CN114934033B - Agarase mutant and encoding gene and application thereof - Google Patents
Agarase mutant and encoding gene and application thereof Download PDFInfo
- Publication number
- CN114934033B CN114934033B CN202210213233.4A CN202210213233A CN114934033B CN 114934033 B CN114934033 B CN 114934033B CN 202210213233 A CN202210213233 A CN 202210213233A CN 114934033 B CN114934033 B CN 114934033B
- Authority
- CN
- China
- Prior art keywords
- agarase
- ser
- mutant
- asn
- asp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2468—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on beta-galactose-glycoside bonds, e.g. carrageenases (3.2.1.83; 3.2.1.157); beta-agarase (3.2.1.81)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01081—Beta-agarase (3.2.1.81)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the technical field of biology, and particularly relates to an agarase mutant, a coding gene thereof, a recombinant vector and a cell containing the coding gene, and a preparation method and application of the agarase mutant. The wild agarase point mutation is rationally designed to obtain an agarase mutant E122W, the amino acid sequence of the agarase mutant is shown as SEQ ID NO.2, the enzyme activity and the thermal stability of the agarase mutant are both obviously improved, the agarase can be efficiently catalyzed and degraded to prepare the agarase oligosaccharide, the yield of the agarase oligosaccharide is higher, the industrial production requirement is met, and a foundation is laid for research application of the agarase in fields of biochemical industry, food, medicine and the like and industrial production of the agarase oligosaccharide.
Description
Technical Field
The invention relates to an agarase mutant, and a coding gene and application thereof, and belongs to the technical field of biology.
Background
Agarase is an enzyme for specifically degrading agarase polysaccharide, and can be divided into alpha-agarase and beta-agarase according to different action modes of the agarase, wherein the alpha-agarase acts on alpha-1, 3 glycosidic bond of agarose to generate Agarase Oligosaccharide (AOS) taking 3, 6-endo-ether-alpha-L-galactose as a reducing end; beta-agarase acts on beta-1, 4 glycosidic linkages to produce Neoagarase (NAOS) with beta-D-galactose as the reducing end. The sugar biology research shows that the agar oligosaccharides have various physiological activities such as antioxidation, anti-tumor, whitening and moisturizing, and the like, and have important application values in the fields of chemical industry, health-care food and medicine.
The enzyme method is one of the main methods for producing the agar oligosaccharides, but because the agar has a complex structure, consists of (1-3) -beta-D-galactose, (1-4) -3, 6-endo-ether-alpha-L-galactose and the like, and has larger temperature difference between the condensation point and the melting point, the agar is always in a sol state at a higher temperature, so that the requirement on the tolerance temperature and the temperature stability of the enzyme in practical application is higher; the agarase reported in the research at the present stage has poor thermal stability, and most of the agarase loses most of the enzyme activity after being acted at a high temperature for a short time, so that the development and application of the agarase and the agarase oligosaccharide are severely limited.
The modification of the enzyme is an important technical means for improving the catalytic efficiency of the enzyme, improving the enzymatic properties and improving the tolerance temperature and the temperature stability. As known from the present inventors by referring to the data and the literature search, qu et al published random mutagenesis of β -agarase YM01-3 of agaropectin (catenovuloubumagarivora) by error-prone PCR technique, studied key sites affecting the enzyme activity of β -agarase YM01-3 (Qu, microbiology report, 2018,45 (9): 2000-2005); guo Yu Zhe et al disclose that the agarase of the microcosmic fungus AG1 is subjected to site-directed mutagenesis by rational design and overlap extension PCR technology to obtain an agarase mutant D136N with high enzyme heat stability (Guo Yuzhe, chinese food science newspaper, 2019, 19 (12): 83-88); lu et al published a pseudoalteromonassp.cy24-derived beta-agarase AgaA, the key catalytic sites of which were studied by site-directed mutagenesis (X Lu, biotechnol Lett (2009) 31:1565-1570); xu et al published a novel alpha-agarase AgaE of Thalassomonas sp.LD5 origin and found that aspartic acid plays a key role in the catalytic activity of alpha-agarase AgaE by site-directed mutagenesis studies (Jinnan Xu, international Journal of Biological Macromolecules,194 (2022) 50-57). The patent "a site-directed mutagenesis modified agarase mutant with improved thermostability" (CN 109207459B) discloses a Vibrio sp. Source agarase with improved stability by site-directed mutagenesis and an application thereof in preparing agarase oligosaccharides. The invention obtains the agarase with better enzyme activity and stability in the early stage, further improves the temperature stability through molecular transformation, meets the requirement of industrial production, and promotes the industrial development of the agarase and the agarase oligosaccharide.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides an agarase mutant, and a coding gene and application thereof. The invention carries out point mutation on amino acid of wild agarase to obtain an agarase mutant, the activity and the thermal stability of the mutant are obviously improved, the agarase can be efficiently catalyzed and degraded to prepare the agarase oligosaccharide, and the requirement of industrial production is met.
In order to solve the problems in the prior art, the invention is implemented by adopting the following technical scheme:
the invention firstly provides an agarase mutant, which is obtained by performing point mutation on the basis of the amino acid sequence SEQ ID NO.1 of wild agarase.
In one embodiment of the invention, the mutant is characterized in that the 122 th site of agarase shown in the amino acid sequence SEQ ID NO.1 is mutated from glutamic acid (E) to tryptophan (W), and the amino acid sequence of the mutant is shown in the SEQ ID NO. 2.
In one embodiment of the invention, the wild-type agarase is derived from Pseudoalteromonas sp.qm222.
In one embodiment of the invention, the nucleotide sequence of the wild agarase is shown in SEQ ID NO. 9.
The invention also provides an agarase mutant coding gene, which codes the agarase mutant.
In one embodiment of the invention, when the agarase mutant is E122W, the nucleotide sequence of the coding gene is shown as SEQ ID NO. 10.
The invention also provides a recombinant vector, which comprises the vector of the coding gene of the agarase mutant.
In one embodiment of the present invention, the plasmid of the recombinant vector is E.coli pProEXHTA plasmid.
The invention also provides a recombinant cell which comprises the agarase mutant coding gene or the recombinant vector.
In one embodiment of the present invention, the recombinant cell is obtained by transforming a host cell with a recombinant vector comprising an agarase gene.
In one embodiment of the invention, the host cell is E.coli cell BL21 (DE 3).
The invention also provides a method for preparing the agarase mutant, which comprises the following steps:
(1) Constructing a wild agarase recombinant vector: extracting a bacterial strain Pseudoalteromonas sp.QM222 (preservation number: CCTCC No. M2018744) genome, cloning to obtain a wild agarase gene, and connecting the wild agarase gene with an escherichia coli plasmid to obtain a wild agarase recombinant vector;
(2) Constructing an agarase mutant recombinant vector: taking the wild agarase recombinant vector in the step (1) as a template, and obtaining an agarase mutant recombinant vector through point mutation;
(3) Constructing an agarase mutant recombinant cell: converting the agarase mutant recombinant vector in the step (2) into escherichia coli to obtain an agarase mutant recombinant cell;
(4): expression and purification of agarase mutant: culturing the recombinant cells of the agarase mutant in the step (3), inducing expression of recombinant proteins, and separating and purifying to obtain the agarase mutant.
The invention also provides an agarase mutant, an agarase mutant coding gene, a recombinant vector, a recombinant cell or application of the agarase mutant prepared by the preparation method in degrading agar or preparing new agarase oligosaccharide.
Compared with the prior art, the invention has the advantages and beneficial effects that:
compared with wild agarase, the agarase mutant provided by the invention has the advantages that the fermentation enzyme activity of the mutant E122W is improved by 47.0%, the relative enzyme activities of the mutant E122W are 79.75% and 55.15% after being treated at 45 ℃ and 50 ℃ for 1 hour, and are respectively improved by 27% and 35.14% compared with the wild agarase, and the enzyme activity half-life of the mutant E122W at 45 ℃ is 1.3 times of that of the wild agarase, so that the enzyme activity and the thermal stability of the agarase mutant are obviously improved.
The agarase mutant provided by the invention has the advantages that the heat resistance is obviously improved, the agarase can be catalyzed and degraded at a higher temperature to prepare the agarase oligosaccharide, the high Wen Liyu agarase is in a sol state, the coagulation is avoided, the agarase is efficiently catalyzed and degraded to produce the agarase oligosaccharide, the recovery rate of the agarase oligosaccharide is improved, the production cost is reduced, and the method is beneficial to industrial application.
The agarase mutant provided by the invention has the excellent properties of high enzyme activity, good heat stability and high catalytic efficiency, breaks through the technical barriers of low agarase activity, poor heat stability and the like, can obviously improve the degradation efficiency and the agarase oligosaccharide recovery rate, meets the industrial production requirements, and has wide application prospects in the fields of biochemical industry, feeds, foods, medicines and the like.
Definition of terms in accordance with the invention
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
The amino acids in the various amino acid sequences presented herein are expressed in terms of their well-known three letter or single letter abbreviations, such as lysine three letter abbreviation Lys, single letter abbreviation K. Nucleotides present in the various DNA fragments are identified by standard single letter designations conventionally used in the art.
The term "nucleotide" means deoxyribonucleoside, ribonucleoside or ribonucleotide and polymers thereof. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides.
The terms "mutation" and "mutant" refer to genetic, naturally occurring or introduced changes in a nucleic acid or polypeptide sequence in the same sense as commonly known to those skilled in the art.
The term "host cell" or "recombinant host cell" means a cell comprising a nucleotide or polypeptide, or protein of the invention. The exogenous nucleotide may remain as a non-integrating vector or may integrate into the host genome.
The term "transformation" refers to the process by which eukaryotic cells acquire new genetic markers due to the incorporation of exogenous DNA.
Preservation information: pseudoalteromonas sp.qm222 strain deposited at the chinese collection at 11, 05, 2018 at the address: china, university of Wuhan, pseudomonas sp.QM222 accession number: cctccc NO: m2018744.
Drawings
The invention is described in further detail below with reference to the attached drawing figures, wherein:
fig. 1: stability of agarase mutants at different temperatures. Wherein the abscissa indicates the agarase mutant and the ordinate indicates the relative enzyme activity.
Fig. 2: heat inactivation profile of agarase mutants. Wherein the abscissa is time and the ordinate is relative enzyme activity.
Fig. 3: mass spectrum of agaro-oligosaccharide. The abscissa is m/z and the ordinate is ion current intensity.
Fig. 4: agar oligosaccharides 13 CNMR profile. Wherein, the abscissa is chemical shift, and the ordinate is absorption peak intensity.
Detailed Description
The invention provides an agarase mutant, a preparation method and application of the agarase mutant, a nucleotide sequence for encoding the agarase mutant, a vector and a host cell, and realizes engineering expression of the agarase mutant. The technical solution of the present invention will be further elucidated with reference to the following specific examples, which are to be understood as merely illustrative of the present invention and are not to be construed as limiting the scope of the present invention. The experimental methods, in which specific conditions are not noted in the following examples, are generally according to conventional conditions such as those described in J.sambrook et al, guidelines for molecular cloning experiments, fourth edition, scientific Press, 2017 or according to the manufacturer's recommendations.
1. Bacterial strain, carrier and kit
Coli DH 5. Alpha., E.coli BL21 (DE 3), vector pProEX HTA were purchased from Invitrogen corporation.
PCR enzymes and ligases were purchased from Takara.
The DNA extraction kit was purchased from TIANGEN company, the seamless cloning kit was purchased from Novain company, and the purification kit, the plasmid extraction kit and the gel recovery kit were purchased from Omega company.
2. Culture medium
LB liquid medium: 0.5% yeast extract, 1% tryptone, 1% NaCl, pH 7.0.
LB solid medium: 0.5% yeast extract, 1% tryptone, 1% NaCl, agar 2%, pH 7.0.
Fermentation medium: 0.5% yeast extract, 1% tryptone, 1% NaCl,0.25% dipotassium hydrogen phosphate, 0.1% magnesium sulfate, 0.5% glucose (sterilized alone), pH 7.0.
Feed medium: 50% glucose, 1% yeast extract, 2% tryptone, 1% magnesium sulfate.
3. Method for measuring agarase activity
The enzyme activity is determined by a 3, 5-dinitrosalicylic acid method. With 0.02mol/L Na 2 HPO 4 Preparing a 0.2% agar solution by using a citric acid buffer solution (pH 7.0), taking 1.9mL of the agar solution as a substrate, adding 0.1mL of enzyme solution, placing the substrate in a water bath at 40 ℃ for heat preservation reaction for 30min, adding 2mL of DNS to terminate the reaction, heating the substrate in the boiling water bath for 5min to develop color, cooling the substrate to room temperature, fixing the volume to 25mL, drawing a standard curve by using D-galactose, measuring a 520nm wavelength absorbance value (OD 520), and using the inactivated enzyme solution as a blank. And (5) drawing a standard curve by using D-galactose to calculate the enzyme activity.
The enzyme activity unit (U) is defined as the amount of enzyme required to catalyze the production of 1. Mu.g of reducing sugar per minute from a substrate under experimental conditions. The enzyme activity unit of the fermentation broth is defined as the enzyme activity unit (U/mL) contained in each milliliter of fermentation broth.
EXAMPLE 1 wild agarase Gene cloning and vector construction
The genome of Pseudoalteromonas sp.qm222 in logarithmic growth phase (accession number: cctccc No. m 2018744) was extracted according to the protocol of TIAamp Bacteria DNA Kit (TIANGEN BIOTECH (BEIJING) co., LTD) kit, and the extracted genome sample was subjected to gene sequencing (BEIJING norelsen technologies, inc.) as a result of 1% agarose gel electrophoresis, showing good uniformity of DNA bands.
The primer EcoR I-F and Kpn I-R containing restriction enzyme cleavage sites are used for amplifying agarase gene AgaZ537 (without signal peptide) by taking the Pseudoalteromonas sp.QM222 genome as a template according to a sequencing result and functional gene analysis:
EcoR I-F：
CCGGAATTCAATGATTGGGACTCAATTCCTTTACC(SEQ ID NO.17)
Kpn I-R：
CGGGGTACCTTATTCAATAAATTGAAAACGTTGATTG(SEQ ID NO.18)
wherein, the liquid crystal display device comprises a liquid crystal display device,GAATTCfor the restriction enzyme EcoRI,GGTACCis the cleavage site for restriction endonuclease KpnI.
Carrying out gene amplification by adopting PCR, and constructing a 50uL amplification reaction system: template DNA, 1. Mu.L; f (10. Mu.M), 1. Mu.L; r (10. Mu.M), 1. Mu.L; dNTPs (2.5 mM each), 4. Mu.L; taq (2U/. Mu.L), 1. Mu.L; 10×Taq buffer, 5. Mu.L; ddH2O was added to 50. Mu.L.
The PCR amplification procedure was: pre-denaturation at 94℃for 3min, denaturation at 94℃for 30s, annealing at 60℃for 30s, extension at 72℃for 2min, cyclic amplification for 35 times, and final extension at 72℃for 5min.
The PCR product is tested by 1% agarose gel electrophoresis to be a single specific band, then is sequenced, the nucleotide sequence is shown as a sequence table SEQ.ID.NO.9, the gene sequence shown as the sequence table SEQ.ID.NO.9 is compared with the whole genome sequence, and the gene sequence is consistent with the functional gene sequence in the whole genome, so that the agarase gene AgaZ537 with the gene length of 1281bp is obtained. The gene codes a protein composed of 426 amino acids, and the amino acid sequence is shown in a sequence table SEQ.ID.NO. 1.
The pProEXHTa empty plasmid and PCR products were digested with restriction enzymes EcoR I and Kpn I, and the linear plasmid was recovered according to the protocol of the gel recovery Kit (OMEGA Bio-Tek Co.) and AgaZ537 gene was purified according to the protocol of the Cycle-Pure Kit (OMEGA Bio-Tek Co.). The linearized plasmid and the AgaZ537 gene are connected by using T4 DNA ligase, and the connection system is as follows: linearizing the pProEXHTa plasmid, 8. Mu.L; agaZ537 gene, 2 μl; t4 DNA Ligase, 1. Mu.L; 10 Xbuffer T4 DNA Liagse, 2. Mu.L; ddH2O was added to 20. Mu.L. The connection conditions are as follows: the connection is carried out at 16℃for 12h.
The recombinant vector pProEXHTa-AgaZ537 after being connected by T4 DNA ligase is transferred into E.coli DH5 alpha competent cells through heat shock transformation (42 ℃,60 s), cultured for 12h at 37 ℃ on LB solid plates containing 100 mug/mL ampicillin sodium, mutant positive transformants are screened by PCR on LB solid plate growth strains, the positive transformants are inoculated into 20mL LB liquid medium and cultured for 10h at 160rpm at 37 ℃, plasmid extraction is carried out by using Plasmid Mini Kit (OMEGA Bio-Tek Co., LTD), and the wild-type agar recombinant expression vector pProEXHTa-AgaZ537 is obtained.
EXAMPLE 2 cloning of the agarase mutant Gene and construction of vector
Based on big data statistical software alpha fold2 and wild agarase amino acid sequence, predicting three-dimensional structure thereof, analyzing and screening by surface charge and substrate-enzyme interaction of the wild agarase amino acid sequence, and influencing the thermal stability of the wild agarase to obtain the key amino acid Glu 122 According to the structure prediction result and the substrate-enzyme interaction analysis, foldX is utilized to calculate gibbs free energy of wild agarase and agarase mutant, and delta G is taken<Mutants of 0.5kJ/mol, glu respectively 122 Mutant to Trp 122 (E122W)、Val 122 (E122V)、Arg 122 (E122R)、Leu 122 (E122L)、Asn 122 (E122N)、Gln 122 (E122Q)、 IlE 122 (E122I). Referring to the codon preference of the strain, a mutation primer is designed by using CE Design V1.04 and is shown as SEQ ID NO.19-SEQ ID NO. 32:
E122W-F：CAATGACTGGCGAGAGATAGATGTGCTCGAGGT(SEQ ID NO.19)
E122W-R：TCTCTCGCCAGTCATTGTCACTTAGCAGCCAAAA(SEQ ID NO.20)
E122V-F：CAATGACGTTCGAGAGATAGATGTGCTCGAGGT(SEQ ID NO.21)
E122V-R：TCTCTCGAACGTCATTGTCACTTAGCAGCCAAAA(SEQ ID NO.22)
E122R-F：CAATGACCGTCGAGAGATAGATGTGCTCGAGGT(SEQ ID NO.23)
E122R-R：TCTCTCGACGGTCATTGTCACTTAGCAGCCAAAA(SEQ ID NO.24)
E122L-F：CAATGACCTGCGAGAGATAGATGTGCTCGAGGT(SEQ ID NO.25)
E122L-R：TCTCTCGCAGGTCATTGTCACTTAGCAGCCAAAA(SEQ ID NO.26)
E122N-F：CAATGACAATCGAGAGATAGATGTGCTCGAGGT(SEQ ID NO.27)
E122N-R：TCTCTCGATTGTCATTGTCACTTAGCAGCCAAAA(SEQ ID NO.28)
E122Q-F：CAATGACCAGCGAGAGATAGATGTGCTCGAGGT(SEQ ID NO.29)
E122Q-R：TCTCTCGCTGGTCATTGTCACTTAGCAGCCAAAA(SEQ ID NO.30)
E122I-F：CAATGACATTCGAGAGATAGATGTGCTCGAGGT(SEQ ID NO.31)
E122I-R：TCTCTCGAATGTCATTGTCACTTAGCAGCCAAAA(SEQ ID NO.32)
the full length of an expression vector is amplified by PCR by using a wild agarase recombinant vector pProEXHTa-AgaZ537 as a template and using primers SEQ ID NO.19-SEQ ID NO.32, and a 50 mu L amplification reaction system is constructed: plasmid DNA template, 1. Mu.L; 2X Phanta Max Buffer, 25. Mu.L; dNTP Mix (10 mM each), 1. Mu.L; f (10. Mu.M), 2. Mu.L; r (10. Mu.M), 2. Mu.L; phanta Max Super-Fidelity DNA Polymerase,1 μl; ddH 2 O, make up to 50. Mu.L. The PCR amplification procedure was: pre-denaturation at 95℃for 3min, denaturation at 95℃for 15s, annealing at 61℃for 30s, extension at 72℃for 4min, cyclic amplification for 35 times, and final extension at 72℃for 5min.
The PCR product is subjected to enzymolysis for 2 hours at 37 ℃ by using Dpn I enzyme to digest a wild agarase recombinant expression vector template, wherein a digestion system is as follows: PCR product, 50. Mu.L; dpn I, 2. Mu.L; fastdigest Buffer,6 μl; ddH 2 O, make up to 60. Mu.L. The digests were purified according to the Cycle-Pure Kit (OMEGA Bio-Tek Co.) protocol.
The purified product was worked up according toII One Step Cloning Kit (Northenan) kit instructions for performing a seamless cloning ligation, the seamless cloning ligation system being: purifying the product, 5 μl;5 XCE II Buffer, 4. Mu.L; exnase II, 2. Mu.L; ddH 2 O, make up to 20. Mu.L. The seamless cloning connection conditions are as follows: 37℃for 30min.
Transferring the recombinant vector after seamless cloning connection into E.coli DH5 alpha competent cells through heat shock transformation (42 ℃ for 60 s), culturing for 12h at 37 ℃ on LB solid plate containing 100 mug/mL ampicillin, screening mutant positive transformants through PCR (polymerase chain reaction) on LB solid plate growth strain, sequencing and identifying PCR products, wherein the nucleotide sequence of the mutant is shown as SEQ ID NO.10-16, and the amino acid sequence of the corresponding mutant is shown as SEQ ID NO.2-SEQ ID NO. 8. The mutant positive transformants were inoculated into LB liquid medium containing 100. Mu.g/mL ampicillin sodium at 37℃and cultured at 160rpm for 10 hours, and Plasmid extraction was performed using Plasmid Mini Kit (OMEGA Bio-Tek Co.) to obtain recombinant expression vectors pProEXHTa-E122W, pProEXHTa-E122V, pProEXHTa-E122R, pProEXHTa-E122L, pProEXHTa-E122N, pProEXHTa-E122Q and pProEXHTa-E122I.
TABLE 1 mutant amino acid sequences
EXAMPLE 3 preparation of agarase mutant
Recombinant cell construction
Wild-type agarase recombinant expression vectors pProEXHTa-AgaZ537 and recombinant mutant expression vectors pProEXHTa-E122W, pProEXHTa-E122V, pProEXHTa-E122R, pProEXHTa-E122L, pProEXHTa-E122N, pProEXHTa-E122Q and pProEXHTa-E122I were transformed by heat shock (42 ℃ C., 60 s) into E.coli BL21 (DE 3) competent cells, cultured on LB solid plates containing 100. Mu.g/mL ampicillin sodium at 37 ℃ for 12h, and wild-type agarase recombinant cells BL21 (DE 3) -pProEXHTa-AgaZ537 and agarase mutant recombinant cells BL21 (DE 3) -pProEXHTa-E122W, BL (DE 3) -pProEXHTa-E122V, BL (DE 3) -pProEXHTa-E122R, BL (DE 3) -pProEXHTa-E122 9721 (DE 3) -pEXa-E122N, BL (pEXHTa-E3) -pEXHTa-E122I were selected by PCR.
Shaking flask fermentation
The wild recombinant cells and the mutant recombinant cells are respectively inoculated into LB liquid culture medium containing 100 mug/mL ampicillin sodium, and cultured for 10 hours at 37 ℃ and 160r/min to obtain seed liquid. Then inoculating the seed solution into LB liquid medium containing 100 μg/mL ampicillin sodium according to 2% inoculum size, culturing at 37deg.C and 160r/min to OD 600 When the concentration is approximately equal to 0.6-0.8, isopropyl-beta-D-thiogalactoside (IPTG) with the final concentration of 1mM is added for induction, and fermentation culture is carried out for 36 hours at 28 ℃ and 160rpm, thus obtaining wild type agarase fermentation broth (1) and agarase mutant fermentation broth (7).
Respectively centrifuging the wild type agarase fermentation liquor and the agarase mutant fermentation liquor at 4 ℃ for 10min at 8000r/min, collecting thalli, washing thalli with a Phosphate Buffer Solution (PBS) with pH of 7.5 and 20mM, then re-suspending thalli with the PBS buffer solution with the same volume of fermentation liquor, crushing cells in ice bath, centrifuging the crushed thalli at 4 ℃ for 10min at 8000r/min, and collecting supernatant. The enzyme activity was measured according to the enzyme activity measurement method, and the enzyme activity results are shown in Table 2. The enzyme activity of the wild agarase WT (AgaZ 537) is 3320U/mL, the enzyme activity of the mutant is 4410U/mL-4880U/mL, which is improved by 32.8% -47.0% compared with the enzyme activity of the wild agarase, wherein the enzyme activity of the mutant E122W is 4880U/mL at most, which is improved by 47% compared with the wild agarase. The result shows that the enzyme activity of the agarase mutant can be improved through rational design.
TABLE 2 enzyme activities of agarase mutants
| Agarase | Enzyme activity (U/mL) |
| WT(AgaZ537) | 3320 |
| E122W | 4880 |
| E122V | 4460 |
| E122R | 4720 |
| E122L | 4410 |
| E122N | 4690 |
| E122Q | 4550 |
| E122I | 4630 |
Fermentation in fermentation tank
BL21 (DE 3) -pProEXHTa-E122W was inoculated into LB liquid medium containing 100. Mu.g/mL ampicillin sodium, and cultured at 37℃for 10 hours at 160r/min to obtain a seed solution. Inoculating into 5L fermentation tank containing 2L fermentation medium according to 2% inoculum size, controlling culture temperature at 37deg.C, pH7.2, aeration rate at 2vvm, controlling dissolved oxygen at 20-30% and related to rotation speed, feeding culture medium to fermentation liquor OD after sugar in initial culture medium is exhausted 600 When the concentration is about 15, IPTG with the final concentration of 1Mm is added, the temperature is regulated to 28 ℃, and the fermentation is stopped when the concentration of the thallus is unchanged. Centrifuging the fermentation liquid at 4deg.C and 8000r/min for 10min, collecting thallus, washing thallus with buffer solution with pH=7.5 and 20mM PBS, re-suspending thallus with PBS buffer solution with the same volume of fermentation liquid, crushing cells in ice bath, and collecting the crushed thallus in ice bathCentrifuging at 4 ℃ for 10min at 8000r/min, and collecting supernatant. The enzyme activity is measured according to an enzyme activity measuring method, and the enzyme activity of the mutant BL21 (DE 3) -pProEXHTa-E122W is 36600U/mL.
EXAMPLE 4 temperature stability of agarase mutant
Performing preliminary separation and purification on the thallus supernatants (8 types in total) of the shake flask fermentation in the embodiment 3 by nickel column affinity chromatography respectively, and collecting preliminary separation and purification products; then using QFF-Purifying the primary purified product again by Fast Flow chromatographic column (GE company), performing linear gradient elution (sodium chloride concentration: 0-1 mol/L) by using PBS buffer solution with pH of 7.5 and 20mM, and collecting the active component of agarase; purifying with SephadexG75 gel column (GE), and collecting active protein component to obtain purified agarase.
The purified wild agarase and the agarase mutant are regulated to the same enzyme activity, the temperature is kept at 40 ℃ and 45 ℃ for 1 hour respectively, the enzyme activity is measured according to an enzyme activity measuring method, the enzyme activity which is not subjected to temperature treatment is defined as 100%, the relative enzyme activity is shown as a graph, the experimental result is shown in the attached figure 1, and the result shows that the wild agarase and the agarase mutant have good stability at 40 ℃ and 45 ℃ and the relative enzyme activity is kept at more than 50% for 1 hour, and the temperature stability at 50 ℃ is reduced. The temperature stability of the agarase mutant is better than that of the wild agarase in the range of 40-50 ℃, for example, the relative enzyme activity of the wild agarase is 52.75% at 45 ℃, and the relative enzyme activity of the agarase mutant is 55.54-79.75%. The mutant E122W has best temperature stability, the relative enzyme activities at 40 ℃,45 ℃ and 50 ℃ are respectively 97.22%,79.75% and 55.15%, and the relative enzyme activities of the wild agarase are respectively 131%,151% and 276%, which shows that the higher the temperature is, the more obvious the temperature stability advantage of the mutant is.
Further preserving the heat of the purified wild agarase and the agarase mutant at 45 ℃ for 360 minutes respectively, sampling every 60 minutes, measuring the enzyme activity according to an enzyme activity measuring method, defining the enzyme activity which is not subjected to temperature treatment as 100 percent, and plotting the relative enzyme activity, and obtaining the resultsFIG. 2 shows that the mutant has better stability at 45℃than the wild-type agarase, with mutant E122W being the best. The heat inactivation kinetic parameters of agarase were calculated according to the Arrhenius equation: inactivation rate constant (k) and half-life (t 1/2 ) The results are shown in Table 3, the half-life of the wild agarase is 68.61min at 45 ℃, the half-life of the agarase mutant is higher than that of the wild agarase at 45 ℃, the half-life is 73.72 min-88.85 min and is 1.1-1.3 times of that of the wild agarase, and the half-life is longest and is mutant E122W.
TABLE 3 dynamic parameters of heat inactivation of agarase
| Agarase | k/min -1 | t 1/2 /min |
| WT(AgaZ537) | 0.0101 | 68.61 |
| E122W | 0.0078 | 88.85 |
| E122V | 0.0086 | 80.58 |
| E122R | 0.0081 | 85.56 |
| E122L | 0.0094 | 73.72 |
| E122N | 0.0083 | 83.49 |
| E122Q | 00085 | 81.53 |
| E122I | 0.0079 | 87.72 |
EXAMPLE 5 preparation of agar oligosaccharides by degradation of agar by the agarase mutant
Preparing 1L of 0.5% agar solution by purified water, heating to 95-100 ℃ until the agar is completely dissolved, cooling and preserving heat to 42+/-1 ℃, adjusting pH to 7.5, adding purified agarase mutant E122W according to the enzyme adding amount of 1U:50mg, preserving heat and reacting for 6 hours at 42+/-1 ℃, heating to 95-100 ℃, preserving heat for 10 minutes, inactivating enzyme 8000r/min, centrifuging for 10 minutes, and collecting supernatant. Adding 2 times of absolute ethyl alcohol into the supernatant, standing to precipitate undegraded macromolecular agar, centrifuging for 10min at 8000r/min, collecting supernatant, continuously adding 6 times of absolute ethyl alcohol into the supernatant to 8 times of absolute ethyl alcohol, and drying to obtain an agar oligosaccharide sample. 3.42g of dry agar oligosaccharide sample is prepared together, and the product yield is 68.4%.
ESI-MS analysis is carried out on the enzymolysis product, and a negative ion ionization mode is adopted, so that the mass-nuclear ratio (m/z) of a scanning range is adopted: 100-3000, the mass spectrum is shown in figure 3, and ESI-MS scanning results show that: four ion peaks of 629.2, 665.2, 935.3 and 971.4 mainly exist in a sample subjected to enzymolysis for 6 hours, and represent agaragar tetrasaccharide (m/z: 629.2), agaragar tetrasaccharide chloride (m/z: 665.2), agaragar hexasaccharide (m/z: 935.3) and agaragar hexasaccharide chloride (m/z: 971.4) respectively, which indicates that the agarase mutant degrades the agaragar to produce the agaragar oligosaccharide with the agaragar tetrasaccharide and the agaragar hexasaccharide as main components.
The agaro-oligosaccharide and the neoagaro-oligosaccharide have different reducing ends, and the product can be judged to be the agaro-oligosaccharide or the neoagaro-oligosaccharide by analyzing the chemical shift of the C1 position of the heterohead of the reducing end of the agaro-oligosaccharide. Agar oligosaccharides 13 The C nuclear magnetic analysis (NMR) spectrum is shown in figure 4, the shift peaks appearing at 92.17ppm and 96.16ppm at C1 position can be seen in the spectrum, the chemical shift of the anomer alpha-D-galactose and beta-D-galactose C1 position in the D-galactosyl at the reducing terminal is represented, the fact that the agarase mutant degrades the agarase to produce new agarase with D-galactose as the reducing terminal is shown, the agarase mutant acts with beta-1, 4 glycosidic bond to produce new agarase with D-galactose as the reducing terminal, and the agarase mutant is beta-agarase.
The above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be apparent to one skilled in the art that modifications may be made to the technical solutions described in the foregoing embodiments, or equivalents may be substituted for some of the technical features thereof; such modifications and substitutions do not depart from the spirit and scope of the corresponding technical solutions.
Sequence listing
<110> Qingdao sea biological medicine institute Co., ltd
<120> agarase mutant and coding gene and application thereof
<160> 32
<170> SIPOSequenceListing 1.0
<210> 1
<211> 426
<212> PRT
<213> Pseudoalteromonas sp.
<400> 1
Asn Asp Trp Asp Ser Ile Pro Leu Pro Val Thr Pro Gly Asp Gly Lys
1 5 10 15
Val Trp Gln Leu Gln Glu Thr Tyr Ser Asp Ser Phe Asn Tyr Thr Gly
20 25 30
Lys Pro Ala Ala Phe Thr Ser Lys Trp Asn Asp Thr Tyr Phe Asn Ser
35 40 45
Trp Thr Gly Pro Gly Leu Thr Tyr Trp Gln Gln Asp Glu Ser Trp Val
50 55 60
Ser Asp Gly Asn Leu Ile Ile Ser Ala Ser Arg Arg Ala Gly Thr Asp
65 70 75 80
Lys Val Asn Ala Gly Val Ile Thr Ser Lys Thr Lys Val Ser Phe Pro
85 90 95
Ile Phe Leu Glu Ala Asn Ile Lys Val Ser Asn Leu Glu Leu Ser Ser
100 105 110
Asn Phe Trp Leu Leu Ser Asp Asn Asp Glu Arg Glu Ile Asp Val Leu
115 120 125
Glu Val Tyr Gly Gly Ala Arg Asp Asp Trp Phe Ala Lys Asn Met Ser
130 135 140
Thr Asn Phe His Val Phe Ile Arg Asp Gln Gln Ser Asn Gln Ile Ile
145 150 155 160
Ser Asp Tyr Asn Asp Gln Thr His Asn Thr Pro Ser Trp Gly Thr Tyr
165 170 175
Trp Arg Glu Gly Phe His Arg Phe Gly Val Tyr Trp Lys Ser Pro Thr
180 185 190
Glu Val Thr Phe Tyr Ile Asp Gly Gln Gln Thr Pro Asp Gly Ser Trp
195 200 205
Ala Gln Val Val Met Lys Asp Lys Asp Tyr Thr Gly Ala Thr Leu Asn
210 215 220
Lys Asn Thr His Asn Met Asp Gln Ser Ala Tyr Ile Ile Ile Asp Thr
225 230 235 240
Glu Asp His Asp Trp Arg Ser Glu Ala Gly Asn Ile Ala Thr Asp Ala
245 250 255
Asp Leu Ala Asp Gly Ser Lys Asn Lys Met Tyr Val Asp Trp Val Arg
260 265 270
Val Tyr Lys Pro Val Asn Ala Ser Asn Thr Asn Ser Val Ser Asn Gly
275 280 285
Ala Gln Ile Lys Ala Lys His Ser Gln Lys Cys Ile Asp Ile Thr Ala
290 295 300
Gly Ala Met Ser Asn Gly Ser Tyr Tyr Gln Gln Trp Gly Cys Gly Ser
305 310 315 320
Asp Asn Ala Asn Gln Gln Phe Asn Leu Val Glu Leu Ser Asn Asn Glu
325 330 335
Tyr Ala Ile Ser Ser Gln Leu Ser Gly Leu Cys Met Gln Ile Glu Asn
340 345 350
Ala Ser Thr Ser Asn Gly Ala Lys Leu Glu Gln Trp Val Cys Asp His
355 360 365
Ala Lys Ala Ser Gln Arg Phe Thr Leu Asn Ser Thr Gly Asp Gly Tyr
370 375 380
Phe Glu Leu Lys Ser Ser Leu Ser Asn Lys Cys Val Asp Ile Ala Gly
385 390 395 400
Lys Leu Gln Thr Asp Gly Ala Asp Ile Val Gln Trp Gln Cys Tyr Asn
405 410 415
Gly Asp Asn Gln Arg Phe Gln Phe Ile Glu
420 425
<210> 2
<211> 426
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Asn Asp Trp Asp Ser Ile Pro Leu Pro Val Thr Pro Gly Asp Gly Lys
1 5 10 15
Val Trp Gln Leu Gln Glu Thr Tyr Ser Asp Ser Phe Asn Tyr Thr Gly
20 25 30
Lys Pro Ala Ala Phe Thr Ser Lys Trp Asn Asp Thr Tyr Phe Asn Ser
35 40 45
Trp Thr Gly Pro Gly Leu Thr Tyr Trp Gln Gln Asp Glu Ser Trp Val
50 55 60
Ser Asp Gly Asn Leu Ile Ile Ser Ala Ser Arg Arg Ala Gly Thr Asp
65 70 75 80
Lys Val Asn Ala Gly Val Ile Thr Ser Lys Thr Lys Val Ser Phe Pro
85 90 95
Ile Phe Leu Glu Ala Asn Ile Lys Val Ser Asn Leu Glu Leu Ser Ser
100 105 110
Asn Phe Trp Leu Leu Ser Asp Asn Asp Trp Arg Glu Ile Asp Val Leu
115 120 125
Glu Val Tyr Gly Gly Ala Arg Asp Asp Trp Phe Ala Lys Asn Met Ser
130 135 140
Thr Asn Phe His Val Phe Ile Arg Asp Gln Gln Ser Asn Gln Ile Ile
145 150 155 160
Ser Asp Tyr Asn Asp Gln Thr His Asn Thr Pro Ser Trp Gly Thr Tyr
165 170 175
Trp Arg Glu Gly Phe His Arg Phe Gly Val Tyr Trp Lys Ser Pro Thr
180 185 190
Glu Val Thr Phe Tyr Ile Asp Gly Gln Gln Thr Pro Asp Gly Ser Trp
195 200 205
Ala Gln Val Val Met Lys Asp Lys Asp Tyr Thr Gly Ala Thr Leu Asn
210 215 220
Lys Asn Thr His Asn Met Asp Gln Ser Ala Tyr Ile Ile Ile Asp Thr
225 230 235 240
Glu Asp His Asp Trp Arg Ser Glu Ala Gly Asn Ile Ala Thr Asp Ala
245 250 255
Asp Leu Ala Asp Gly Ser Lys Asn Lys Met Tyr Val Asp Trp Val Arg
260 265 270
Val Tyr Lys Pro Val Asn Ala Ser Asn Thr Asn Ser Val Ser Asn Gly
275 280 285
Ala Gln Ile Lys Ala Lys His Ser Gln Lys Cys Ile Asp Ile Thr Ala
290 295 300
Gly Ala Met Ser Asn Gly Ser Tyr Tyr Gln Gln Trp Gly Cys Gly Ser
305 310 315 320
Asp Asn Ala Asn Gln Gln Phe Asn Leu Val Glu Leu Ser Asn Asn Glu
325 330 335
Tyr Ala Ile Ser Ser Gln Leu Ser Gly Leu Cys Met Gln Ile Glu Asn
340 345 350
Ala Ser Thr Ser Asn Gly Ala Lys Leu Glu Gln Trp Val Cys Asp His
355 360 365
Ala Lys Ala Ser Gln Arg Phe Thr Leu Asn Ser Thr Gly Asp Gly Tyr
370 375 380
Phe Glu Leu Lys Ser Ser Leu Ser Asn Lys Cys Val Asp Ile Ala Gly
385 390 395 400
Lys Leu Gln Thr Asp Gly Ala Asp Ile Val Gln Trp Gln Cys Tyr Asn
405 410 415
Gly Asp Asn Gln Arg Phe Gln Phe Ile Glu
420 425
<210> 3
<211> 426
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 3
Asn Asp Trp Asp Ser Ile Pro Leu Pro Val Thr Pro Gly Asp Gly Lys
1 5 10 15
Val Trp Gln Leu Gln Glu Thr Tyr Ser Asp Ser Phe Asn Tyr Thr Gly
20 25 30
Lys Pro Ala Ala Phe Thr Ser Lys Trp Asn Asp Thr Tyr Phe Asn Ser
35 40 45
Trp Thr Gly Pro Gly Leu Thr Tyr Trp Gln Gln Asp Glu Ser Trp Val
50 55 60
Ser Asp Gly Asn Leu Ile Ile Ser Ala Ser Arg Arg Ala Gly Thr Asp
65 70 75 80
Lys Val Asn Ala Gly Val Ile Thr Ser Lys Thr Lys Val Ser Phe Pro
85 90 95
Ile Phe Leu Glu Ala Asn Ile Lys Val Ser Asn Leu Glu Leu Ser Ser
100 105 110
Asn Phe Trp Leu Leu Ser Asp Asn Asp Val Arg Glu Ile Asp Val Leu
115 120 125
Glu Val Tyr Gly Gly Ala Arg Asp Asp Trp Phe Ala Lys Asn Met Ser
130 135 140
Thr Asn Phe His Val Phe Ile Arg Asp Gln Gln Ser Asn Gln Ile Ile
145 150 155 160
Ser Asp Tyr Asn Asp Gln Thr His Asn Thr Pro Ser Trp Gly Thr Tyr
165 170 175
Trp Arg Glu Gly Phe His Arg Phe Gly Val Tyr Trp Lys Ser Pro Thr
180 185 190
Glu Val Thr Phe Tyr Ile Asp Gly Gln Gln Thr Pro Asp Gly Ser Trp
195 200 205
Ala Gln Val Val Met Lys Asp Lys Asp Tyr Thr Gly Ala Thr Leu Asn
210 215 220
Lys Asn Thr His Asn Met Asp Gln Ser Ala Tyr Ile Ile Ile Asp Thr
225 230 235 240
Glu Asp His Asp Trp Arg Ser Glu Ala Gly Asn Ile Ala Thr Asp Ala
245 250 255
Asp Leu Ala Asp Gly Ser Lys Asn Lys Met Tyr Val Asp Trp Val Arg
260 265 270
Val Tyr Lys Pro Val Asn Ala Ser Asn Thr Asn Ser Val Ser Asn Gly
275 280 285
Ala Gln Ile Lys Ala Lys His Ser Gln Lys Cys Ile Asp Ile Thr Ala
290 295 300
Gly Ala Met Ser Asn Gly Ser Tyr Tyr Gln Gln Trp Gly Cys Gly Ser
305 310 315 320
Asp Asn Ala Asn Gln Gln Phe Asn Leu Val Glu Leu Ser Asn Asn Glu
325 330 335
Tyr Ala Ile Ser Ser Gln Leu Ser Gly Leu Cys Met Gln Ile Glu Asn
340 345 350
Ala Ser Thr Ser Asn Gly Ala Lys Leu Glu Gln Trp Val Cys Asp His
355 360 365
Ala Lys Ala Ser Gln Arg Phe Thr Leu Asn Ser Thr Gly Asp Gly Tyr
370 375 380
Phe Glu Leu Lys Ser Ser Leu Ser Asn Lys Cys Val Asp Ile Ala Gly
385 390 395 400
Lys Leu Gln Thr Asp Gly Ala Asp Ile Val Gln Trp Gln Cys Tyr Asn
405 410 415
Gly Asp Asn Gln Arg Phe Gln Phe Ile Glu
420 425
<210> 4
<211> 426
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 4
Asn Asp Trp Asp Ser Ile Pro Leu Pro Val Thr Pro Gly Asp Gly Lys
1 5 10 15
Val Trp Gln Leu Gln Glu Thr Tyr Ser Asp Ser Phe Asn Tyr Thr Gly
20 25 30
Lys Pro Ala Ala Phe Thr Ser Lys Trp Asn Asp Thr Tyr Phe Asn Ser
35 40 45
Trp Thr Gly Pro Gly Leu Thr Tyr Trp Gln Gln Asp Glu Ser Trp Val
50 55 60
Ser Asp Gly Asn Leu Ile Ile Ser Ala Ser Arg Arg Ala Gly Thr Asp
65 70 75 80
Lys Val Asn Ala Gly Val Ile Thr Ser Lys Thr Lys Val Ser Phe Pro
85 90 95
Ile Phe Leu Glu Ala Asn Ile Lys Val Ser Asn Leu Glu Leu Ser Ser
100 105 110
Asn Phe Trp Leu Leu Ser Asp Asn Asp Arg Arg Glu Ile Asp Val Leu
115 120 125
Glu Val Tyr Gly Gly Ala Arg Asp Asp Trp Phe Ala Lys Asn Met Ser
130 135 140
Thr Asn Phe His Val Phe Ile Arg Asp Gln Gln Ser Asn Gln Ile Ile
145 150 155 160
Ser Asp Tyr Asn Asp Gln Thr His Asn Thr Pro Ser Trp Gly Thr Tyr
165 170 175
Trp Arg Glu Gly Phe His Arg Phe Gly Val Tyr Trp Lys Ser Pro Thr
180 185 190
Glu Val Thr Phe Tyr Ile Asp Gly Gln Gln Thr Pro Asp Gly Ser Trp
195 200 205
Ala Gln Val Val Met Lys Asp Lys Asp Tyr Thr Gly Ala Thr Leu Asn
210 215 220
Lys Asn Thr His Asn Met Asp Gln Ser Ala Tyr Ile Ile Ile Asp Thr
225 230 235 240
Glu Asp His Asp Trp Arg Ser Glu Ala Gly Asn Ile Ala Thr Asp Ala
245 250 255
Asp Leu Ala Asp Gly Ser Lys Asn Lys Met Tyr Val Asp Trp Val Arg
260 265 270
Val Tyr Lys Pro Val Asn Ala Ser Asn Thr Asn Ser Val Ser Asn Gly
275 280 285
Ala Gln Ile Lys Ala Lys His Ser Gln Lys Cys Ile Asp Ile Thr Ala
290 295 300
Gly Ala Met Ser Asn Gly Ser Tyr Tyr Gln Gln Trp Gly Cys Gly Ser
305 310 315 320
Asp Asn Ala Asn Gln Gln Phe Asn Leu Val Glu Leu Ser Asn Asn Glu
325 330 335
Tyr Ala Ile Ser Ser Gln Leu Ser Gly Leu Cys Met Gln Ile Glu Asn
340 345 350
Ala Ser Thr Ser Asn Gly Ala Lys Leu Glu Gln Trp Val Cys Asp His
355 360 365
Ala Lys Ala Ser Gln Arg Phe Thr Leu Asn Ser Thr Gly Asp Gly Tyr
370 375 380
Phe Glu Leu Lys Ser Ser Leu Ser Asn Lys Cys Val Asp Ile Ala Gly
385 390 395 400
Lys Leu Gln Thr Asp Gly Ala Asp Ile Val Gln Trp Gln Cys Tyr Asn
405 410 415
Gly Asp Asn Gln Arg Phe Gln Phe Ile Glu
420 425
<210> 5
<211> 426
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 5
Asn Asp Trp Asp Ser Ile Pro Leu Pro Val Thr Pro Gly Asp Gly Lys
1 5 10 15
Val Trp Gln Leu Gln Glu Thr Tyr Ser Asp Ser Phe Asn Tyr Thr Gly
20 25 30
Lys Pro Ala Ala Phe Thr Ser Lys Trp Asn Asp Thr Tyr Phe Asn Ser
35 40 45
Trp Thr Gly Pro Gly Leu Thr Tyr Trp Gln Gln Asp Glu Ser Trp Val
50 55 60
Ser Asp Gly Asn Leu Ile Ile Ser Ala Ser Arg Arg Ala Gly Thr Asp
65 70 75 80
Lys Val Asn Ala Gly Val Ile Thr Ser Lys Thr Lys Val Ser Phe Pro
85 90 95
Ile Phe Leu Glu Ala Asn Ile Lys Val Ser Asn Leu Glu Leu Ser Ser
100 105 110
Asn Phe Trp Leu Leu Ser Asp Asn Asp Leu Arg Glu Ile Asp Val Leu
115 120 125
Glu Val Tyr Gly Gly Ala Arg Asp Asp Trp Phe Ala Lys Asn Met Ser
130 135 140
Thr Asn Phe His Val Phe Ile Arg Asp Gln Gln Ser Asn Gln Ile Ile
145 150 155 160
Ser Asp Tyr Asn Asp Gln Thr His Asn Thr Pro Ser Trp Gly Thr Tyr
165 170 175
Trp Arg Glu Gly Phe His Arg Phe Gly Val Tyr Trp Lys Ser Pro Thr
180 185 190
Glu Val Thr Phe Tyr Ile Asp Gly Gln Gln Thr Pro Asp Gly Ser Trp
195 200 205
Ala Gln Val Val Met Lys Asp Lys Asp Tyr Thr Gly Ala Thr Leu Asn
210 215 220
Lys Asn Thr His Asn Met Asp Gln Ser Ala Tyr Ile Ile Ile Asp Thr
225 230 235 240
Glu Asp His Asp Trp Arg Ser Glu Ala Gly Asn Ile Ala Thr Asp Ala
245 250 255
Asp Leu Ala Asp Gly Ser Lys Asn Lys Met Tyr Val Asp Trp Val Arg
260 265 270
Val Tyr Lys Pro Val Asn Ala Ser Asn Thr Asn Ser Val Ser Asn Gly
275 280 285
Ala Gln Ile Lys Ala Lys His Ser Gln Lys Cys Ile Asp Ile Thr Ala
290 295 300
Gly Ala Met Ser Asn Gly Ser Tyr Tyr Gln Gln Trp Gly Cys Gly Ser
305 310 315 320
Asp Asn Ala Asn Gln Gln Phe Asn Leu Val Glu Leu Ser Asn Asn Glu
325 330 335
Tyr Ala Ile Ser Ser Gln Leu Ser Gly Leu Cys Met Gln Ile Glu Asn
340 345 350
Ala Ser Thr Ser Asn Gly Ala Lys Leu Glu Gln Trp Val Cys Asp His
355 360 365
Ala Lys Ala Ser Gln Arg Phe Thr Leu Asn Ser Thr Gly Asp Gly Tyr
370 375 380
Phe Glu Leu Lys Ser Ser Leu Ser Asn Lys Cys Val Asp Ile Ala Gly
385 390 395 400
Lys Leu Gln Thr Asp Gly Ala Asp Ile Val Gln Trp Gln Cys Tyr Asn
405 410 415
Gly Asp Asn Gln Arg Phe Gln Phe Ile Glu
420 425
<210> 6
<211> 426
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 6
Asn Asp Trp Asp Ser Ile Pro Leu Pro Val Thr Pro Gly Asp Gly Lys
1 5 10 15
Val Trp Gln Leu Gln Glu Thr Tyr Ser Asp Ser Phe Asn Tyr Thr Gly
20 25 30
Lys Pro Ala Ala Phe Thr Ser Lys Trp Asn Asp Thr Tyr Phe Asn Ser
35 40 45
Trp Thr Gly Pro Gly Leu Thr Tyr Trp Gln Gln Asp Glu Ser Trp Val
50 55 60
Ser Asp Gly Asn Leu Ile Ile Ser Ala Ser Arg Arg Ala Gly Thr Asp
65 70 75 80
Lys Val Asn Ala Gly Val Ile Thr Ser Lys Thr Lys Val Ser Phe Pro
85 90 95
Ile Phe Leu Glu Ala Asn Ile Lys Val Ser Asn Leu Glu Leu Ser Ser
100 105 110
Asn Phe Trp Leu Leu Ser Asp Asn Asp Asn Arg Glu Ile Asp Val Leu
115 120 125
Glu Val Tyr Gly Gly Ala Arg Asp Asp Trp Phe Ala Lys Asn Met Ser
130 135 140
Thr Asn Phe His Val Phe Ile Arg Asp Gln Gln Ser Asn Gln Ile Ile
145 150 155 160
Ser Asp Tyr Asn Asp Gln Thr His Asn Thr Pro Ser Trp Gly Thr Tyr
165 170 175
Trp Arg Glu Gly Phe His Arg Phe Gly Val Tyr Trp Lys Ser Pro Thr
180 185 190
Glu Val Thr Phe Tyr Ile Asp Gly Gln Gln Thr Pro Asp Gly Ser Trp
195 200 205
Ala Gln Val Val Met Lys Asp Lys Asp Tyr Thr Gly Ala Thr Leu Asn
210 215 220
Lys Asn Thr His Asn Met Asp Gln Ser Ala Tyr Ile Ile Ile Asp Thr
225 230 235 240
Glu Asp His Asp Trp Arg Ser Glu Ala Gly Asn Ile Ala Thr Asp Ala
245 250 255
Asp Leu Ala Asp Gly Ser Lys Asn Lys Met Tyr Val Asp Trp Val Arg
260 265 270
Val Tyr Lys Pro Val Asn Ala Ser Asn Thr Asn Ser Val Ser Asn Gly
275 280 285
Ala Gln Ile Lys Ala Lys His Ser Gln Lys Cys Ile Asp Ile Thr Ala
290 295 300
Gly Ala Met Ser Asn Gly Ser Tyr Tyr Gln Gln Trp Gly Cys Gly Ser
305 310 315 320
Asp Asn Ala Asn Gln Gln Phe Asn Leu Val Glu Leu Ser Asn Asn Glu
325 330 335
Tyr Ala Ile Ser Ser Gln Leu Ser Gly Leu Cys Met Gln Ile Glu Asn
340 345 350
Ala Ser Thr Ser Asn Gly Ala Lys Leu Glu Gln Trp Val Cys Asp His
355 360 365
Ala Lys Ala Ser Gln Arg Phe Thr Leu Asn Ser Thr Gly Asp Gly Tyr
370 375 380
Phe Glu Leu Lys Ser Ser Leu Ser Asn Lys Cys Val Asp Ile Ala Gly
385 390 395 400
Lys Leu Gln Thr Asp Gly Ala Asp Ile Val Gln Trp Gln Cys Tyr Asn
405 410 415
Gly Asp Asn Gln Arg Phe Gln Phe Ile Glu
420 425
<210> 7
<211> 426
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 7
Asn Asp Trp Asp Ser Ile Pro Leu Pro Val Thr Pro Gly Asp Gly Lys
1 5 10 15
Val Trp Gln Leu Gln Glu Thr Tyr Ser Asp Ser Phe Asn Tyr Thr Gly
20 25 30
Lys Pro Ala Ala Phe Thr Ser Lys Trp Asn Asp Thr Tyr Phe Asn Ser
35 40 45
Trp Thr Gly Pro Gly Leu Thr Tyr Trp Gln Gln Asp Glu Ser Trp Val
50 55 60
Ser Asp Gly Asn Leu Ile Ile Ser Ala Ser Arg Arg Ala Gly Thr Asp
65 70 75 80
Lys Val Asn Ala Gly Val Ile Thr Ser Lys Thr Lys Val Ser Phe Pro
85 90 95
Ile Phe Leu Glu Ala Asn Ile Lys Val Ser Asn Leu Glu Leu Ser Ser
100 105 110
Asn Phe Trp Leu Leu Ser Asp Asn Asp Gln Arg Glu Ile Asp Val Leu
115 120 125
Glu Val Tyr Gly Gly Ala Arg Asp Asp Trp Phe Ala Lys Asn Met Ser
130 135 140
Thr Asn Phe His Val Phe Ile Arg Asp Gln Gln Ser Asn Gln Ile Ile
145 150 155 160
Ser Asp Tyr Asn Asp Gln Thr His Asn Thr Pro Ser Trp Gly Thr Tyr
165 170 175
Trp Arg Glu Gly Phe His Arg Phe Gly Val Tyr Trp Lys Ser Pro Thr
180 185 190
Glu Val Thr Phe Tyr Ile Asp Gly Gln Gln Thr Pro Asp Gly Ser Trp
195 200 205
Ala Gln Val Val Met Lys Asp Lys Asp Tyr Thr Gly Ala Thr Leu Asn
210 215 220
Lys Asn Thr His Asn Met Asp Gln Ser Ala Tyr Ile Ile Ile Asp Thr
225 230 235 240
Glu Asp His Asp Trp Arg Ser Glu Ala Gly Asn Ile Ala Thr Asp Ala
245 250 255
Asp Leu Ala Asp Gly Ser Lys Asn Lys Met Tyr Val Asp Trp Val Arg
260 265 270
Val Tyr Lys Pro Val Asn Ala Ser Asn Thr Asn Ser Val Ser Asn Gly
275 280 285
Ala Gln Ile Lys Ala Lys His Ser Gln Lys Cys Ile Asp Ile Thr Ala
290 295 300
Gly Ala Met Ser Asn Gly Ser Tyr Tyr Gln Gln Trp Gly Cys Gly Ser
305 310 315 320
Asp Asn Ala Asn Gln Gln Phe Asn Leu Val Glu Leu Ser Asn Asn Glu
325 330 335
Tyr Ala Ile Ser Ser Gln Leu Ser Gly Leu Cys Met Gln Ile Glu Asn
340 345 350
Ala Ser Thr Ser Asn Gly Ala Lys Leu Glu Gln Trp Val Cys Asp His
355 360 365
Ala Lys Ala Ser Gln Arg Phe Thr Leu Asn Ser Thr Gly Asp Gly Tyr
370 375 380
Phe Glu Leu Lys Ser Ser Leu Ser Asn Lys Cys Val Asp Ile Ala Gly
385 390 395 400
Lys Leu Gln Thr Asp Gly Ala Asp Ile Val Gln Trp Gln Cys Tyr Asn
405 410 415
Gly Asp Asn Gln Arg Phe Gln Phe Ile Glu
420 425
<210> 8
<211> 426
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 8
Asn Asp Trp Asp Ser Ile Pro Leu Pro Val Thr Pro Gly Asp Gly Lys
1 5 10 15
Val Trp Gln Leu Gln Glu Thr Tyr Ser Asp Ser Phe Asn Tyr Thr Gly
20 25 30
Lys Pro Ala Ala Phe Thr Ser Lys Trp Asn Asp Thr Tyr Phe Asn Ser
35 40 45
Trp Thr Gly Pro Gly Leu Thr Tyr Trp Gln Gln Asp Glu Ser Trp Val
50 55 60
Ser Asp Gly Asn Leu Ile Ile Ser Ala Ser Arg Arg Ala Gly Thr Asp
65 70 75 80
Lys Val Asn Ala Gly Val Ile Thr Ser Lys Thr Lys Val Ser Phe Pro
85 90 95
Ile Phe Leu Glu Ala Asn Ile Lys Val Ser Asn Leu Glu Leu Ser Ser
100 105 110
Asn Phe Trp Leu Leu Ser Asp Asn Asp Ile Arg Glu Ile Asp Val Leu
115 120 125
Glu Val Tyr Gly Gly Ala Arg Asp Asp Trp Phe Ala Lys Asn Met Ser
130 135 140
Thr Asn Phe His Val Phe Ile Arg Asp Gln Gln Ser Asn Gln Ile Ile
145 150 155 160
Ser Asp Tyr Asn Asp Gln Thr His Asn Thr Pro Ser Trp Gly Thr Tyr
165 170 175
Trp Arg Glu Gly Phe His Arg Phe Gly Val Tyr Trp Lys Ser Pro Thr
180 185 190
Glu Val Thr Phe Tyr Ile Asp Gly Gln Gln Thr Pro Asp Gly Ser Trp
195 200 205
Ala Gln Val Val Met Lys Asp Lys Asp Tyr Thr Gly Ala Thr Leu Asn
210 215 220
Lys Asn Thr His Asn Met Asp Gln Ser Ala Tyr Ile Ile Ile Asp Thr
225 230 235 240
Glu Asp His Asp Trp Arg Ser Glu Ala Gly Asn Ile Ala Thr Asp Ala
245 250 255
Asp Leu Ala Asp Gly Ser Lys Asn Lys Met Tyr Val Asp Trp Val Arg
260 265 270
Val Tyr Lys Pro Val Asn Ala Ser Asn Thr Asn Ser Val Ser Asn Gly
275 280 285
Ala Gln Ile Lys Ala Lys His Ser Gln Lys Cys Ile Asp Ile Thr Ala
290 295 300
Gly Ala Met Ser Asn Gly Ser Tyr Tyr Gln Gln Trp Gly Cys Gly Ser
305 310 315 320
Asp Asn Ala Asn Gln Gln Phe Asn Leu Val Glu Leu Ser Asn Asn Glu
325 330 335
Tyr Ala Ile Ser Ser Gln Leu Ser Gly Leu Cys Met Gln Ile Glu Asn
340 345 350
Ala Ser Thr Ser Asn Gly Ala Lys Leu Glu Gln Trp Val Cys Asp His
355 360 365
Ala Lys Ala Ser Gln Arg Phe Thr Leu Asn Ser Thr Gly Asp Gly Tyr
370 375 380
Phe Glu Leu Lys Ser Ser Leu Ser Asn Lys Cys Val Asp Ile Ala Gly
385 390 395 400
Lys Leu Gln Thr Asp Gly Ala Asp Ile Val Gln Trp Gln Cys Tyr Asn
405 410 415
Gly Asp Asn Gln Arg Phe Gln Phe Ile Glu
420 425
<210> 9
<211> 1281
<212> DNA
<213> Pseudoalteromonas sp.
<400> 9
aatgattggg actcaattcc tttaccggtt actcccggtg atggcaaagt ctggcagcta 60
caagaaacat actcagactc atttaattac actggtaaac ctgctgcatt taccagtaaa 120
tggaatgata cttactttaa tagttggaca ggcccaggtt taacctattg gcaacaagat 180
gagtcatggg tttcagacgg caaccttata attagtgctt cgcgtcgtgc tggtacagat 240
aaagttaatg caggggtgat cacctcgaaa acaaaagtta gctttccaat ctttttagaa 300
gcaaacatta aggtaagtaa tctggaatta tcttcaaatt tttggctgct aagtgacaat 360
gacgaacgag agatagatgt gctcgaggta tacggtgggg cacgtgatga ttggtttgct 420
aaaaatatgt cgacgaactt tcatgtgttt attcgtgatc aacaatctaa ccaaataatt 480
agtgattaca atgatcaaac gcataatacg cctagttggg gaacgtattg gcgtgaaggt 540
tttcatcgtt ttggcgtgta ttggaaaagc ccaacagaag tcacatttta cattgatggt 600
cagcaaacgc ctgatggttc gtgggcgcag gtggtgatga aagataaaga ctataccggt 660
gcgacgttaa acaagaacac acataatatg gatcaatccg cttatatcat tattgataca 720
gaagatcacg attggcgttc agaggcggga aatattgcta cagatgccga tttggctgac 780
gggagtaaaa ataaaatgta tgtcgattgg gtgcgagttt ataaacctgt taatgcgtcc 840
aatacaaaca gtgttagtaa tggtgcacag atcaaagcta agcatagtca aaagtgtatt 900
gatataacag ctggcgctat gagtaatggc tcttattatc agcagtgggg ttgtggctct 960
gataatgcta accaacaatt taaccttgtt gagttaagta ataatgaata tgcaattagc 1020
tcacagttaa gtggcttgtg catgcagatt gaaaacgcca gtacaagtaa tggcgctaag 1080
ttggagcagt gggtttgtga tcatgcaaaa gccagtcaac gctttactct caatagcacg 1140
ggtgatggct acttcgagct caaatcaagt ttaagtaata aatgtgttga tatcgcaggt 1200
aaactgcaaa cagatggtgc tgatattgta cagtggcagt gttataacgg cgacaatcaa 1260
cgttttcaat ttattgaata a 1281
<210> 10
<211> 1281
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
aatgattggg actcaattcc tttaccggtt actcccggtg atggcaaagt ctggcagcta 60
caagaaacat actcagactc atttaattac actggtaaac ctgctgcatt taccagtaaa 120
tggaatgata cttactttaa tagttggaca ggcccaggtt taacctattg gcaacaagat 180
gagtcatggg tttcagacgg caaccttata attagtgctt cgcgtcgtgc tggtacagat 240
aaagttaatg caggggtgat cacctcgaaa acaaaagtta gctttccaat ctttttagaa 300
gcaaacatta aggtaagtaa tctggaatta tcttcaaatt tttggctgct aagtgacaat 360
gactggcgag agatagatgt gctcgaggta tacggtgggg cacgtgatga ttggtttgct 420
aaaaatatgt cgacgaactt tcatgtgttt attcgtgatc aacaatctaa ccaaataatt 480
agtgattaca atgatcaaac gcataatacg cctagttggg gaacgtattg gcgtgaaggt 540
tttcatcgtt ttggcgtgta ttggaaaagc ccaacagaag tcacatttta cattgatggt 600
cagcaaacgc ctgatggttc gtgggcgcag gtggtgatga aagataaaga ctataccggt 660
gcgacgttaa acaagaacac acataatatg gatcaatccg cttatatcat tattgataca 720
gaagatcacg attggcgttc agaggcggga aatattgcta cagatgccga tttggctgac 780
gggagtaaaa ataaaatgta tgtcgattgg gtgcgagttt ataaacctgt taatgcgtcc 840
aatacaaaca gtgttagtaa tggtgcacag atcaaagcta agcatagtca aaagtgtatt 900
gatataacag ctggcgctat gagtaatggc tcttattatc agcagtgggg ttgtggctct 960
gataatgcta accaacaatt taaccttgtt gagttaagta ataatgaata tgcaattagc 1020
tcacagttaa gtggcttgtg catgcagatt gaaaacgcca gtacaagtaa tggcgctaag 1080
ttggagcagt gggtttgtga tcatgcaaaa gccagtcaac gctttactct caatagcacg 1140
ggtgatggct acttcgagct caaatcaagt ttaagtaata aatgtgttga tatcgcaggt 1200
aaactgcaaa cagatggtgc tgatattgta cagtggcagt gttataacgg cgacaatcaa 1260
cgttttcaat ttattgaata a 1281
<210> 11
<211> 1281
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
aatgattggg actcaattcc tttaccggtt actcccggtg atggcaaagt ctggcagcta 60
caagaaacat actcagactc atttaattac actggtaaac ctgctgcatt taccagtaaa 120
tggaatgata cttactttaa tagttggaca ggcccaggtt taacctattg gcaacaagat 180
gagtcatggg tttcagacgg caaccttata attagtgctt cgcgtcgtgc tggtacagat 240
aaagttaatg caggggtgat cacctcgaaa acaaaagtta gctttccaat ctttttagaa 300
gcaaacatta aggtaagtaa tctggaatta tcttcaaatt tttggctgct aagtgacaat 360
gacgttcgag agatagatgt gctcgaggta tacggtgggg cacgtgatga ttggtttgct 420
aaaaatatgt cgacgaactt tcatgtgttt attcgtgatc aacaatctaa ccaaataatt 480
agtgattaca atgatcaaac gcataatacg cctagttggg gaacgtattg gcgtgaaggt 540
tttcatcgtt ttggcgtgta ttggaaaagc ccaacagaag tcacatttta cattgatggt 600
cagcaaacgc ctgatggttc gtgggcgcag gtggtgatga aagataaaga ctataccggt 660
gcgacgttaa acaagaacac acataatatg gatcaatccg cttatatcat tattgataca 720
gaagatcacg attggcgttc agaggcggga aatattgcta cagatgccga tttggctgac 780
gggagtaaaa ataaaatgta tgtcgattgg gtgcgagttt ataaacctgt taatgcgtcc 840
aatacaaaca gtgttagtaa tggtgcacag atcaaagcta agcatagtca aaagtgtatt 900
gatataacag ctggcgctat gagtaatggc tcttattatc agcagtgggg ttgtggctct 960
gataatgcta accaacaatt taaccttgtt gagttaagta ataatgaata tgcaattagc 1020
tcacagttaa gtggcttgtg catgcagatt gaaaacgcca gtacaagtaa tggcgctaag 1080
ttggagcagt gggtttgtga tcatgcaaaa gccagtcaac gctttactct caatagcacg 1140
ggtgatggct acttcgagct caaatcaagt ttaagtaata aatgtgttga tatcgcaggt 1200
aaactgcaaa cagatggtgc tgatattgta cagtggcagt gttataacgg cgacaatcaa 1260
cgttttcaat ttattgaata a 1281
<210> 12
<211> 1281
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
aatgattggg actcaattcc tttaccggtt actcccggtg atggcaaagt ctggcagcta 60
caagaaacat actcagactc atttaattac actggtaaac ctgctgcatt taccagtaaa 120
tggaatgata cttactttaa tagttggaca ggcccaggtt taacctattg gcaacaagat 180
gagtcatggg tttcagacgg caaccttata attagtgctt cgcgtcgtgc tggtacagat 240
aaagttaatg caggggtgat cacctcgaaa acaaaagtta gctttccaat ctttttagaa 300
gcaaacatta aggtaagtaa tctggaatta tcttcaaatt tttggctgct aagtgacaat 360
gaccgtcgag agatagatgt gctcgaggta tacggtgggg cacgtgatga ttggtttgct 420
aaaaatatgt cgacgaactt tcatgtgttt attcgtgatc aacaatctaa ccaaataatt 480
agtgattaca atgatcaaac gcataatacg cctagttggg gaacgtattg gcgtgaaggt 540
tttcatcgtt ttggcgtgta ttggaaaagc ccaacagaag tcacatttta cattgatggt 600
cagcaaacgc ctgatggttc gtgggcgcag gtggtgatga aagataaaga ctataccggt 660
gcgacgttaa acaagaacac acataatatg gatcaatccg cttatatcat tattgataca 720
gaagatcacg attggcgttc agaggcggga aatattgcta cagatgccga tttggctgac 780
gggagtaaaa ataaaatgta tgtcgattgg gtgcgagttt ataaacctgt taatgcgtcc 840
aatacaaaca gtgttagtaa tggtgcacag atcaaagcta agcatagtca aaagtgtatt 900
gatataacag ctggcgctat gagtaatggc tcttattatc agcagtgggg ttgtggctct 960
gataatgcta accaacaatt taaccttgtt gagttaagta ataatgaata tgcaattagc 1020
tcacagttaa gtggcttgtg catgcagatt gaaaacgcca gtacaagtaa tggcgctaag 1080
ttggagcagt gggtttgtga tcatgcaaaa gccagtcaac gctttactct caatagcacg 1140
ggtgatggct acttcgagct caaatcaagt ttaagtaata aatgtgttga tatcgcaggt 1200
aaactgcaaa cagatggtgc tgatattgta cagtggcagt gttataacgg cgacaatcaa 1260
cgttttcaat ttattgaata a 1281
<210> 13
<211> 1281
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
aatgattggg actcaattcc tttaccggtt actcccggtg atggcaaagt ctggcagcta 60
caagaaacat actcagactc atttaattac actggtaaac ctgctgcatt taccagtaaa 120
tggaatgata cttactttaa tagttggaca ggcccaggtt taacctattg gcaacaagat 180
gagtcatggg tttcagacgg caaccttata attagtgctt cgcgtcgtgc tggtacagat 240
aaagttaatg caggggtgat cacctcgaaa acaaaagtta gctttccaat ctttttagaa 300
gcaaacatta aggtaagtaa tctggaatta tcttcaaatt tttggctgct aagtgacaat 360
gacctgcgag agatagatgt gctcgaggta tacggtgggg cacgtgatga ttggtttgct 420
aaaaatatgt cgacgaactt tcatgtgttt attcgtgatc aacaatctaa ccaaataatt 480
agtgattaca atgatcaaac gcataatacg cctagttggg gaacgtattg gcgtgaaggt 540
tttcatcgtt ttggcgtgta ttggaaaagc ccaacagaag tcacatttta cattgatggt 600
cagcaaacgc ctgatggttc gtgggcgcag gtggtgatga aagataaaga ctataccggt 660
gcgacgttaa acaagaacac acataatatg gatcaatccg cttatatcat tattgataca 720
gaagatcacg attggcgttc agaggcggga aatattgcta cagatgccga tttggctgac 780
gggagtaaaa ataaaatgta tgtcgattgg gtgcgagttt ataaacctgt taatgcgtcc 840
aatacaaaca gtgttagtaa tggtgcacag atcaaagcta agcatagtca aaagtgtatt 900
gatataacag ctggcgctat gagtaatggc tcttattatc agcagtgggg ttgtggctct 960
gataatgcta accaacaatt taaccttgtt gagttaagta ataatgaata tgcaattagc 1020
tcacagttaa gtggcttgtg catgcagatt gaaaacgcca gtacaagtaa tggcgctaag 1080
ttggagcagt gggtttgtga tcatgcaaaa gccagtcaac gctttactct caatagcacg 1140
ggtgatggct acttcgagct caaatcaagt ttaagtaata aatgtgttga tatcgcaggt 1200
aaactgcaaa cagatggtgc tgatattgta cagtggcagt gttataacgg cgacaatcaa 1260
cgttttcaat ttattgaata a 1281
<210> 14
<211> 1281
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
aatgattggg actcaattcc tttaccggtt actcccggtg atggcaaagt ctggcagcta 60
caagaaacat actcagactc atttaattac actggtaaac ctgctgcatt taccagtaaa 120
tggaatgata cttactttaa tagttggaca ggcccaggtt taacctattg gcaacaagat 180
gagtcatggg tttcagacgg caaccttata attagtgctt cgcgtcgtgc tggtacagat 240
aaagttaatg caggggtgat cacctcgaaa acaaaagtta gctttccaat ctttttagaa 300
gcaaacatta aggtaagtaa tctggaatta tcttcaaatt tttggctgct aagtgacaat 360
gacaatcgag agatagatgt gctcgaggta tacggtgggg cacgtgatga ttggtttgct 420
aaaaatatgt cgacgaactt tcatgtgttt attcgtgatc aacaatctaa ccaaataatt 480
agtgattaca atgatcaaac gcataatacg cctagttggg gaacgtattg gcgtgaaggt 540
tttcatcgtt ttggcgtgta ttggaaaagc ccaacagaag tcacatttta cattgatggt 600
cagcaaacgc ctgatggttc gtgggcgcag gtggtgatga aagataaaga ctataccggt 660
gcgacgttaa acaagaacac acataatatg gatcaatccg cttatatcat tattgataca 720
gaagatcacg attggcgttc agaggcggga aatattgcta cagatgccga tttggctgac 780
gggagtaaaa ataaaatgta tgtcgattgg gtgcgagttt ataaacctgt taatgcgtcc 840
aatacaaaca gtgttagtaa tggtgcacag atcaaagcta agcatagtca aaagtgtatt 900
gatataacag ctggcgctat gagtaatggc tcttattatc agcagtgggg ttgtggctct 960
gataatgcta accaacaatt taaccttgtt gagttaagta ataatgaata tgcaattagc 1020
tcacagttaa gtggcttgtg catgcagatt gaaaacgcca gtacaagtaa tggcgctaag 1080
ttggagcagt gggtttgtga tcatgcaaaa gccagtcaac gctttactct caatagcacg 1140
ggtgatggct acttcgagct caaatcaagt ttaagtaata aatgtgttga tatcgcaggt 1200
aaactgcaaa cagatggtgc tgatattgta cagtggcagt gttataacgg cgacaatcaa 1260
cgttttcaat ttattgaata a 1281
<210> 15
<211> 1281
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
aatgattggg actcaattcc tttaccggtt actcccggtg atggcaaagt ctggcagcta 60
caagaaacat actcagactc atttaattac actggtaaac ctgctgcatt taccagtaaa 120
tggaatgata cttactttaa tagttggaca ggcccaggtt taacctattg gcaacaagat 180
gagtcatggg tttcagacgg caaccttata attagtgctt cgcgtcgtgc tggtacagat 240
aaagttaatg caggggtgat cacctcgaaa acaaaagtta gctttccaat ctttttagaa 300
gcaaacatta aggtaagtaa tctggaatta tcttcaaatt tttggctgct aagtgacaat 360
gaccagcgag agatagatgt gctcgaggta tacggtgggg cacgtgatga ttggtttgct 420
aaaaatatgt cgacgaactt tcatgtgttt attcgtgatc aacaatctaa ccaaataatt 480
agtgattaca atgatcaaac gcataatacg cctagttggg gaacgtattg gcgtgaaggt 540
tttcatcgtt ttggcgtgta ttggaaaagc ccaacagaag tcacatttta cattgatggt 600
cagcaaacgc ctgatggttc gtgggcgcag gtggtgatga aagataaaga ctataccggt 660
gcgacgttaa acaagaacac acataatatg gatcaatccg cttatatcat tattgataca 720
gaagatcacg attggcgttc agaggcggga aatattgcta cagatgccga tttggctgac 780
gggagtaaaa ataaaatgta tgtcgattgg gtgcgagttt ataaacctgt taatgcgtcc 840
aatacaaaca gtgttagtaa tggtgcacag atcaaagcta agcatagtca aaagtgtatt 900
gatataacag ctggcgctat gagtaatggc tcttattatc agcagtgggg ttgtggctct 960
gataatgcta accaacaatt taaccttgtt gagttaagta ataatgaata tgcaattagc 1020
tcacagttaa gtggcttgtg catgcagatt gaaaacgcca gtacaagtaa tggcgctaag 1080
ttggagcagt gggtttgtga tcatgcaaaa gccagtcaac gctttactct caatagcacg 1140
ggtgatggct acttcgagct caaatcaagt ttaagtaata aatgtgttga tatcgcaggt 1200
aaactgcaaa cagatggtgc tgatattgta cagtggcagt gttataacgg cgacaatcaa 1260
cgttttcaat ttattgaata a 1281
<210> 16
<211> 1281
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
aatgattggg actcaattcc tttaccggtt actcccggtg atggcaaagt ctggcagcta 60
caagaaacat actcagactc atttaattac actggtaaac ctgctgcatt taccagtaaa 120
tggaatgata cttactttaa tagttggaca ggcccaggtt taacctattg gcaacaagat 180
gagtcatggg tttcagacgg caaccttata attagtgctt cgcgtcgtgc tggtacagat 240
aaagttaatg caggggtgat cacctcgaaa acaaaagtta gctttccaat ctttttagaa 300
gcaaacatta aggtaagtaa tctggaatta tcttcaaatt tttggctgct aagtgacaat 360
gacattcgag agatagatgt gctcgaggta tacggtgggg cacgtgatga ttggtttgct 420
aaaaatatgt cgacgaactt tcatgtgttt attcgtgatc aacaatctaa ccaaataatt 480
agtgattaca atgatcaaac gcataatacg cctagttggg gaacgtattg gcgtgaaggt 540
tttcatcgtt ttggcgtgta ttggaaaagc ccaacagaag tcacatttta cattgatggt 600
cagcaaacgc ctgatggttc gtgggcgcag gtggtgatga aagataaaga ctataccggt 660
gcgacgttaa acaagaacac acataatatg gatcaatccg cttatatcat tattgataca 720
gaagatcacg attggcgttc agaggcggga aatattgcta cagatgccga tttggctgac 780
gggagtaaaa ataaaatgta tgtcgattgg gtgcgagttt ataaacctgt taatgcgtcc 840
aatacaaaca gtgttagtaa tggtgcacag atcaaagcta agcatagtca aaagtgtatt 900
gatataacag ctggcgctat gagtaatggc tcttattatc agcagtgggg ttgtggctct 960
gataatgcta accaacaatt taaccttgtt gagttaagta ataatgaata tgcaattagc 1020
tcacagttaa gtggcttgtg catgcagatt gaaaacgcca gtacaagtaa tggcgctaag 1080
ttggagcagt gggtttgtga tcatgcaaaa gccagtcaac gctttactct caatagcacg 1140
ggtgatggct acttcgagct caaatcaagt ttaagtaata aatgtgttga tatcgcaggt 1200
aaactgcaaa cagatggtgc tgatattgta cagtggcagt gttataacgg cgacaatcaa 1260
cgttttcaat ttattgaata a 1281
<210> 17
<211> 35
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
ccggaattca atgattggga ctcaattcct ttacc 35
<210> 18
<211> 37
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
cggggtacct tattcaataa attgaaaacg ttgattg 37
<210> 19
<211> 33
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 19
caatgactgg cgagagatag atgtgctcga ggt 33
<210> 20
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 20
tctctcgcca gtcattgtca cttagcagcc aaaa 34
<210> 21
<211> 33
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 21
caatgacgtt cgagagatag atgtgctcga ggt 33
<210> 22
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 22
tctctcgaac gtcattgtca cttagcagcc aaaa 34
<210> 23
<211> 33
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 23
caatgaccgt cgagagatag atgtgctcga ggt 33
<210> 24
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 24
tctctcgacg gtcattgtca cttagcagcc aaaa 34
<210> 25
<211> 33
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 25
caatgacctg cgagagatag atgtgctcga ggt 33
<210> 26
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 26
tctctcgcag gtcattgtca cttagcagcc aaaa 34
<210> 27
<211> 33
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 27
caatgacaat cgagagatag atgtgctcga ggt 33
<210> 28
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 28
tctctcgatt gtcattgtca cttagcagcc aaaa 34
<210> 29
<211> 33
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 29
caatgaccag cgagagatag atgtgctcga ggt 33
<210> 30
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 30
tctctcgctg gtcattgtca cttagcagcc aaaa 34
<210> 31
<211> 33
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 31
caatgacatt cgagagatag atgtgctcga ggt 33
<210> 32
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 32
tctctcgaat gtcattgtca cttagcagcc aaaa 34
Claims (9)
1. The agarase mutant is characterized in that the agarase mutant is obtained by point mutation based on agarase with an amino acid sequence shown as SEQ ID NO.1, and the amino acid sequence of the agarase mutant is shown as SEQ ID NO. 2.
2. An agarase mutant encoding gene, wherein the agarase mutant encoding gene encodes the agarase mutant of claim 1.
3. The agarase mutant coding gene according to claim 2, wherein the nucleotide sequence of the agarase mutant coding gene is shown in SEQ ID NO. 10.
4. A recombinant vector comprising the agarase mutant-encoding gene according to claim 2 or 3.
5. The recombinant vector according to claim 4, wherein the recombinant vector plasmid is E.coli pProEX HTA plasmid.
6. A recombinant cell expressing the agarase mutant according to claim 1, or comprising the agarase mutant-encoding gene according to claim 2 or 3, or comprising the recombinant vector according to claim 4 or 5.
7. The recombinant cell according to claim 6, wherein the recombinant cell is a host cell of E.coli BL21 (DE 3).
8. A method of making the agarase mutant of claim 1, comprising the steps of:
(1) Constructing a wild agarase recombinant vector: extracting a bacterial strain Pseudoalteromonas sp.QM222 (preservation number: CCTCC NO: M2018744) genome, cloning to obtain a wild agarase gene, and connecting the wild agarase gene with an escherichia coli plasmid to obtain a wild agarase recombinant vector;
(2) Constructing an agarase mutant recombinant vector: taking the wild agarase recombinant vector obtained in the step (1) as a template, and obtaining an agarase mutant recombinant vector through point mutation;
(3) Constructing an agarase mutant recombinant cell: converting the agarase mutant recombinant vector in the step (2) into escherichia coli to obtain an agarase mutant recombinant cell;
(4) Expression and purification of agarase mutant: culturing the recombinant cells of the agarase mutant in the step (3), inducing and expressing recombinant proteins, and separating and purifying to obtain the agarase mutant.
9. Use of an agarase mutant according to claim 1, or a coding gene according to claim 2 or 3, or a recombinant vector according to claim 4 or 5, or a recombinant cell according to claim 6 or 7, or an agarase mutant prepared by the preparation method according to claim 8, for degrading agar or preparing a novel agarase oligosaccharide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210213233.4A CN114934033B (en) | 2022-03-04 | 2022-03-04 | Agarase mutant and encoding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210213233.4A CN114934033B (en) | 2022-03-04 | 2022-03-04 | Agarase mutant and encoding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114934033A CN114934033A (en) | 2022-08-23 |
| CN114934033B true CN114934033B (en) | 2023-08-04 |
Family
ID=82861831
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210213233.4A Active CN114934033B (en) | 2022-03-04 | 2022-03-04 | Agarase mutant and encoding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114934033B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999066052A1 (en) * | 1998-06-12 | 1999-12-23 | Laboratoires Goemar S.A. | GENES CODING FOR β-AGARASES AND THEIR USE FOR PRODUCING AGAR BIODEGRADATION ENZYMES |
| CN102559547A (en) * | 2011-12-22 | 2012-07-11 | 浙江工业大学 | Paenibacillus for producing agarase and application thereof |
| CN104388411A (en) * | 2014-12-03 | 2015-03-04 | 福州大学 | Agarase as well as gene and application thereof |
| CN109207459A (en) * | 2018-11-23 | 2019-01-15 | 福州大学 | A kind of agar-agar enzyme mutant that Fixedpoint mutation modified thermal stability improves |
| CN110724677A (en) * | 2018-07-16 | 2020-01-24 | 中国海洋大学 | Agarase and preparation method thereof |
-
2022
- 2022-03-04 CN CN202210213233.4A patent/CN114934033B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999066052A1 (en) * | 1998-06-12 | 1999-12-23 | Laboratoires Goemar S.A. | GENES CODING FOR β-AGARASES AND THEIR USE FOR PRODUCING AGAR BIODEGRADATION ENZYMES |
| CN102559547A (en) * | 2011-12-22 | 2012-07-11 | 浙江工业大学 | Paenibacillus for producing agarase and application thereof |
| CN104388411A (en) * | 2014-12-03 | 2015-03-04 | 福州大学 | Agarase as well as gene and application thereof |
| CN110724677A (en) * | 2018-07-16 | 2020-01-24 | 中国海洋大学 | Agarase and preparation method thereof |
| CN109207459A (en) * | 2018-11-23 | 2019-01-15 | 福州大学 | A kind of agar-agar enzyme mutant that Fixedpoint mutation modified thermal stability improves |
Non-Patent Citations (1)
| Title |
|---|
| 登录号：WP_064385033;无;GenBank;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114934033A (en) | 2022-08-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108285900B (en) | Recombinant alginate lyase and construction method and application thereof | |
| JP7241368B2 (en) | Ulva polysaccharide lyase and its coding gene and application | |
| CN110066777B (en) | Endo-inulase and application thereof in production of fructo-oligosaccharide | |
| KR100601333B1 (en) | Agarase and gene thereof | |
| CN113122490B (en) | Double-gene defective engineering bacterium and application thereof in improving yield of N-acetylglucosamine | |
| CN112725319B (en) | Alginate lyase FaAly7 with polyG substrate specificity and application thereof | |
| CN109022408B (en) | A kind of novel algin catenase Aly08 and its application | |
| CN111893125A (en) | Chitosan enzyme gene, chitosanase, preparation method and application thereof | |
| CN114480350B (en) | Application of carrageenase in degrading kappa-carrageenan and furcellaran | |
| CN107603994B (en) | Kappa-carrageenase and gene and application thereof | |
| CN117625581A (en) | N-acetylglucosaminidase mutant Ea2F and application thereof | |
| CN114934033B (en) | Agarase mutant and encoding gene and application thereof | |
| CN111334488A (en) | Laminarin enzyme OUC-L1, and coding gene and application thereof | |
| Cristóbal et al. | Isolation and molecular characterization of Shewanella sp. G5, a producer of cold‐active β‐D‐glucosidases | |
| CN112921025B (en) | Mutant of epimerase, coding gene, amino acid sequence and application thereof | |
| JPH07322883A (en) | Recombinant type enzyme, its production and use thereof | |
| KR101347685B1 (en) | Novel microorganism, oligoalginate lyase isolated therefrom, method for saccharifying oligoalginates using the same | |
| CN115232805B (en) | Chondroitin sulfate lyase, recombinant strain and application thereof | |
| CN114807102B (en) | Ethanol-resistant amidase, gene, expression vector, engineering bacterium, preparation method and application | |
| CN116042561B (en) | S-adenosylmethionine synthetase mutant and application thereof | |
| CN114940963B (en) | Bacillus subtilis engineering bacteria for efficiently expressing alginic acid lyase and construction method and application thereof | |
| CN117701547A (en) | PL24 family ulva polysaccharide lyase, coding gene, mutant and application thereof | |
| KR100367154B1 (en) | Amylase with Acabose Resolution, Genes That Encode It, Microorganisms That Produce It, and Its Uses | |
| JP3557271B2 (en) | DNA encoding an enzyme, recombinant DNA containing the same, and transformant | |
| CN117384934A (en) | Recombinant vector for expressing maltotetraose amylase and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |