein, such as binding sites or catalytic centers, are also contemplated as described herein, and such substitutions are generally non-conservative but would be readily accomplished by one of skill in the art.
Suitable amino acid conservative substitutions are known to those skilled in the art and can generally be made without altering the biological activity, e.g., enzymatic activity, of the resulting molecule. One skilled in the art will recognize that, in general, single amino acid substitutions in non-essential regions of a polypeptide will not substantially alter the biological activity, conservative amino acid substitutions may be made, and are readily accomplished by one skilled in the art and are within the scope of the present invention. Conservative amino acid substitutions that may be made are shown in table 1: Y35F: a substitution of the amino acid sequence Y (Tyr) at position 35 with F (Phe); D126E substitution of amino acid sequence 126 position D (Asp) with E (Glu); N150Q substitution of N (Asn) at amino acid sequence position 150 to E (Gln); V167L substitution of V (Val) at position 167 of the amino acid sequence with L (Leu); S198T substitution of amino acid sequence 198 position S (Ser) with T (Thr); K313R substitutions K (Lys) at amino acid position 313 to R (Arg), etc., other conservative amino acid substitutions are permissible and can be determined empirically or based on known conservative substitutions.
TABLE 1 conservative substitutions
Alternative locations and ways Amino acids before substitution Substituted amino acid Alternative locations and ways Amino acids before substitution Substituted amino acid
Y35F Tyr Phe D152E Asp Glu
D75E Asp Glu F156W Phe Trp
N76Q Asn Gln W166F Trp Phe
H77R His Arg V167L Val Leu
G78A Gly Ala Y168F Tyr Phe
K79H Lys His D197E Asp Glu
H91K His Lys S198T Ser Thr
D126E Asp Glu W199F Trp Phe
I127V Ile Val Y217F Tyr Phe
N150Q Asn Gln K313R Lys Arg
G151A Gly Ala
The substitution for changing the protein characteristics can change the biological activities of the enzyme protein, such as catalytic activity, stability and the like, is an important mode for substituting the enzyme protein, is easy to finish by the technical personnel in the field, and also belongs to the scope of the invention. Amino acid substitutions that may be made to alter the properties of the protein are shown below: H112A: substitution of amino acid sequence 112H (His) to A (Ala); T141V: substitution of the amino acid sequence T (Thr) at position 141 with V (Val); H162F: h (His) instead of F (Phe) at amino acid sequence position 162; Y200Q: a substitution of Y (Tyr) at amino acid sequence position 200 to Q (Gln); C220S: substitution of C (Cys) at amino acid sequence position 220 with S (Ser); H232C: substitution of amino acid sequence 232 position h (his) to c (cys); other substitutions are also permissible and can be determined empirically or based on known substitutions that alter the properties of the protein.
The technical scheme of the invention is further illustrated by combining specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002 or according to the manufacturer's recommendations.
Example 1 extraction of Alteromonas colwelliana A321 genome
A bacterial solution of Alteromonas colwelliana A321 (the preservation number of the strain is CCTCC NO. M2012132) cultured to the logarithmic growth phase is taken for DNA extraction according to the operation instruction of a TIAamp Bacteria DNA Kit (TIANGINBIOTECO TECH (BEIJING) CO., LTD Kit, and then the concentration and purity of the genomic DNA are determined in NanoDrop2000(Thermofisher Scientific CO., so) that the concentration of the extracted genomic DNA is 380ng/mL, and the ratio of OD260/OD280 is 1.82. And detecting DNA bands in 1% agarose gel electrophoresis under the following detection conditions: the sample loading amount is 5 mu L, the voltage is 120V, electrophoresis is carried out for 30min, and the strip is observed in a gel imaging system and has good strip uniformity. The extracted DNA sample was sequenced.
Example 2 cloning and analysis of Ulva lactuca Polysaccharase Gene
Taking Alteromonas colwelliana A321 total DNA as a template, and amplifying an ulva polysaccharide lyase gene (without a signal peptide) by using primers F and R containing restriction enzyme cutting sites according to a sequencing result and functional gene analysis:
Figure BDA0002082037090000071
Figure BDA0002082037090000072
wherein the content of the first and second substances,
Figure BDA0002082037090000073
is the restriction site of the restriction enzyme EcoRI,
Figure BDA0002082037090000074
is the restriction site of restriction enzyme Kpn I.
PCR was used for amplification, and the 50. mu.L reaction system was:
1 μ L of DNA template in 50 μ L of reaction system; f (10. mu.M), 1. mu.L; r (10. mu.M), 1. mu.L; dNTPs (2.5 mM each), 4. mu.L; taq (2U/. mu.L), 1. mu.L; 10 × Taq buffer, 5 μ L; ddH2O, to 50. mu.L.
The PCR amplification procedure was: pre-denaturation at 94 deg.C for 3min, denaturation at 94 deg.C for 30s, annealing at 60 deg.C for 30s, extension at 72 deg.C for 2min, cyclic amplification for 35 times, and final extension at 72 deg.C for 5 min.
The PCR product is detected to be a single specific band by 1 percent agarose electrophoresis and then sequenced (the electrophoresis pattern is shown in figure 1), the ulva polysaccharide lyase gene with the length of 1314bp is obtained by PCR amplification, the sequencing sequence is shown in a sequence table SEQ.ID.NO.2, and the gene sequence shown in the SEQ.ID.NO.2 is compared with the whole genome sequence and is consistent with the functional gene sequence in the whole genome. The gene codes a protein consisting of 437 amino acids, and the sequence is shown in a sequence table SEQ.ID.NO. 1. Blast sequence analysis in NCBI database shows that the protein belongs to polysaccharide lyase 25 family, the similarity of the amino acid sequence of the protein and other reported ulva polysaccharide lyase amino acid sequences is only 64.14% at most (ulva polysaccharide cleavage of pseudoalteromonas: WP-033186995.1), and the protein is a new protein and the gene is a new gene. The comparison result of the amino acid sequences of the ulva polysaccharide lyase and the reported ulva polysaccharide lyase is shown in the attached figure 2, the comparison result shows that the amino acid sequence of the ulva polysaccharide lyase gene is obviously different from the amino acid sequence of the reported ulva polysaccharide lyase, and further shows that the enzyme protein is a new enzyme protein.
Example 3 construction of Ulva lactuca polysaccharide lyase recombinant vector
The ulva polysaccharide degrading enzyme gene PCR product is purified according to the operation method required by a Cycle-Pure Kit (OMEGA Bio-Tek Co.) purification Kit.
Carrying out double enzyme digestion on the purified ulva polysaccharide lyase gene and a vector pProEX-HTa by using EcoR I and Kpn I, wherein the enzyme digestion conditions are as follows: 37 ℃ for 6 h. Carrying out agarose electrophoresis on the enzyme digestion product, wherein the electrophoresis conditions are as follows: 80V and 1 h. The Gel extraction kit (OMEGA Bio-Tek Co.) was used to recover the cut Gel according to the procedures required by the Gel extraction kit.
Connecting the enzyme-cut ulva polysaccharide lyase gene sequence fragment with a pProEX-HTa vector by using T4 ligase, wherein the connection conditions are as follows: 16 ℃ and 16 h. To obtain a recombinant vector pProEX-HTa-ALT3695 (shown in figure 3) containing ulva polysaccharide lyase gene.
Example 4 expression of recombinant Ulva lactuca polysaccharide lyase in E.coli
The recombinant vector was transformed into E.coli DH 5. alpha. competent cells by heat transformation (42 ℃ C., 60s), and cultured on LB solid plate containing 100. mu.g/mL ampicillin sodium at 37 ℃ for 12 hours, and the untransformed strain could not grow on the plate, and positive strain selection was performed by PCR. The PCR amplification procedure was: pre-denaturation at 94 deg.C for 3min, denaturation at 94 deg.C for 30s, annealing at 60 deg.C for 30s, extension at 72 deg.C for 2min, cyclic amplification for 35 times, and final extension at 72 deg.C for 5 min. The positive strain is inoculated in LB liquid culture medium, cultured for 12h at 37 ℃, and Plasmid extraction is carried out by using Plasmid Mini Kit (OMEGA Bio-Tek Co.) to obtain a recombinant vector pProEX-HTa-ALT 3695.
Escherichia coli expression strain BL21(DE3) was selected as a host cell, heat shock transformed (42 ℃, 60s), incubated (37 ℃, 45min), and finally cultured on LB solid plate containing 100. mu.g/mL ampicillin sodium at 37 ℃ for 12h, and the selected strain was screened for positive strains by PCR. The PCR amplification procedure was: pre-denaturation at 94 deg.C for 3min, denaturation at 94 deg.C for 30s, annealing at 60 deg.C for 30s, extension at 72 deg.C for 2min, cyclic amplification for 35 times, and final extension at 72 deg.C for 5 min. A positive clone was obtained, ALT3695-BL21(DE 3).
And (3) shaking flask fermentation: inoculating ALT3695-BL21(DE3) into LB liquid medium (100 mu g/mL ampicillin sodium), culturing at 37 ℃ until OD600 is 0.6-0.7, adding IPTG to the final concentration of 1mM, culturing at 28 ℃ and 180r/min for 24h, centrifuging the fermentation liquor at 4 ℃ and 8000r/min for 10min, discarding supernatant, re-suspending the bacteria with 20mM Tris-HCl with the same volume pH of 7.5, crushing cells under ice bath, centrifuging the crushed bacteria liquid at 4 ℃ and 8000r/min for 10min, and collecting supernatant. The enzyme activity is measured according to an enzyme activity measuring method, and the measured enzyme activity is 1.34U/mL.
Fermentation in a fermentation tank: ALT3695-BL21(DE3) was inoculated into LB liquid medium (100. mu.g/mL ampicillin sodium), cultured at 37 ℃ for 12 hours, then inoculated into a 5L fermentor (20g/L yeast extract powder, 5g/L tryptone, 5g/L glucose, 10g/L NaCl, 2g/L magnesium sulfate heptahydrate, 6g/L dipotassium hydrogen phosphate) containing 3L of medium in an inoculum size of 2%, cultured at 37 ℃, IPTG was added after the sugar in the initial medium had been consumed to a final concentration of 1mM, the temperature was adjusted to 28 ℃, the cell concentration did not increase after 24 hours of fermentation, and the fermentation was stopped. Centrifuging the fermentation liquor at 4 ℃ at 8000r/min for 10min, discarding the supernatant, resuspending the thallus with the same volume of Tris-HCl with pH 7.5 and 20mM, crushing the cells in ice bath, centrifuging the crushed bacterial liquid at 4 ℃ at 8000r/min for 10min, and collecting the supernatant. And (3) determining the enzyme activity according to an enzyme activity determination method, wherein the enzyme activity is 230U/mL.
Example 5 amino acid sequence mutations
According to analysis of conserved sites and spatial structures of ulva polysaccharide lyase amino acid sequences (without signal peptides), the mutation positions and modes of the gene are designed according to the amino acid sequence of the ulva polysaccharide lyase in SEQ ID NO.1 and the nucleotide sequence of the ulva polysaccharide lyase in SEQ ID NO. 2: H112A, T141V, H162F, Y200Q, C220S, H232C, N76Q and K313R, wherein the mutant primers are designed by using CE Design V1.04 according to the codon preference of strains shown in SEQ ID NO.5-SEQ ID NO. 20:
H112A-F：TAATACAGCGTATGGCCGCAATATTCATGCT (SEQ ID NO.5)
H112A-R：GGCCATACGCTGTATTACCTAAAGGGTTTTTGCCA (SEQ ID NO.6)
T141V-F：GGTGTGTATAACCAAGCTGTAAAAATGGATAACG (SEQ ID NO.7)
T141V-R:GCTTGGTTATACACACCAAATACCGATATATTATCTAATTCTTCC (SEQ ID NO.8)
H162F-F：ATGGCGCGTTTAGAAGCGATTGGGTTTATCAAAA (SEQ ID NO.9)
H162F-R：GCTTCTAAACGCGCCATGTCGGTAGAA (SEQ ID NO.10)
Y200Q-F：ATAGTTGGCAGGCCTGGGTAGGTAAAGGACAGG (SEQ ID NO.11)
Y200Q-R：CCAGGCCTGCCAACTATCCACGGCTTTAATATCA (SEQ ID NO.12)
C220S-F：CCATATTAGCTGGGATGGTGGTGCTGGTG (SEQ ID NO.13)
C220S-R：CATCCCAGCTAATATGGTAATCATAAGAAATAATGATATCG (SEQ ID NO.14)
H232C-F：GAGGCTGCACAACTGAACGCCATGATGCC (SEQ ID NO.15)
H232C-R：TTCAGTTGTGCAGCCTCGGCCATTAACACCA (SEQ ID NO.16)
N76Q-F：AATAGATCAGCACGGCAAACCTACCATGTTG (SEQ ID NO.17)
N76Q-R：TGCCGTGCTGATCTATTTTAGAGCGGGTAGGGTCT (SEQ ID NO.18)
K313R-F：TGGGCCACGTCAAACTAGTTATTTCCGTTGGAATGG (SEQ ID NO.19)
K313R-R：TAGTTTGACGTGGCCCACCTGTTTTTTGAC (SEQ ID NO.20)
the method is characterized in that a recombinant vector pProEX-HTa-ALT3695 containing an ulva polysaccharide lyase gene is used as a template, a primer of SEQ ID NO.5-SEQ ID NO.20 is used, a PCR amplification plasmid full-length method is adopted for mutation, and a 50-microliter reaction system is as follows:
plasmid template, 0.5 μ L; 2 × Phanta Max Buffer, 25 μ L; dNTP Mix (10mM each), 1. mu.L; f (10. mu.M), 2. mu.L; r (10. mu.M), 2. mu.L; phanta Max Super-Fidelity DNA Polymerase, 1. mu.L; ddH2O, to 50. mu.L.
The PCR amplification procedure was: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 15s, annealing at 61 ℃ for 15s, extension at 72 ℃ for 4min, cyclic amplification for 35 times, and final extension at 72 ℃ for 5 min.
The PCR reaction product was digested by 0.5. mu.L of Dpn I enzyme at 37 ℃ for 2 hours, and the PCR product was purified by the procedure required for the Cycle-Pure Kit (OMEGA Bio-Tek Co.) purification Kit.
For the above purified product
Figure BDA0002082037090000101
II One Step Cloning Kit (Novezam) for plasmid ligation, 20. mu.L system:
5 × CE II Buffer, 4 μ L; exnase II, 2. mu.L; purify product, 5 μ L; ddH2O, to 20. mu.L. Plasmid recombination conditions: 30min at 37 ℃.
The mutated recombinant plasmid was transformed into E.coli DH 5. alpha. competent cells by heat transformation (42 ℃ C., 60s), and cultured on LB solid plate containing 100. mu.g/mL ampicillin sodium at 37 ℃ for 12 hours, and the untransformed strain could not grow on the plate, and the mutant strain was selected by PCR. The PCR amplification procedure was: pre-denaturation at 94 deg.C for 3min, denaturation at 94 deg.C for 30s, annealing at 60 deg.C for 30s, extension at 72 deg.C for 2min, cyclic amplification for 35 times, and final extension at 72 deg.C for 5 min. And sequencing and identifying the mutant sequence, wherein the mutant nucleotide sequence is shown as SEQ ID NO.21-SEQ ID NO.28, and the corresponding mutant amino acid sequence is shown as SEQ ID NO.29-SEQ ID NO. 36. Then, the positive mutant strain is inoculated in an LB liquid culture medium, cultured for 12h at 37 ℃, and Plasmid extraction is carried out by using Plasmid MiniKit (OMEGA Bio-Tek Co.) to obtain mutant recombinant Plasmid.
Escherichia coli expression strain BL21(DE3) was selected as a host cell, heat shock transformed (42 ℃, 60s), incubated (37 ℃, 160rpm, 45min), and finally cultured on LB solid plate containing 100. mu.g/mL ampicillin sodium at 37 ℃ for 12h, and the selected strain was subjected to positive strain screening by PCR. The PCR amplification procedure was: pre-denaturation at 94 deg.C for 3min, denaturation at 94 deg.C for 30s, annealing at 60 deg.C for 30s, extension at 72 deg.C for 2min, cyclic amplification for 35 times, and final extension at 72 deg.C for 5 min. Obtaining positive clone bacterial strain.
Inoculating the positive clone strain into LB liquid culture medium (100 mug/mL ampicillin sodium), culturing at 37 ℃ until OD600 is 0.6-0.7, adding IPTG to the final concentration of 1mM, culturing at 28 ℃ and 180r/min for 24h, centrifuging the fermentation liquor at 4 ℃ and 8000r/min for 10min, discarding the supernatant, re-suspending the strain with the same volume of pH 7.5 and 20mM Tris-HCl, crushing the cells under ice bath, centrifuging the crushed bacteria liquid at 4 ℃ and 8000r/min for 10min, and collecting the supernatant. The enzyme activity is measured according to an enzyme activity measuring method, and the enzyme activity results are shown in a table 2:
TABLE 2 amino acid mutations and enzyme activities
Amino acid mutation position and mode Enzyme activity (U/mL)
ALT3695 1.34
H112A 0.22
T141V 0.15
H162F 0.43
Y200Q 12.5
C220S 0.78
H232C 13.1
N76Q 1.38
K313R 1.31
The result of mutation for changing protein characteristics shows that the enzyme activities of the mutants Y200Q and H232C are obviously improved compared with the shake-flask fermentation enzyme activity of the strain before mutation, the enzyme activities of the mutants H162F and C220S are reduced to a certain extent compared with the shake-flask fermentation enzyme activity of the strain before mutation, and the enzyme activities of the mutants H112A and T141V are obviously reduced compared with the shake-flask fermentation enzyme activity of the strain before mutation, which indicates that the amino acid sites are important amino acid sites in enzymatic reaction and have great influence on the enzyme activity.
The amino acid conservative substitution result shows that the enzyme activity of the mutants N76Q and K313R is basically unchanged compared with that of the strain before mutation. These amino acids are essential for maintaining the spatial structure of the enzyme, but have substantially no effect on the enzyme activity.
Example 6 recombinase purification
The supernatant from the shake flask fermentation of example 4 was subjected to affinity chromatography (GE) using a nickel column, and subjected to preliminary separation and purification according to the instructions for nickel column purification, and the separated and purified product was collected. Carrying out SDS-PAGE electrophoresis on the purified ulva polysaccharide lyase to obtain a single protein band (the electrophoresis pattern is shown in figure 4), wherein the position of the single protein band is identical with the predicted molecular weight, and the molecular weight is about 53 kDa. The recovery rate of enzyme activity is 43 percent, the specific activity is 2053U/mg, and the purification multiple is 6.7 times.
Example 7 Ulva polysaccharide lyase enzymatic Properties
1. Effect of temperature on Ulva polysaccharide lyase
The enzyme activities of the samples prepared in example 5 were measured at 30, 35, 40, 45, 50, 55 and 60 ℃ respectively according to the enzyme activity measurement method, and the relative enzyme activities were compared with each other (the highest enzyme activity was 100%). The experimental result is shown in figure 5, and shows that the sample has good enzyme activity within the temperature range of 30-55 ℃, and the optimal reaction temperature is 50 ℃.
The samples prepared in example 5 were incubated at 25 ℃, 37 ℃, 40 ℃, 45 ℃, 50 ℃ and 55 ℃ for 2min, 5min, 10min, 30min, 60min and 120min, respectively, the enzyme activity was measured according to the enzyme activity measurement method to examine the temperature stability of the enzyme, the enzyme activity of the enzyme solution without temperature treatment (0min) was defined as 100%, and the relative enzyme activities were compared. The experimental result is shown in figure 6, and the experimental result shows that the enzyme has good stability at the temperature lower than 40 ℃, the enzyme activity can be kept above 90% within 2h, but the enzyme activity is not easy to be activated at the temperature higher than 45 ℃, and the enzyme activity is avoided as much as possible.
2. Effect of pH on Ulva polysaccharide lyase
Ulva polysaccharide substrates are prepared by using 50mM phosphate buffer solutions with pH values of 4, 5, 6, 7, 7.5, 8, 8.5, 9 and 10 respectively, enzyme activities of the samples prepared in example 5 at different pH values are determined according to an enzyme activity determination method, and the enzyme activities are compared by using a relative enzyme activity graph (the highest enzyme activity is 100%). The experimental result is shown in figure 7, and the experimental result shows that the sample has the optimum pH value of 8.0 and has good enzyme activity (the relative enzyme activity is more than or equal to 80%) within the range of pH 7-9.0.
The sample prepared in example 5 was incubated at pH 4-10 for 3 hours at 4 ℃ to determine the enzyme activity according to the enzyme activity determination method to examine the pH stability of the enzyme, and the enzyme activity of the enzyme solution without pH incubation treatment was defined as 100%, and the relative enzyme activities were compared as a graph. The experimental result is shown in figure 8, and the experimental result shows that the enzyme can keep more than 90% of enzyme activity after being incubated for 3 hours under different pH values, has good pH stability, and is suitable for industrial application.
Example 8 application of Ulva polysaccharide lyase in preparation of Ulva oligosaccharides
Taking 10mL of 1% ulva polysaccharide water solution, adding 1.5 × 103Carrying out enzymolysis on the purified ulva polysaccharide lyase enzyme solution for 8h in a water bath at 35 ℃ at 100rpm, inactivating the enzyme in a boiling water bath for 10min, centrifuging for 10min at 10000rpm, and carrying out freeze drying to obtain ulva oligosaccharide. Mass spectrometry (ESI-MS) was performed on the prepared ulva oligosaccharide sample. The mass spectrogram is shown in figure 9, and the peak m/z:401.1 represents ulva disaccharide (composed of one molecule of rhamnose sulfate and one molecule of unsaturated glucuronic acid) with a charge; 577.1 is ulvan trisaccharide with single charge (composed of one molecule of rhamnose sulfate, one molecule of unsaturated glucuronic acid and one molecule of glucuronic acid); m/z: the 379 peak represents that ulva tetrasaccharide (consisting of two molecules of rhamnose sulfate, one molecule of unsaturated glucuronic acid and one molecule of xylose) has two charges; m/z: 781.1 Peak represents ulva tetrasaccharide (consisting of two molecules of rhamnose sulfate, one molecule of unsaturated glucuronic acid, and one molecule of xylose) with a charge; mass spectrum results show that main products of ulva polysaccharide degraded by ulva polysaccharide lyase are unsaturated ulva disaccharide, trisaccharide and tetrasaccharide. The ultraviolet scanning spectrum is shown in figure 10, and the result shows that the prepared ulva oligosaccharide has characteristic absorption at 235nm, which indicates that double bonds are generated; mass spectrum and ultraviolet scanning results show that the enzyme is lyase and is a main product for degrading ulva polysaccharideUnsaturated ulva disaccharide, trisaccharide and tetrasaccharide.
Example 9 application of Ulva lactuca polysaccharide lyase in preparation of Enteromorpha oligosaccharides
Taking 100mL of 1% Enteromorpha prolifera polysaccharide aqueous solution, adding 3 × 103Carrying out enzymolysis on the purified ulva polysaccharide lyase enzyme liquid in water bath at 100rpm and 35 ℃. Sampling at 0min, 10min, 20min, 30min and 60min respectively, inactivating enzyme in boiling water bath for 10min, centrifuging at 10000r/min for 10min, measuring molecular weight by HPLC and recording. The results are shown in table 3, which shows that the enzyme can be used for preparing enteromorpha oligosaccharides with different molecular weights.
TABLE 3 Enteromorpha oligosaccharide molecular weights
Time (min) Molecular weight (kDa)
0 2700
10 620
20 50
30 3.6
60 1.3
The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.
Sequence listing
<110> China oceanic university
Ulva lactuca polysaccharide lyase as well as coding gene and application thereof
<130> 2019
<160> 36
<170> SIPOSequenceListing 1.0
<210> 1
<211> 437
<212> PRT
<213> Alteromonas colwelliana
<400> 1
Pro Asn Asn Thr Val Asp Phe Ala Asn Asn Ala Leu Gly Asn Pro Leu
1 5 10 15
Ala Val Val Gln His Pro Ala Gly Ile Tyr His Asn Gly Ile Thr Tyr
20 25 30
Val Thr Tyr Gln Gly Pro Leu Glu Asp Pro Tyr Ile Ala Ala Tyr Asn
35 40 45
His Lys Thr Asp Thr Trp Gln Gly Pro Phe Lys Ala Gly Val Ser Asp
50 55 60
Met Gly Lys Asp Pro Thr Arg Ser Lys Ile Asp Asn His Gly Lys Pro
65 70 75 80
Thr Met Leu Ile Asp Asp Leu Gly Tyr Ile His Ile Phe Phe Gly Gly
85 90 95
His Gly Gly Met Pro Lys His Gly Lys Asn Pro Leu Gly Asn Thr His
100 105 110
Tyr Gly Arg Asn Ile His Ala Val Ser Lys Asn Pro Gly Asp Ile Thr
115 120 125
Ser Trp Glu Glu Leu Asp Asn Ile Ser Val Phe Gly Thr Tyr Asn Gln
130 135 140
Ala Val Lys Met Asp Asn Gly Asp Ile Tyr Leu Phe Tyr Arg His Gly
145 150 155 160
Ala His Arg Ser Asp Trp Val Tyr Gln Lys Ser Thr Asp His Gly Arg
165 170 175
Thr Phe Ala Glu Pro Val Ser Phe Leu Lys His Lys Arg Arg Ser Asp
180 185 190
Ile Lys Ala Val Asp Ser Trp Tyr Ala Trp Val Gly Lys Gly Gln Gly
195 200 205
Asp Asp Ile Ile Ile Ser Tyr Asp Tyr His Ile Cys Trp Asp Gly Gly
210 215 220
Ala Gly Val Asn Gly Arg Gly His Thr Thr Glu Arg His Asp Ala Tyr
225 230 235 240
Tyr Met Val Phe Asn Thr Lys Asp Asp Thr Trp Arg Asn Val Gln Gly
245 250 255
Asp Asn Leu Asn Leu Pro Ile Thr Arg Glu Thr Ala Asp Glu Lys Thr
260 265 270
Leu Val Ala Arg Thr Gly Lys Asn Trp Thr Phe Asn Gly Ser Ala His
275 280 285
Leu Asp Glu His Gly Tyr Pro His Ile Ala Thr Asn Ile Gly Lys Asp
290 295 300
Leu Gly Gln Lys Thr Gly Gly Pro Lys Gln Thr Ser Tyr Phe Arg Trp
305 310 315 320
Asn Gly Ser Glu Trp Leu Gly Gly Gln Pro Val Asn Pro Gln Val Arg
325 330 335
Ser Leu Asn Ile Asp Ser Arg Gly Asp Phe Phe Val Asn Thr Pro Thr
340 345 350
Asp Val Thr Phe Thr Leu Gly Tyr Lys Glu Lys Asp Asp Gly Val Ile
355 360 365
Ala Tyr Trp Asn Thr Gln Asp Gly Gly Lys Ser Phe Thr Lys Gly Lys
370 375 380
Glu Leu Leu Arg Arg Gln Gly Ala Gly Trp Ala Leu Thr Ser Ile Ile
385 390 395 400
Glu Asn Ala His Pro Asp Ala Arg Val Ile Val Ala Glu Lys Gln Lys
405 410 415
Gly Thr Asn Trp Ser Lys Val Tyr Leu Leu Gly Asp Lys Gly Pro Ile
420 425 430
Arg Ser Glu Asn Lys
435
<210> 2
<211> 1314
<212> DNA
<213> Alteromonas colwelliana
<400> 2
cccaataata ctgtcgactt cgctaacaat gcattgggta acccacttgc ggttgtccag 60
catccagcgg gtatctacca taatggcatt acgtatgtaa cctatcaagg gccgttagaa 120
gatccttaca ttgcagcgta taatcataaa acagatactt ggcaaggtcc gtttaaggca 180
ggtgtaagtg atatgggtaa agaccctacc cgctctaaaa tagataatca cggcaaacct 240
accatgttga ttgatgattt aggctatatt catatctttt ttggtggtca tggtggcatg 300
cctaaacatg gcaaaaaccc tttaggtaat acacattatg gccgcaatat tcatgctgtt 360
tctaaaaacc cgggtgatat taccagttgg gaagaattag ataatatatc ggtatttggt 420
acttataacc aagctgtaaa aatggataac ggtgatattt atttattcta ccgacatggc 480
gcgcacagaa gcgattgggt ttatcaaaaa tcgacagacc atggtcgtac ttttgctgag 540
cctgtgtcgt ttttaaaaca taaacgacgt agtgatatta aagccgtgga tagttggtat 600
gcctgggtag gtaaaggaca gggtgacgat atcattattt cttatgatta ccatatttgt 660
tgggatggtg gtgctggtgt taatggccga ggccatacaa ctgaacgcca tgatgcctat 720
tatatggtat ttaatacgaa ggatgatact tggcgcaatg ttcaaggtga taatctaaac 780
ttgccaataa cccgtgaaac agcagatgaa aaaacactcg tagccagaac aggtaaaaat 840
tggaccttta acggttcagc ccatttagat gagcatggtt acccgcatat tgcaaccaac 900
ataggtaaag atttgggtca aaaaacaggt gggccaaaac aaactagtta tttccgttgg 960
aatggcagtg agtggcttgg tggtcaacct gttaaccctc aggtacgcag cttaaacata 1020
gattcacgtg gtgatttttt tgtgaatacc ccaacagatg tgacttttac gctgggttat 1080
aaagaaaaag atgatggcgt aattgcttat tggaatacgc aagatggcgg caaaagcttt 1140
actaaaggta aagaattgct tcgtcgccaa ggtgcaggtt gggcgttaac atctatcatt 1200
gaaaatgccc acccagatgc tcgagtaatt gttgctgaaa aacaaaaagg tacaaactgg 1260
agtaaagttt atctcttagg ggataaggga ccaatacgaa gcgagaataa gtaa 1314
<210> 3
<211> 40
<212> DNA
<213> Artificial sequence ()
<400> 3
ccggaattcc ggcccaataa tactgtcgac ttcgctaaca 40
<210> 4
<211> 37
<212> DNA
<213> Artificial sequence ()
<400> 4
ggggtacccc ttacttattc tcgcttcgta ttggtcc 37
<210> 5
<211> 31
<212> DNA
<213> Artificial sequence ()
<400> 5
taatacagcg tatggccgca atattcatgc t 31
<210> 6
<211> 35
<212> DNA
<213> Artificial sequence ()
<400> 6
ggccatacgc tgtattacct aaagggtttt tgcca 35
<210> 7
<211> 34
<212> DNA
<213> Artificial sequence ()
<400> 7
ggtgtgtata accaagctgt aaaaatggat aacg 34
<210> 8
<211> 45
<212> DNA
<213> Artificial sequence ()
<400> 8
gcttggttat acacaccaaa taccgatata ttatctaatt cttcc 45
<210> 9
<211> 34
<212> DNA
<213> Artificial sequence ()
<400> 9
atggcgcgtt tagaagcgat tgggtttatc aaaa 34
<210> 10
<211> 27
<212> DNA
<213> Artificial sequence ()
<400> 10
gcttctaaac gcgccatgtc ggtagaa 27
<210> 11
<211> 33
<212> DNA
<213> Artificial sequence ()
<400> 11
atagttggca ggcctgggta ggtaaaggac agg 33
<210> 12
<211> 34
<212> DNA
<213> Artificial sequence ()
<400> 12
ccaggcctgc caactatcca cggctttaat atca 34
<210> 13
<211> 29
<212> DNA
<213> Artificial sequence ()
<400> 13
ccatattagc tgggatggtg gtgctggtg 29
<210> 14
<211> 41
<212> DNA
<213> Artificial sequence ()
<400> 14
catcccagct aatatggtaa tcataagaaa taatgatatc g 41
<210> 15
<211> 29
<212> DNA
<213> Artificial sequence ()
<400> 15
gaggctgcac aactgaacgc catgatgcc 29
<210> 16
<211> 31
<212> DNA
<213> Artificial sequence ()
<400> 16
ttcagttgtg cagcctcggc cattaacacc a 31
<210> 17
<211> 31
<212> DNA
<213> Artificial sequence ()
<400> 17
aatagatcag cacggcaaac ctaccatgtt g 31
<210> 18
<211> 35
<212> DNA
<213> Artificial sequence ()
<400> 18
tgccgtgctg atctatttta gagcgggtag ggtct 35
<210> 19
<211> 36
<212> DNA
<213> Artificial sequence ()
<400> 19
tgggccacgt caaactagtt atttccgttg gaatgg 36
<210> 20
<211> 30
<212> DNA
<213> Artificial sequence ()
<400> 20
tagtttgacg tggcccacct gttttttgac 30
<210> 21
<211> 1314
<212> DNA
<213> Artificial sequence ()
<400> 21
cccaataata ctgtcgactt cgctaacaat gcattgggta acccacttgc ggttgtccag 60
catccagcgg gtatctacca taatggcatt acgtatgtaa cctatcaagg gccgttagaa 120
gatccttaca ttgcagcgta taatcataaa acagatactt ggcaaggtcc gtttaaggca 180
ggtgtaagtg atatgggtaa agaccctacc cgctctaaaa tagataatca cggcaaacct 240
accatgttga ttgatgattt aggctatatt catatctttt ttggtggtca tggtggcatg 300
cctaaacatg gcaaaaaccc tttaggtaat acagcgtatg gccgcaatat tcatgctgtt 360
tctaaaaacc cgggtgatat taccagttgg gaagaattag ataatatatc ggtatttggt 420
acttataacc aagctgtaaa aatggataac ggtgatattt atttattcta ccgacatggc 480
gcgcacagaa gcgattgggt ttatcaaaaa tcgacagacc atggtcgtac ttttgctgag 540
cctgtgtcgt ttttaaaaca taaacgacgt agtgatatta aagccgtgga tagttggtat 600
gcctgggtag gtaaaggaca gggtgacgat atcattattt cttatgatta ccatatttgt 660
tgggatggtg gtgctggtgt taatggccga ggccatacaa ctgaacgcca tgatgcctat 720
tatatggtat ttaatacgaa ggatgatact tggcgcaatg ttcaaggtga taatctaaac 780
ttgccaataa cccgtgaaac agcagatgaa aaaacactcg tagccagaac aggtaaaaat 840
tggaccttta acggttcagc ccatttagat gagcatggtt acccgcatat tgcaaccaac 900
ataggtaaag atttgggtca aaaaacaggt gggccaaaac aaactagtta tttccgttgg 960
aatggcagtg agtggcttgg tggtcaacct gttaaccctc aggtacgcag cttaaacata 1020
gattcacgtg gtgatttttt tgtgaatacc ccaacagatg tgacttttac gctgggttat 1080
aaagaaaaag atgatggcgt aattgcttat tggaatacgc aagatggcgg caaaagcttt 1140
actaaaggta aagaattgct tcgtcgccaa ggtgcaggtt gggcgttaac atctatcatt 1200
gaaaatgccc acccagatgc tcgagtaatt gttgctgaaa aacaaaaagg tacaaactgg 1260
agtaaagttt atctcttagg ggataaggga ccaatacgaa gcgagaataa gtaa 1314
<210> 22
<211> 1314
<212> DNA
<213> Artificial sequence ()
<400> 22
cccaataata ctgtcgactt cgctaacaat gcattgggta acccacttgc ggttgtccag 60
catccagcgg gtatctacca taatggcatt acgtatgtaa cctatcaagg gccgttagaa 120
gatccttaca ttgcagcgta taatcataaa acagatactt ggcaaggtcc gtttaaggca 180
ggtgtaagtg atatgggtaa agaccctacc cgctctaaaa tagataatca cggcaaacct 240
accatgttga ttgatgattt aggctatatt catatctttt ttggtggtca tggtggcatg 300
cctaaacatg gcaaaaaccc tttaggtaat acacattatg gccgcaatat tcatgctgtt 360
tctaaaaacc cgggtgatat taccagttgg gaagaattag ataatatatc ggtatttggt 420
gtgtataacc aagctgtaaa aatggataac ggtgatattt atttattcta ccgacatggc 480
gcgcacagaa gcgattgggt ttatcaaaaa tcgacagacc atggtcgtac ttttgctgag 540
cctgtgtcgt ttttaaaaca taaacgacgt agtgatatta aagccgtgga tagttggtat 600
gcctgggtag gtaaaggaca gggtgacgat atcattattt cttatgatta ccatatttgt 660
tgggatggtg gtgctggtgt taatggccga ggccatacaa ctgaacgcca tgatgcctat 720
tatatggtat ttaatacgaa ggatgatact tggcgcaatg ttcaaggtga taatctaaac 780
ttgccaataa cccgtgaaac agcagatgaa aaaacactcg tagccagaac aggtaaaaat 840
tggaccttta acggttcagc ccatttagat gagcatggtt acccgcatat tgcaaccaac 900
ataggtaaag atttgggtca aaaaacaggt gggccaaaac aaactagtta tttccgttgg 960
aatggcagtg agtggcttgg tggtcaacct gttaaccctc aggtacgcag cttaaacata 1020
gattcacgtg gtgatttttt tgtgaatacc ccaacagatg tgacttttac gctgggttat 1080
aaagaaaaag atgatggcgt aattgcttat tggaatacgc aagatggcgg caaaagcttt 1140
actaaaggta aagaattgct tcgtcgccaa ggtgcaggtt gggcgttaac atctatcatt 1200
gaaaatgccc acccagatgc tcgagtaatt gttgctgaaa aacaaaaagg tacaaactgg 1260
agtaaagttt atctcttagg ggataaggga ccaatacgaa gcgagaataa gtaa 1314
<210> 23
<211> 1314
<212> DNA
<213> Artificial sequence ()
<400> 23
cccaataata ctgtcgactt cgctaacaat gcattgggta acccacttgc ggttgtccag 60
catccagcgg gtatctacca taatggcatt acgtatgtaa cctatcaagg gccgttagaa 120
gatccttaca ttgcagcgta taatcataaa acagatactt ggcaaggtcc gtttaaggca 180
ggtgtaagtg atatgggtaa agaccctacc cgctctaaaa tagataatca cggcaaacct 240
accatgttga ttgatgattt aggctatatt catatctttt ttggtggtca tggtggcatg 300
cctaaacatg gcaaaaaccc tttaggtaat acacattatg gccgcaatat tcatgctgtt 360
tctaaaaacc cgggtgatat taccagttgg gaagaattag ataatatatc ggtatttggt 420
acttataacc aagctgtaaa aatggataac ggtgatattt atttattcta ccgacatggc 480
gcgtttagaa gcgattgggt ttatcaaaaa tcgacagacc atggtcgtac ttttgctgag 540
cctgtgtcgt ttttaaaaca taaacgacgt agtgatatta aagccgtgga tagttggtat 600
gcctgggtag gtaaaggaca gggtgacgat atcattattt cttatgatta ccatatttgt 660
tgggatggtg gtgctggtgt taatggccga ggccatacaa ctgaacgcca tgatgcctat 720
tatatggtat ttaatacgaa ggatgatact tggcgcaatg ttcaaggtga taatctaaac 780
ttgccaataa cccgtgaaac agcagatgaa aaaacactcg tagccagaac aggtaaaaat 840
tggaccttta acggttcagc ccatttagat gagcatggtt acccgcatat tgcaaccaac 900
ataggtaaag atttgggtca aaaaacaggt gggccaaaac aaactagtta tttccgttgg 960
aatggcagtg agtggcttgg tggtcaacct gttaaccctc aggtacgcag cttaaacata 1020
gattcacgtg gtgatttttt tgtgaatacc ccaacagatg tgacttttac gctgggttat 1080
aaagaaaaag atgatggcgt aattgcttat tggaatacgc aagatggcgg caaaagcttt 1140
actaaaggta aagaattgct tcgtcgccaa ggtgcaggtt gggcgttaac atctatcatt 1200
gaaaatgccc acccagatgc tcgagtaatt gttgctgaaa aacaaaaagg tacaaactgg 1260
agtaaagttt atctcttagg ggataaggga ccaatacgaa gcgagaataa gtaa 1314
<210> 24
<211> 1314
<212> DNA
<213> Artificial sequence ()
<400> 24
cccaataata ctgtcgactt cgctaacaat gcattgggta acccacttgc ggttgtccag 60
catccagcgg gtatctacca taatggcatt acgtatgtaa cctatcaagg gccgttagaa 120
gatccttaca ttgcagcgta taatcataaa acagatactt ggcaaggtcc gtttaaggca 180
ggtgtaagtg atatgggtaa agaccctacc cgctctaaaa tagataatca cggcaaacct 240
accatgttga ttgatgattt aggctatatt catatctttt ttggtggtca tggtggcatg 300
cctaaacatg gcaaaaaccc tttaggtaat acacattatg gccgcaatat tcatgctgtt 360
tctaaaaacc cgggtgatat taccagttgg gaagaattag ataatatatc ggtatttggt 420
acttataacc aagctgtaaa aatggataac ggtgatattt atttattcta ccgacatggc 480
gcgcacagaa gcgattgggt ttatcaaaaa tcgacagacc atggtcgtac ttttgctgag 540
cctgtgtcgt ttttaaaaca taaacgacgt agtgatatta aagccgtgga tagttggcag 600
gcctgggtag gtaaaggaca gggtgacgat atcattattt cttatgatta ccatatttgt 660
tgggatggtg gtgctggtgt taatggccga ggccatacaa ctgaacgcca tgatgcctat 720
tatatggtat ttaatacgaa ggatgatact tggcgcaatg ttcaaggtga taatctaaac 780
ttgccaataa cccgtgaaac agcagatgaa aaaacactcg tagccagaac aggtaaaaat 840
tggaccttta acggttcagc ccatttagat gagcatggtt acccgcatat tgcaaccaac 900
ataggtaaag atttgggtca aaaaacaggt gggccaaaac aaactagtta tttccgttgg 960
aatggcagtg agtggcttgg tggtcaacct gttaaccctc aggtacgcag cttaaacata 1020
gattcacgtg gtgatttttt tgtgaatacc ccaacagatg tgacttttac gctgggttat 1080
aaagaaaaag atgatggcgt aattgcttat tggaatacgc aagatggcgg caaaagcttt 1140
actaaaggta aagaattgct tcgtcgccaa ggtgcaggtt gggcgttaac atctatcatt 1200
gaaaatgccc acccagatgc tcgagtaatt gttgctgaaa aacaaaaagg tacaaactgg 1260
agtaaagttt atctcttagg ggataaggga ccaatacgaa gcgagaataa gtaa 1314
<210> 25
<211> 1314
<212> DNA
<213> Artificial sequence ()
<400> 25
cccaataata ctgtcgactt cgctaacaat gcattgggta acccacttgc ggttgtccag 60
catccagcgg gtatctacca taatggcatt acgtatgtaa cctatcaagg gccgttagaa 120
gatccttaca ttgcagcgta taatcataaa acagatactt ggcaaggtcc gtttaaggca 180
ggtgtaagtg atatgggtaa agaccctacc cgctctaaaa tagataatca cggcaaacct 240
accatgttga ttgatgattt aggctatatt catatctttt ttggtggtca tggtggcatg 300
cctaaacatg gcaaaaaccc tttaggtaat acacattatg gccgcaatat tcatgctgtt 360
tctaaaaacc cgggtgatat taccagttgg gaagaattag ataatatatc ggtatttggt 420
acttataacc aagctgtaaa aatggataac ggtgatattt atttattcta ccgacatggc 480
gcgcacagaa gcgattgggt ttatcaaaaa tcgacagacc atggtcgtac ttttgctgag 540
cctgtgtcgt ttttaaaaca taaacgacgt agtgatatta aagccgtgga tagttggtat 600
gcctgggtag gtaaaggaca gggtgacgat atcattattt cttatgatta ccatattagc 660
tgggatggtg gtgctggtgt taatggccga ggccatacaa ctgaacgcca tgatgcctat 720
tatatggtat ttaatacgaa ggatgatact tggcgcaatg ttcaaggtga taatctaaac 780
ttgccaataa cccgtgaaac agcagatgaa aaaacactcg tagccagaac aggtaaaaat 840
tggaccttta acggttcagc ccatttagat gagcatggtt acccgcatat tgcaaccaac 900
ataggtaaag atttgggtca aaaaacaggt gggccaaaac aaactagtta tttccgttgg 960
aatggcagtg agtggcttgg tggtcaacct gttaaccctc aggtacgcag cttaaacata 1020
gattcacgtg gtgatttttt tgtgaatacc ccaacagatg tgacttttac gctgggttat 1080
aaagaaaaag atgatggcgt aattgcttat tggaatacgc aagatggcgg caaaagcttt 1140
actaaaggta aagaattgct tcgtcgccaa ggtgcaggtt gggcgttaac atctatcatt 1200
gaaaatgccc acccagatgc tcgagtaatt gttgctgaaa aacaaaaagg tacaaactgg 1260
agtaaagttt atctcttagg ggataaggga ccaatacgaa gcgagaataa gtaa 1314
<210> 26
<211> 1314
<212> DNA
<213> Artificial sequence ()
<400> 26
cccaataata ctgtcgactt cgctaacaat gcattgggta acccacttgc ggttgtccag 60
catccagcgg gtatctacca taatggcatt acgtatgtaa cctatcaagg gccgttagaa 120
gatccttaca ttgcagcgta taatcataaa acagatactt ggcaaggtcc gtttaaggca 180
ggtgtaagtg atatgggtaa agaccctacc cgctctaaaa tagataatca cggcaaacct 240
accatgttga ttgatgattt aggctatatt catatctttt ttggtggtca tggtggcatg 300
cctaaacatg gcaaaaaccc tttaggtaat acacattatg gccgcaatat tcatgctgtt 360
tctaaaaacc cgggtgatat taccagttgg gaagaattag ataatatatc ggtatttggt 420
acttataacc aagctgtaaa aatggataac ggtgatattt atttattcta ccgacatggc 480
gcgcacagaa gcgattgggt ttatcaaaaa tcgacagacc atggtcgtac ttttgctgag 540
cctgtgtcgt ttttaaaaca taaacgacgt agtgatatta aagccgtgga tagttggtat 600
gcctgggtag gtaaaggaca gggtgacgat atcattattt cttatgatta ccatatttgt 660
tgggatggtg gtgctggtgt taatggccga ggctgcacaa ctgaacgcca tgatgcctat 720
tatatggtat ttaatacgaa ggatgatact tggcgcaatg ttcaaggtga taatctaaac 780
ttgccaataa cccgtgaaac agcagatgaa aaaacactcg tagccagaac aggtaaaaat 840
tggaccttta acggttcagc ccatttagat gagcatggtt acccgcatat tgcaaccaac 900
ataggtaaag atttgggtca aaaaacaggt gggccaaaac aaactagtta tttccgttgg 960
aatggcagtg agtggcttgg tggtcaacct gttaaccctc aggtacgcag cttaaacata 1020
gattcacgtg gtgatttttt tgtgaatacc ccaacagatg tgacttttac gctgggttat 1080
aaagaaaaag atgatggcgt aattgcttat tggaatacgc aagatggcgg caaaagcttt 1140
actaaaggta aagaattgct tcgtcgccaa ggtgcaggtt gggcgttaac atctatcatt 1200
gaaaatgccc acccagatgc tcgagtaatt gttgctgaaa aacaaaaagg tacaaactgg 1260
agtaaagttt atctcttagg ggataaggga ccaatacgaa gcgagaataa gtaa 1314
<210> 27
<211> 1314
<212> DNA
<213> Artificial sequence ()
<400> 27
cccaataata ctgtcgactt cgctaacaat gcattgggta acccacttgc ggttgtccag 60
catccagcgg gtatctacca taatggcatt acgtatgtaa cctatcaagg gccgttagaa 120
gatccttaca ttgcagcgta taatcataaa acagatactt ggcaaggtcc gtttaaggca 180
ggtgtaagtg atatgggtaa agaccctacc cgctctaaaa tagatcagca cggcaaacct 240
accatgttga ttgatgattt aggctatatt catatctttt ttggtggtca tggtggcatg 300
cctaaacatg gcaaaaaccc tttaggtaat acacattatg gccgcaatat tcatgctgtt 360
tctaaaaacc cgggtgatat taccagttgg gaagaattag ataatatatc ggtatttggt 420
acttataacc aagctgtaaa aatggataac ggtgatattt atttattcta ccgacatggc 480
gcgcacagaa gcgattgggt ttatcaaaaa tcgacagacc atggtcgtac ttttgctgag 540
cctgtgtcgt ttttaaaaca taaacgacgt agtgatatta aagccgtgga tagttggtat 600
gcctgggtag gtaaaggaca gggtgacgat atcattattt cttatgatta ccatatttgt 660
tgggatggtg gtgctggtgt taatggccga ggccatacaa ctgaacgcca tgatgcctat 720
tatatggtat ttaatacgaa ggatgatact tggcgcaatg ttcaaggtga taatctaaac 780
ttgccaataa cccgtgaaac agcagatgaa aaaacactcg tagccagaac aggtaaaaat 840
tggaccttta acggttcagc ccatttagat gagcatggtt acccgcatat tgcaaccaac 900
ataggtaaag atttgggtca aaaaacaggt gggccaaaac aaactagtta tttccgttgg 960
aatggcagtg agtggcttgg tggtcaacct gttaaccctc aggtacgcag cttaaacata 1020
gattcacgtg gtgatttttt tgtgaatacc ccaacagatg tgacttttac gctgggttat 1080
aaagaaaaag atgatggcgt aattgcttat tggaatacgc aagatggcgg caaaagcttt 1140
actaaaggta aagaattgct tcgtcgccaa ggtgcaggtt gggcgttaac atctatcatt 1200
gaaaatgccc acccagatgc tcgagtaatt gttgctgaaa aacaaaaagg tacaaactgg 1260
agtaaagttt atctcttagg ggataaggga ccaatacgaa gcgagaataa gtaa 1314
<210> 28
<211> 1314
<212> DNA
<213> Artificial sequence ()
<400> 28
cccaataata ctgtcgactt cgctaacaat gcattgggta acccacttgc ggttgtccag 60
catccagcgg gtatctacca taatggcatt acgtatgtaa cctatcaagg gccgttagaa 120
gatccttaca ttgcagcgta taatcataaa acagatactt ggcaaggtcc gtttaaggca 180
ggtgtaagtg atatgggtaa agaccctacc cgctctaaaa tagataatca cggcaaacct 240
accatgttga ttgatgattt aggctatatt catatctttt ttggtggtca tggtggcatg 300
cctaaacatg gcaaaaaccc tttaggtaat acacattatg gccgcaatat tcatgctgtt 360
tctaaaaacc cgggtgatat taccagttgg gaagaattag ataatatatc ggtatttggt 420
acttataacc aagctgtaaa aatggataac ggtgatattt atttattcta ccgacatggc 480
gcgcacagaa gcgattgggt ttatcaaaaa tcgacagacc atggtcgtac ttttgctgag 540
cctgtgtcgt ttttaaaaca taaacgacgt agtgatatta aagccgtgga tagttggtat 600
gcctgggtag gtaaaggaca gggtgacgat atcattattt cttatgatta ccatatttgt 660
tgggatggtg gtgctggtgt taatggccga ggccatacaa ctgaacgcca tgatgcctat 720
tatatggtat ttaatacgaa ggatgatact tggcgcaatg ttcaaggtga taatctaaac 780
ttgccaataa cccgtgaaac agcagatgaa aaaacactcg tagccagaac aggtaaaaat 840
tggaccttta acggttcagc ccatttagat gagcatggtt acccgcatat tgcaaccaac 900
ataggtaaag atttgggtca aaaaacaggt gggccacgtc aaactagtta tttccgttgg 960
aatggcagtg agtggcttgg tggtcaacct gttaaccctc aggtacgcag cttaaacata 1020
gattcacgtg gtgatttttt tgtgaatacc ccaacagatg tgacttttac gctgggttat 1080
aaagaaaaag atgatggcgt aattgcttat tggaatacgc aagatggcgg caaaagcttt 1140
actaaaggta aagaattgct tcgtcgccaa ggtgcaggtt gggcgttaac atctatcatt 1200
gaaaatgccc acccagatgc tcgagtaatt gttgctgaaa aacaaaaagg tacaaactgg 1260
agtaaagttt atctcttagg ggataaggga ccaatacgaa gcgagaataa gtaa 1314
<210> 29
<211> 437
<212> PRT
<213> Artificial sequence ()
<400> 29
Pro Asn Asn Thr Val Asp Phe Ala Asn Asn Ala Leu Gly Asn Pro Leu
1 5 10 15
Ala Val Val Gln His Pro Ala Gly Ile Tyr His Asn Gly Ile Thr Tyr
20 25 30
Val Thr Tyr Gln Gly Pro Leu Glu Asp Pro Tyr Ile Ala Ala Tyr Asn
35 40 45
His Lys Thr Asp Thr Trp Gln Gly Pro Phe Lys Ala Gly Val Ser Asp
50 55 60
Met Gly Lys Asp Pro Thr Arg Ser Lys Ile Asp Asn His Gly Lys Pro
65 70 75 80
Thr Met Leu Ile Asp Asp Leu Gly Tyr Ile His Ile Phe Phe Gly Gly
85 90 95
His Gly Gly Met Pro Lys His Gly Lys Asn Pro Leu Gly Asn Thr Ala
100 105 110
Tyr Gly Arg Asn Ile His Ala Val Ser Lys Asn Pro Gly Asp Ile Thr
115 120 125
Ser Trp Glu Glu Leu Asp Asn Ile Ser Val Phe Gly Thr Tyr Asn Gln
130 135 140
Ala Val Lys Met Asp Asn Gly Asp Ile Tyr Leu Phe Tyr Arg His Gly
145 150 155 160
Ala His Arg Ser Asp Trp Val Tyr Gln Lys Ser Thr Asp His Gly Arg
165 170 175
Thr Phe Ala Glu Pro Val Ser Phe Leu Lys His Lys Arg Arg Ser Asp
180 185 190
Ile Lys Ala Val Asp Ser Trp Tyr Ala Trp Val Gly Lys Gly Gln Gly
195 200 205
Asp Asp Ile Ile Ile Ser Tyr Asp Tyr His Ile Cys Trp Asp Gly Gly
210 215 220
Ala Gly Val Asn Gly Arg Gly His Thr Thr Glu Arg His Asp Ala Tyr
225 230 235 240
Tyr Met Val Phe Asn Thr Lys Asp Asp Thr Trp Arg Asn Val Gln Gly
245 250 255
Asp Asn Leu Asn Leu Pro Ile Thr Arg Glu Thr Ala Asp Glu Lys Thr
260 265 270
Leu Val Ala Arg Thr Gly Lys Asn Trp Thr Phe Asn Gly Ser Ala His
275 280 285
Leu Asp Glu His Gly Tyr Pro His Ile Ala Thr Asn Ile Gly Lys Asp
290 295 300
Leu Gly Gln Lys Thr Gly Gly Pro Lys Gln Thr Ser Tyr Phe Arg Trp
305 310 315 320
Asn Gly Ser Glu Trp Leu Gly Gly Gln Pro Val Asn Pro Gln Val Arg
325 330 335
Ser Leu Asn Ile Asp Ser Arg Gly Asp Phe Phe Val Asn Thr Pro Thr
340 345 350
Asp Val Thr Phe Thr Leu Gly Tyr Lys Glu Lys Asp Asp Gly Val Ile
355 360 365
Ala Tyr Trp Asn Thr Gln Asp Gly Gly Lys Ser Phe Thr Lys Gly Lys
370 375 380
Glu Leu Leu Arg Arg Gln Gly Ala Gly Trp Ala Leu Thr Ser Ile Ile
385 390 395 400
Glu Asn Ala His Pro Asp Ala Arg Val Ile Val Ala Glu Lys Gln Lys
405 410 415
Gly Thr Asn Trp Ser Lys Val Tyr Leu Leu Gly Asp Lys Gly Pro Ile
420 425 430
Arg Ser Glu Asn Lys
435
<210> 30
<211> 437
<212> PRT
<213> Artificial sequence ()
<400> 30
Pro Asn Asn Thr Val Asp Phe Ala Asn Asn Ala Leu Gly Asn Pro Leu
1 5 10 15
Ala Val Val Gln His Pro Ala Gly Ile Tyr His Asn Gly Ile Thr Tyr
20 25 30
Val Thr Tyr Gln Gly Pro Leu Glu Asp Pro Tyr Ile Ala Ala Tyr Asn
35 40 45
His Lys Thr Asp Thr Trp Gln Gly Pro Phe Lys Ala Gly Val Ser Asp
50 55 60
Met Gly Lys Asp Pro Thr Arg Ser Lys Ile Asp Asn His Gly Lys Pro
65 70 75 80
Thr Met Leu Ile Asp Asp Leu Gly Tyr Ile His Ile Phe Phe Gly Gly
85 90 95
His Gly Gly Met Pro Lys His Gly Lys Asn Pro Leu Gly Asn Thr His
100 105 110
Tyr Gly Arg Asn Ile His Ala Val Ser Lys Asn Pro Gly Asp Ile Thr
115 120 125
Ser Trp Glu Glu Leu Asp Asn Ile Ser Val Phe Gly Val Tyr Asn Gln
130 135 140
Ala Val Lys Met Asp Asn Gly Asp Ile Tyr Leu Phe Tyr Arg His Gly
145 150 155 160
Ala His Arg Ser Asp Trp Val Tyr Gln Lys Ser Thr Asp His Gly Arg
165 170 175
Thr Phe Ala Glu Pro Val Ser Phe Leu Lys His Lys Arg Arg Ser Asp
180 185 190
Ile Lys Ala Val Asp Ser Trp Tyr Ala Trp Val Gly Lys Gly Gln Gly
195 200 205
Asp Asp Ile Ile Ile Ser Tyr Asp Tyr His Ile Cys Trp Asp Gly Gly
210 215 220
Ala Gly Val Asn Gly Arg Gly His Thr Thr Glu Arg His Asp Ala Tyr
225 230 235 240
Tyr Met Val Phe Asn Thr Lys Asp Asp Thr Trp Arg Asn Val Gln Gly
245 250 255
Asp Asn Leu Asn Leu Pro Ile Thr Arg Glu Thr Ala Asp Glu Lys Thr
260 265 270
Leu Val Ala Arg Thr Gly Lys Asn Trp Thr Phe Asn Gly Ser Ala His
275 280 285
Leu Asp Glu His Gly Tyr Pro His Ile Ala Thr Asn Ile Gly Lys Asp
290 295 300
Leu Gly Gln Lys Thr Gly Gly Pro Lys Gln Thr Ser Tyr Phe Arg Trp
305 310 315 320
Asn Gly Ser Glu Trp Leu Gly Gly Gln Pro Val Asn Pro Gln Val Arg
325 330 335
Ser Leu Asn Ile Asp Ser Arg Gly Asp Phe Phe Val Asn Thr Pro Thr
340 345 350
Asp Val Thr Phe Thr Leu Gly Tyr Lys Glu Lys Asp Asp Gly Val Ile
355 360 365
Ala Tyr Trp Asn Thr Gln Asp Gly Gly Lys Ser Phe Thr Lys Gly Lys
370 375 380
Glu Leu Leu Arg Arg Gln Gly Ala Gly Trp Ala Leu Thr Ser Ile Ile
385 390 395 400
Glu Asn Ala His Pro Asp Ala Arg Val Ile Val Ala Glu Lys Gln Lys
405 410 415
Gly Thr Asn Trp Ser Lys Val Tyr Leu Leu Gly Asp Lys Gly Pro Ile
420 425 430
Arg Ser Glu Asn Lys
435
<210> 31
<211> 437
<212> PRT
<213> Artificial sequence ()
<400> 31
Pro Asn Asn Thr Val Asp Phe Ala Asn Asn Ala Leu Gly Asn Pro Leu
1 5 10 15
Ala Val Val Gln His Pro Ala Gly Ile Tyr His Asn Gly Ile Thr Tyr
20 25 30
Val Thr Tyr Gln Gly Pro Leu Glu Asp Pro Tyr Ile Ala Ala Tyr Asn
35 40 45
His Lys Thr Asp Thr Trp Gln Gly Pro Phe Lys Ala Gly Val Ser Asp
50 55 60
Met Gly Lys Asp Pro Thr Arg Ser Lys Ile Asp Asn His Gly Lys Pro
65 70 75 80
Thr Met Leu Ile Asp Asp Leu Gly Tyr Ile His Ile Phe Phe Gly Gly
85 90 95
His Gly Gly Met Pro Lys His Gly Lys Asn Pro Leu Gly Asn Thr His
100 105 110
Tyr Gly Arg Asn Ile His Ala Val Ser Lys Asn Pro Gly Asp Ile Thr
115 120 125
Ser Trp Glu Glu Leu Asp Asn Ile Ser Val Phe Gly Thr Tyr Asn Gln
130 135 140
Ala Val Lys Met Asp Asn Gly Asp Ile Tyr Leu Phe Tyr Arg His Gly
145 150 155 160
Ala Phe Arg Ser Asp Trp Val Tyr Gln Lys Ser Thr Asp His Gly Arg
165 170 175
Thr Phe Ala Glu Pro Val Ser Phe Leu Lys His Lys Arg Arg Ser Asp
180 185 190
Ile Lys Ala Val Asp Ser Trp Tyr Ala Trp Val Gly Lys Gly Gln Gly
195 200 205
Asp Asp Ile Ile Ile Ser Tyr Asp Tyr His Ile Cys Trp Asp Gly Gly
210 215 220
Ala Gly Val Asn Gly Arg Gly His Thr Thr Glu Arg His Asp Ala Tyr
225 230 235 240
Tyr Met Val Phe Asn Thr Lys Asp Asp Thr Trp Arg Asn Val Gln Gly
245 250 255
Asp Asn Leu Asn Leu Pro Ile Thr Arg Glu Thr Ala Asp Glu Lys Thr
260 265 270
Leu Val Ala Arg Thr Gly Lys Asn Trp Thr Phe Asn Gly Ser Ala His
275 280 285
Leu Asp Glu His Gly Tyr Pro His Ile Ala Thr Asn Ile Gly Lys Asp
290 295 300
Leu Gly Gln Lys Thr Gly Gly Pro Lys Gln Thr Ser Tyr Phe Arg Trp
305 310 315 320
Asn Gly Ser Glu Trp Leu Gly Gly Gln Pro Val Asn Pro Gln Val Arg
325 330 335
Ser Leu Asn Ile Asp Ser Arg Gly Asp Phe Phe Val Asn Thr Pro Thr
340 345 350
Asp Val Thr Phe Thr Leu Gly Tyr Lys Glu Lys Asp Asp Gly Val Ile
355 360 365
Ala Tyr Trp Asn Thr Gln Asp Gly Gly Lys Ser Phe Thr Lys Gly Lys
370 375 380
Glu Leu Leu Arg Arg Gln Gly Ala Gly Trp Ala Leu Thr Ser Ile Ile
385 390 395 400
Glu Asn Ala His Pro Asp Ala Arg Val Ile Val Ala Glu Lys Gln Lys
405 410 415
Gly Thr Asn Trp Ser Lys Val Tyr Leu Leu Gly Asp Lys Gly Pro Ile
420 425 430
Arg Ser Glu Asn Lys
435
<210> 32
<211> 437
<212> PRT
<213> Artificial sequence ()
<400> 32
Pro Asn Asn Thr Val Asp Phe Ala Asn Asn Ala Leu Gly Asn Pro Leu
1 5 10 15
Ala Val Val Gln His Pro Ala Gly Ile Tyr His Asn Gly Ile Thr Tyr
20 25 30
Val Thr Tyr Gln Gly Pro Leu Glu Asp Pro Tyr Ile Ala Ala Tyr Asn
35 40 45
His Lys Thr Asp Thr Trp Gln Gly Pro Phe Lys Ala Gly Val Ser Asp
50 55 60
Met Gly Lys Asp Pro Thr Arg Ser Lys Ile Asp Asn His Gly Lys Pro
65 70 75 80
Thr Met Leu Ile Asp Asp Leu Gly Tyr Ile His Ile Phe Phe Gly Gly
85 90 95
His Gly Gly Met Pro Lys His Gly Lys Asn Pro Leu Gly Asn Thr His
100 105 110
Tyr Gly Arg Asn Ile His Ala Val Ser Lys Asn Pro Gly Asp Ile Thr
115 120 125
Ser Trp Glu Glu Leu Asp Asn Ile Ser Val Phe Gly Thr Tyr Asn Gln
130 135 140
Ala Val Lys Met Asp Asn Gly Asp Ile Tyr Leu Phe Tyr Arg His Gly
145 150 155 160
Ala His Arg Ser Asp Trp Val Tyr Gln Lys Ser Thr Asp His Gly Arg
165 170 175
Thr Phe Ala Glu Pro Val Ser Phe Leu Lys His Lys Arg Arg Ser Asp
180 185 190
Ile Lys Ala Val Asp Ser Trp Gln Ala Trp Val Gly Lys Gly Gln Gly
195 200 205
Asp Asp Ile Ile Ile Ser Tyr Asp Tyr His Ile Cys Trp Asp Gly Gly
210 215 220
Ala Gly Val Asn Gly Arg Gly His Thr Thr Glu Arg His Asp Ala Tyr
225 230 235 240
Tyr Met Val Phe Asn Thr Lys Asp Asp Thr Trp Arg Asn Val Gln Gly
245 250 255
Asp Asn Leu Asn Leu Pro Ile Thr Arg Glu Thr Ala Asp Glu Lys Thr
260 265 270
Leu Val Ala Arg Thr Gly Lys Asn Trp Thr Phe Asn Gly Ser Ala His
275 280 285
Leu Asp Glu His Gly Tyr Pro His Ile Ala Thr Asn Ile Gly Lys Asp
290 295 300
Leu Gly Gln Lys Thr Gly Gly Pro Lys Gln Thr Ser Tyr Phe Arg Trp
305 310 315 320
Asn Gly Ser Glu Trp Leu Gly Gly Gln Pro Val Asn Pro Gln Val Arg
325 330 335
Ser Leu Asn Ile Asp Ser Arg Gly Asp Phe Phe Val Asn Thr Pro Thr
340 345 350
Asp Val Thr Phe Thr Leu Gly Tyr Lys Glu Lys Asp Asp Gly Val Ile
355 360 365
Ala Tyr Trp Asn Thr Gln Asp Gly Gly Lys Ser Phe Thr Lys Gly Lys
370 375 380
Glu Leu Leu Arg Arg Gln Gly Ala Gly Trp Ala Leu Thr Ser Ile Ile
385 390 395 400
Glu Asn Ala His Pro Asp Ala Arg Val Ile Val Ala Glu Lys Gln Lys
405 410 415
Gly Thr Asn Trp Ser Lys Val Tyr Leu Leu Gly Asp Lys Gly Pro Ile
420 425 430
Arg Ser Glu Asn Lys
435
<210> 33
<211> 437
<212> PRT
<213> Artificial sequence ()
<400> 33
Pro Asn Asn Thr Val Asp Phe Ala Asn Asn Ala Leu Gly Asn Pro Leu
1 5 10 15
Ala Val Val Gln His Pro Ala Gly Ile Tyr His Asn Gly Ile Thr Tyr
20 25 30
Val Thr Tyr Gln Gly Pro Leu Glu Asp Pro Tyr Ile Ala Ala Tyr Asn
35 40 45
His Lys Thr Asp Thr Trp Gln Gly Pro Phe Lys Ala Gly Val Ser Asp
50 55 60
Met Gly Lys Asp Pro Thr Arg Ser Lys Ile Asp Asn His Gly Lys Pro
65 70 75 80
Thr Met Leu Ile Asp Asp Leu Gly Tyr Ile His Ile Phe Phe Gly Gly
85 90 95
His Gly Gly Met Pro Lys His Gly Lys Asn Pro Leu Gly Asn Thr His
100 105 110
Tyr Gly Arg Asn Ile His Ala Val Ser Lys Asn Pro Gly Asp Ile Thr
115 120 125
Ser Trp Glu Glu Leu Asp Asn Ile Ser Val Phe Gly Thr Tyr Asn Gln
130 135 140
Ala Val Lys Met Asp Asn Gly Asp Ile Tyr Leu Phe Tyr Arg His Gly
145 150 155 160
Ala His Arg Ser Asp Trp Val Tyr Gln Lys Ser Thr Asp His Gly Arg
165 170 175
Thr Phe Ala Glu Pro Val Ser Phe Leu Lys His Lys Arg Arg Ser Asp
180 185 190
Ile Lys Ala Val Asp Ser Trp Tyr Ala Trp Val Gly Lys Gly Gln Gly
195 200 205
Asp Asp Ile Ile Ile Ser Tyr Asp Tyr His Ile Ser Trp Asp Gly Gly
210 215 220
Ala Gly Val Asn Gly Arg Gly His Thr Thr Glu Arg His Asp Ala Tyr
225 230 235 240
Tyr Met Val Phe Asn Thr Lys Asp Asp Thr Trp Arg Asn Val Gln Gly
245 250 255
Asp Asn Leu Asn Leu Pro Ile Thr Arg Glu Thr Ala Asp Glu Lys Thr
260 265 270
Leu Val Ala Arg Thr Gly Lys Asn Trp Thr Phe Asn Gly Ser Ala His
275 280 285
Leu Asp Glu His Gly Tyr Pro His Ile Ala Thr Asn Ile Gly Lys Asp
290 295 300
Leu Gly Gln Lys Thr Gly Gly Pro Lys Gln Thr Ser Tyr Phe Arg Trp
305 310 315 320
Asn Gly Ser Glu Trp Leu Gly Gly Gln Pro Val Asn Pro Gln Val Arg
325 330 335
Ser Leu Asn Ile Asp Ser Arg Gly Asp Phe Phe Val Asn Thr Pro Thr
340 345 350
Asp Val Thr Phe Thr Leu Gly Tyr Lys Glu Lys Asp Asp Gly Val Ile
355 360 365
Ala Tyr Trp Asn Thr Gln Asp Gly Gly Lys Ser Phe Thr Lys Gly Lys
370 375 380
Glu Leu Leu Arg Arg Gln Gly Ala Gly Trp Ala Leu Thr Ser Ile Ile
385 390 395 400
Glu Asn Ala His Pro Asp Ala Arg Val Ile Val Ala Glu Lys Gln Lys
405 410 415
Gly Thr Asn Trp Ser Lys Val Tyr Leu Leu Gly Asp Lys Gly Pro Ile
420 425 430
Arg Ser Glu Asn Lys
435
<210> 34
<211> 437
<212> PRT
<213> Artificial sequence ()
<400> 34
Pro Asn Asn Thr Val Asp Phe Ala Asn Asn Ala Leu Gly Asn Pro Leu
1 5 10 15
Ala Val Val Gln His Pro Ala Gly Ile Tyr His Asn Gly Ile Thr Tyr
20 25 30
Val Thr Tyr Gln Gly Pro Leu Glu Asp Pro Tyr Ile Ala Ala Tyr Asn
35 40 45
His Lys Thr Asp Thr Trp Gln Gly Pro Phe Lys Ala Gly Val Ser Asp
50 55 60
Met Gly Lys Asp Pro Thr Arg Ser Lys Ile Asp Asn His Gly Lys Pro
65 70 75 80
Thr Met Leu Ile Asp Asp Leu Gly Tyr Ile His Ile Phe Phe Gly Gly
85 90 95
His Gly Gly Met Pro Lys His Gly Lys Asn Pro Leu Gly Asn Thr His
100 105 110
Tyr Gly Arg Asn Ile His Ala Val Ser Lys Asn Pro Gly Asp Ile Thr
115 120 125
Ser Trp Glu Glu Leu Asp Asn Ile Ser Val Phe Gly Thr Tyr Asn Gln
130 135 140
Ala Val Lys Met Asp Asn Gly Asp Ile Tyr Leu Phe Tyr Arg His Gly
145 150 155 160
Ala His Arg Ser Asp Trp Val Tyr Gln Lys Ser Thr Asp His Gly Arg
165 170 175
Thr Phe Ala Glu Pro Val Ser Phe Leu Lys His Lys Arg Arg Ser Asp
180 185 190
Ile Lys Ala Val Asp Ser Trp Tyr Ala Trp Val Gly Lys Gly Gln Gly
195 200 205
Asp Asp Ile Ile Ile Ser Tyr Asp Tyr His Ile Cys Trp Asp Gly Gly
210 215 220
Ala Gly Val Asn Gly Arg Gly Cys Thr Thr Glu Arg His Asp Ala Tyr
225 230 235 240
Tyr Met Val Phe Asn Thr Lys Asp Asp Thr Trp Arg Asn Val Gln Gly
245 250 255
Asp Asn Leu Asn Leu Pro Ile Thr Arg Glu Thr Ala Asp Glu Lys Thr
260 265 270
Leu Val Ala Arg Thr Gly Lys Asn Trp Thr Phe Asn Gly Ser Ala His
275 280 285
Leu Asp Glu His Gly Tyr Pro His Ile Ala Thr Asn Ile Gly Lys Asp
290 295 300
Leu Gly Gln Lys Thr Gly Gly Pro Lys Gln Thr Ser Tyr Phe Arg Trp
305 310 315 320
Asn Gly Ser Glu Trp Leu Gly Gly Gln Pro Val Asn Pro Gln Val Arg
325 330 335
Ser Leu Asn Ile Asp Ser Arg Gly Asp Phe Phe Val Asn Thr Pro Thr
340 345 350
Asp Val Thr Phe Thr Leu Gly Tyr Lys Glu Lys Asp Asp Gly Val Ile
355 360 365
Ala Tyr Trp Asn Thr Gln Asp Gly Gly Lys Ser Phe Thr Lys Gly Lys
370 375 380
Glu Leu Leu Arg Arg Gln Gly Ala Gly Trp Ala Leu Thr Ser Ile Ile
385 390 395 400
Glu Asn Ala His Pro Asp Ala Arg Val Ile Val Ala Glu Lys Gln Lys
405 410 415
Gly Thr Asn Trp Ser Lys Val Tyr Leu Leu Gly Asp Lys Gly Pro Ile
420 425 430
Arg Ser Glu Asn Lys
435
<210> 35
<211> 437
<212> PRT
<213> Artificial sequence ()
<400> 35
Pro Asn Asn Thr Val Asp Phe Ala Asn Asn Ala Leu Gly Asn Pro Leu
1 5 10 15
Ala Val Val Gln His Pro Ala Gly Ile Tyr His Asn Gly Ile Thr Tyr
20 25 30
Val Thr Tyr Gln Gly Pro Leu Glu Asp Pro Tyr Ile Ala Ala Tyr Asn
35 40 45
His Lys Thr Asp Thr Trp Gln Gly Pro Phe Lys Ala Gly Val Ser Asp
50 55 60
Met Gly Lys Asp Pro Thr Arg Ser Lys Ile Asp Gln His Gly Lys Pro
65 70 75 80
Thr Met Leu Ile Asp Asp Leu Gly Tyr Ile His Ile Phe Phe Gly Gly
85 90 95
His Gly Gly Met Pro Lys His Gly Lys Asn Pro Leu Gly Asn Thr His
100 105 110
Tyr Gly Arg Asn Ile His Ala Val Ser Lys Asn Pro Gly Asp Ile Thr
115 120 125
Ser Trp Glu Glu Leu Asp Asn Ile Ser Val Phe Gly Thr Tyr Asn Gln
130 135 140
Ala Val Lys Met Asp Asn Gly Asp Ile Tyr Leu Phe Tyr Arg His Gly
145 150 155 160
Ala His Arg Ser Asp Trp Val Tyr Gln Lys Ser Thr Asp His Gly Arg
165 170 175
Thr Phe Ala Glu Pro Val Ser Phe Leu Lys His Lys Arg Arg Ser Asp
180 185 190
Ile Lys Ala Val Asp Ser Trp Tyr Ala Trp Val Gly Lys Gly Gln Gly
195 200 205
Asp Asp Ile Ile Ile Ser Tyr Asp Tyr His Ile Cys Trp Asp Gly Gly
210 215 220
Ala Gly Val Asn Gly Arg Gly His Thr Thr Glu Arg His Asp Ala Tyr
225 230 235 240
Tyr Met Val Phe Asn Thr Lys Asp Asp Thr Trp Arg Asn Val Gln Gly
245 250 255
Asp Asn Leu Asn Leu Pro Ile Thr Arg Glu Thr Ala Asp Glu Lys Thr
260 265 270
Leu Val Ala Arg Thr Gly Lys Asn Trp Thr Phe Asn Gly Ser Ala His
275 280 285
Leu Asp Glu His Gly Tyr Pro His Ile Ala Thr Asn Ile Gly Lys Asp
290 295 300
Leu Gly Gln Lys Thr Gly Gly Pro Lys Gln Thr Ser Tyr Phe Arg Trp
305 310 315 320
Asn Gly Ser Glu Trp Leu Gly Gly Gln Pro Val Asn Pro Gln Val Arg
325 330 335
Ser Leu Asn Ile Asp Ser Arg Gly Asp Phe Phe Val Asn Thr Pro Thr
340 345 350
Asp Val Thr Phe Thr Leu Gly Tyr Lys Glu Lys Asp Asp Gly Val Ile
355 360 365
Ala Tyr Trp Asn Thr Gln Asp Gly Gly Lys Ser Phe Thr Lys Gly Lys
370 375 380
Glu Leu Leu Arg Arg Gln Gly Ala Gly Trp Ala Leu Thr Ser Ile Ile
385 390 395 400
Glu Asn Ala His Pro Asp Ala Arg Val Ile Val Ala Glu Lys Gln Lys
405 410 415
Gly Thr Asn Trp Ser Lys Val Tyr Leu Leu Gly Asp Lys Gly Pro Ile
420 425 430
Arg Ser Glu Asn Lys
435
<210> 36
<211> 437
<212> PRT
<213> Artificial sequence ()
<400> 36
Pro Asn Asn Thr Val Asp Phe Ala Asn Asn Ala Leu Gly Asn Pro Leu
1 5 10 15
Ala Val Val Gln His Pro Ala Gly Ile Tyr His Asn Gly Ile Thr Tyr
20 25 30
Val Thr Tyr Gln Gly Pro Leu Glu Asp Pro Tyr Ile Ala Ala Tyr Asn
35 40 45
His Lys Thr Asp Thr Trp Gln Gly Pro Phe Lys Ala Gly Val Ser Asp
50 55 60
Met Gly Lys Asp Pro Thr Arg Ser Lys Ile Asp Asn His Gly Lys Pro
65 70 75 80
Thr Met Leu Ile Asp Asp Leu Gly Tyr Ile His Ile Phe Phe Gly Gly
85 90 95
His Gly Gly Met Pro Lys His Gly Lys Asn Pro Leu Gly Asn Thr His
100 105 110
Tyr Gly Arg Asn Ile His Ala Val Ser Lys Asn Pro Gly Asp Ile Thr
115 120 125
Ser Trp Glu Glu Leu Asp Asn Ile Ser Val Phe Gly Thr Tyr Asn Gln
130 135 140
Ala Val Lys Met Asp Asn Gly Asp Ile Tyr Leu Phe Tyr Arg His Gly
145 150 155 160
Ala His Arg Ser Asp Trp Val Tyr Gln Lys Ser Thr Asp His Gly Arg
165 170 175
Thr Phe Ala Glu Pro Val Ser Phe Leu Lys His Lys Arg Arg Ser Asp
180 185 190
Ile Lys Ala Val Asp Ser Trp Tyr Ala Trp Val Gly Lys Gly Gln Gly
195 200 205
Asp Asp Ile Ile Ile Ser Tyr Asp Tyr His Ile Cys Trp Asp Gly Gly
210 215 220
Ala Gly Val Asn Gly Arg Gly His Thr Thr Glu Arg His Asp Ala Tyr
225 230 235 240
Tyr Met Val Phe Asn Thr Lys Asp Asp Thr Trp Arg Asn Val Gln Gly
245 250 255
Asp Asn Leu Asn Leu Pro Ile Thr Arg Glu Thr Ala Asp Glu Lys Thr
260 265 270
Leu Val Ala Arg Thr Gly Lys Asn Trp Thr Phe Asn Gly Ser Ala His
275 280 285
Leu Asp Glu His Gly Tyr Pro His Ile Ala Thr Asn Ile Gly Lys Asp
290 295 300
Leu Gly Gln Lys Thr Gly Gly Pro Arg Gln Thr Ser Tyr Phe Arg Trp
305 310 315 320
Asn Gly Ser Glu Trp Leu Gly Gly Gln Pro Val Asn Pro Gln Val Arg
325 330 335
Ser Leu Asn Ile Asp Ser Arg Gly Asp Phe Phe Val Asn Thr Pro Thr
340 345 350
Asp Val Thr Phe Thr Leu Gly Tyr Lys Glu Lys Asp Asp Gly Val Ile
355 360 365
Ala Tyr Trp Asn Thr Gln Asp Gly Gly Lys Ser Phe Thr Lys Gly Lys
370 375 380
Glu Leu Leu Arg Arg Gln Gly Ala Gly Trp Ala Leu Thr Ser Ile Ile
385 390 395 400
Glu Asn Ala His Pro Asp Ala Arg Val Ile Val Ala Glu Lys Gln Lys
405 410 415
Gly Thr Asn Trp Ser Lys Val Tyr Leu Leu Gly Asp Lys Gly Pro Ile
420 425 430
Arg Ser Glu Asn Lys
435

Claims (11)

1. An ulvan lyase, which is characterized in that the amino acid sequence of the ulvan lyase is shown as SEQ ID number 1.
2. The ulvan lyase-encoding gene of claim 1, wherein the nucleotide sequence of the ulvan lyase-encoding gene having an amino acid sequence represented by SEQ ID number 1 is represented by SEQ ID No. 2.
3. A recombinant vector comprising a gene encoding ulvan lyase described in claim 1.
4. The recombinant vector according to claim 3, wherein the recombinant vector plasmid is an E.coli plasmid or a B.subtilis plasmid.
5. A cell transformed with a host cell comprising the recombinant vector of claim 3.
6. The cell of claim 5, wherein: the host cell is escherichia coli or bacillus subtilis.
7. A method for preparing the ulva polysaccharide lyase of claim 1, wherein the method for preparing the ulva polysaccharide lyase comprises the following steps:
(1) cloning and analysis of ulva polysaccharide lyase gene: extracting preservation number of CCTCC M2012132Alteromonas colwelliana A321 strain genome, comparing and analyzing the genome sequence and the functional gene, designing a primer, and obtaining an ulva polysaccharide lyase gene by PCR (polymerase chain reaction) by taking the extracted genome DNA as a template;
(2) constructing an ulva polysaccharide lyase recombinant vector: carrying out double-enzyme digestion on the nucleotide sequence of the ulva polysaccharide lyase gene obtained in the step (1), and then connecting the nucleotide sequence with an escherichia coli plasmid to obtain an escherichia coli recombinant vector;
(3) constructing ulva polysaccharide lyase recombinant cells: transforming the ulva polysaccharide lyase recombinant vector in the step (2) into escherichia coli to obtain escherichia coli ulva polysaccharide lyase recombinant cells;
(4) expression and purification of ulva polysaccharide lyase: inoculating cells containing ulva polysaccharide lyase genes or cells of recombinant vectors containing the ulva polysaccharide lyase genes into a bioreactor for culture, inducing expression, collecting expression products, and purifying by affinity chromatography or ion exchange and gel filtration to obtain the ulva polysaccharide lyase.
8. A composition comprising the ulvan lyase of claim 1.
9. The composition of claim 8, wherein the composition further comprises an adjuvant or carrier acceptable in food or pharmaceutical products.
10. Use of the ulva polysaccharide lyase of claim 1 or the composition of claim 8 or 9 for the catalytic degradation of chlorella polysaccharide to produce chlorella oligosaccharides.
11. The use of claim 10, wherein the green algal polysaccharide is ulva polysaccharide, enteromorpha polysaccharide or monostroma nitidum polysaccharide.
CN201910475251.8A 2019-06-03 2019-06-03 Ulva lactuca polysaccharide lyase as well as coding gene and application thereof Active CN112029752B (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN201910475251.8A CN112029752B (en) 2019-06-03 2019-06-03 Ulva lactuca polysaccharide lyase as well as coding gene and application thereof
PCT/CN2019/096475 WO2020244031A1 (en) 2019-06-03 2019-07-18 Ulva lactuca polysaccharide lyase, encoding gene thereof, and application thereof
JP2021521492A JP7241368B2 (en) 2019-06-03 2019-07-18 Ulva polysaccharide lyase and its coding gene and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910475251.8A CN112029752B (en) 2019-06-03 2019-06-03 Ulva lactuca polysaccharide lyase as well as coding gene and application thereof

Publications (2)

Publication Number Publication Date
CN112029752A CN112029752A (en) 2020-12-04
CN112029752B true CN112029752B (en) 2022-01-07

Family

ID=73575764

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910475251.8A Active CN112029752B (en) 2019-06-03 2019-06-03 Ulva lactuca polysaccharide lyase as well as coding gene and application thereof

Country Status (3)

Country Link
JP (1) JP7241368B2 (en)
CN (1) CN112029752B (en)
WO (1) WO2020244031A1 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112646799B (en) * 2021-01-04 2022-01-18 天津科技大学 Ulva lactuca polysaccharide lyase mutant and application thereof
CN113293114B (en) * 2021-06-25 2022-08-05 山东大学 Alteromonas HT1 and culture method and application thereof
CN114480346B (en) * 2022-02-18 2023-07-21 嘉兴维亚生物科技有限公司 DNA hydrolase and preparation method thereof
CN116622683A (en) * 2023-03-27 2023-08-22 昆明理工大学 Specific bacillus lyase and preparation method and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018051002A1 (en) * 2016-09-13 2018-03-22 Centre National De La Recherche Scientifique Novel ulvan lyase and use thereof for cleaving polysaccharides

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103451119B (en) * 2012-06-03 2015-06-17 中国海洋大学 Alteromonas and method thereby for producing gel-type enteromorpha polysaccharide degrading enzyme by using Alteromonas
CN106578379A (en) 2016-12-09 2017-04-26 中国海洋大学 Method for preparing functional feed additive through biological glycolysis of enteromorpha

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018051002A1 (en) * 2016-09-13 2018-03-22 Centre National De La Recherche Scientifique Novel ulvan lyase and use thereof for cleaving polysaccharides

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Biochemical characterization of a novel ulvan lyase from Pseudoalteromonas sp. strain PLSV;QIN,H.M.等;《RSC Advances》;20181231;2610-2615 *
Cloning,Expression,and Characterization of a New PL25 Family Ulvan Lyase from Marine Bacterium Alteromonas sp. A321;GAO,J.等;《MAR. DRUGS》;20191008;1-11 *
石莼多糖裂解酶原核表达方法比较;陈冉等;《水产科学》;20181130;842-846 *

Also Published As

Publication number Publication date
CN112029752A (en) 2020-12-04
JP7241368B2 (en) 2023-03-17
WO2020244031A1 (en) 2020-12-10
JP2022512771A (en) 2022-02-07

Similar Documents

Publication Publication Date Title
CN112029752B (en) Ulva lactuca polysaccharide lyase as well as coding gene and application thereof
CN108285900B (en) Recombinant alginate lyase and construction method and application thereof
CN112646794B (en) Exoinulase mutant MutY119V with improved low-temperature activity
CN110066777B (en) Endo-inulase and application thereof in production of fructo-oligosaccharide
CN112852782A (en) Low-temperature-adaptively-improved low-temperature inulinase mutant MutDL121EK5 and application thereof
CN113174385B (en) Sucrose isomerase mutant with high activity and high conversion rate and application thereof
CN112725319B (en) Alginate lyase FaAly7 with polyG substrate specificity and application thereof
CN113122490B (en) Double-gene defective engineering bacterium and application thereof in improving yield of N-acetylglucosamine
CN107603994B (en) Kappa-carrageenase and gene and application thereof
CN113462678B (en) Glutamic acid decarboxylase mutant
CN109593744B (en) Agarase and preparation method thereof
CN110592035B (en) Carbonyl reductase mutant, recombinant expression vector and application of carbonyl reductase mutant in production of chiral alcohol
KR20100040438A (en) A novel agarase and an enzymatic production method of agarooligosaccharide from agarose using the same
CN114196655B (en) Heat-resistant Kunmu polysaccharide degrading enzyme OUC-SaLam66 and application thereof
CN114181927B (en) Heparinase I
CN114015675B (en) Lambda-carrageenase OUC-LuV and application thereof
CN109022471B (en) Escherichia coli expression system for producing oxalate oxidase, and production method and application of oxalate oxidase
CN111849949B (en) Mannuronic acid C-5 epimerase/alginate lyase coding gene, enzyme, preparation and application
CN108728457B (en) Trehalose synthase gene optimization sequence and application thereof
CN107083375B (en) Medium-temperature alpha-amylase and gene and application thereof
CN115011622A (en) Screening method and application of D-psicose 3-epimerase mutant
CN114934033B (en) Agarase mutant and encoding gene and application thereof
KR101347685B1 (en) Novel microorganism, oligoalginate lyase isolated therefrom, method for saccharifying oligoalginates using the same
CN115232805B (en) Chondroitin sulfate lyase, recombinant strain and application thereof
CN113583991B (en) Amylosucrase SaAS and encoding gene and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant