CN106520712B - Beta carotene assimilation enzyme mutant, recombinant expression carrier, genetic engineering bacterium and its application - Google Patents
Beta carotene assimilation enzyme mutant, recombinant expression carrier, genetic engineering bacterium and its application Download PDFInfo
- Publication number
- CN106520712B CN106520712B CN201610903201.1A CN201610903201A CN106520712B CN 106520712 B CN106520712 B CN 106520712B CN 201610903201 A CN201610903201 A CN 201610903201A CN 106520712 B CN106520712 B CN 106520712B
- Authority
- CN
- China
- Prior art keywords
- beta carotene
- mutant
- assimilation enzyme
- genetic engineering
- recombinant expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
Abstract
The present invention provide it is a kind of by directed evolution means obtain beta carotene assimilation enzyme mutant, encode it nucleic acid sequence, containing the recombinant expression carrier of the mutant gene, and in saccharomyces cerevisiae expression and its application in ketone group carotenogenesis.The present invention filters out the mutant strain improved to beta carotene catalysis activity by high-throughput screening method, and it is analyzed by gene sequencing, catastrophe point is combined mutation, further increases catalysis activity, and will be in the production of the saccharomyces cerevisiae ketonization carotenoid of the mutant strain that screened application.
Description
Technical field
The invention belongs to genetic engineerings and enzyme engineering field, and in particular to one kind is derived from by directed evolution means
The beta carotene assimilation enzyme mutant of haematococcus pluvialis bacterial strain, the nucleic acid sequence for encoding it, the weight containing the mutant gene
Group expression vector, and the expression in saccharomyces cerevisiae and its application in ketone group carotenogenesis.
Background technique
Ketone group carotenoid is a kind of important natural pigment being present in plant, algae, marine bacteria and fungi,
Belong to C40 isoprenoid compound, it, can be with containing unsaturated ketone group in the conjugated double bond and end hexatomic ring containing there are many
Effective quenching single line oxygen, has very strong oxidation resistance.Therefore there is a variety of physiology and trophic function, can be widely applied to
The every profession and trades such as food, drug, health care product and cosmetics.These carotenoid currently on the market are mostly to pass through chemical method
Synthesis, and other impurity compounds can be introduced during chemical synthesis, biological safety is reduced, in addition some classes in chemical synthesis
The configuration of carrotene and natural configuration difference are big, reduce biological activity.And it is red from the microorganism naturally produced such as rain life
Content, at high cost is extracted in ball algae, phaffiafhodozyma, is difficult to be mass produced at present.Excavate carotenogenesis way
Gene in diameter, and carotenoid not only economy but also safety are produced using these genes by biological method.Beta carotene
Assimilation enzyme is the key that in ketone group carotenoid (echinenone, canthaxanthin, pot marigold flavine, astaxanthin etc.) route of synthesis
Enzyme.Under the action of beta carotene assimilation enzyme, beta carotene can be converted to echinenone and canthaxanthin, it can also be by corn
Huang Zhijing calendula yellow generates astaxanthin.However the effect of these zymolytes in vegetative bacteria source is not single-minded, enzyme activity is lower.
(3) summary of the invention
The object of the present invention is to provide a kind of beta carotene assimilation enzyme mutant obtained by directed evolution means with
And its application in carotenogenesis.
The purpose of the present invention also with a kind of beta carotene assimilation enzyme mutant obtained by directed evolution means is provided
The assimilation enzyme of gene coding and its application.
SEQ ID in the beta carotene assimilation enzyme gene expressed in saccharomyces cerevisiae after codon optimization such as sequence table
Shown in NO:15, amino acid sequence is as shown in SEQ ID NO:16 in sequence table.The present invention provides above-mentioned oriented evolution and obtains
Beta carotene assimilation enzyme mutant, the nucleotide sequence of the mutated gene is one of following nucleotide sequences:
(1) in sequence table SEQ ID NO:1 nucleotide sequence；
(2) in sequence table SEQ ID NO:2 nucleotide sequence；
(3) in sequence table SEQ ID NO:3 nucleotide sequence；
(4) in sequence table SEQ ID NO:4 nucleotide sequence；
(5) in sequence table SEQ ID NO:5 nucleotide sequence；
(6) in sequence table SEQ ID NO:6 nucleotide sequence；
(7) in sequence table SEQ ID NO:7 nucleotide sequence；
The beta carotene assimilation enzyme mutant encoded by mutated gene, the ammonia of the beta carotene assimilation enzyme mutant
One of following amino acid sequences when base acid sequence:
(1) in sequence table SEQ ID NO:8 amino acid sequence；
(2) in sequence table SEQ ID NO:9 amino acid sequence；
(3) in sequence table SEQ ID NO:10 amino acid sequence；
(4) in sequence table SEQ ID NO:11 amino acid sequence；
(5) in sequence table SEQ ID NO:12 amino acid sequence；
(6) in sequence table SEQ ID NO:13 amino acid sequence；
(7) in sequence table SEQ ID NO:14 amino acid sequence；
Amino acid is by lacking, being inserted into or replace one or several in amino acid sequence shown in any couple of SEQ ID NO:14
Amino acid and the sequence with sequence SEQ ID NO:14 in amino acid levels at least 70% homology, and there is β-carrot
Plain assimilation enzymatic activity, that is, have for example to be transformed into canthaxanthin or luteole is transformed into astaxanthin beta carotene and live
Property, still fall within protection scope of the present invention.
Wherein, the amino acid sequences encoded beta carotene assimilation enzyme of the SEQ ID NO:8 in sequence table is named as
OBKT-M1, relative to the amino acid of wild type SEQ ID NO:16 its 165th Histidine mutagenesis at arginine；Sequence
The amino acid sequences encoded beta carotene assimilation enzyme of SEQ ID NO:9 is named as OBKT-M2 in table, relative to wild type its
264th valine mutation is at aspartic acid；Amino acid sequences encoded β-the Hu Luo of SEQ ID NO:10 in sequence table
Bu Su assimilation enzyme is named as OBKT-M3, and relative to wild type, its 298th phenylalanine becomes threonine；In sequence table
The amino acid sequences encoded beta carotene assimilation enzyme of SEQ ID NO:11 is named as OBKT-M12, relative to wild type
165 Histidine mutagenesis are at arginine, the 264th valine mutation at aspartic acid；SEQ ID in sequence table
The amino acid sequences encoded beta carotene assimilation enzyme of NO:12 is named as OBKT-M13, relative to wild type the 165th
Histidine mutagenesis becomes threonine at arginine, the 298th phenylalanine；The amino of SEQ ID NO:13 in sequence table
The beta carotene assimilation enzyme of sequences code is named as OBKT-M23, relative to its 264th valine mutation of wild type
Become threonine at aspartic acid, the 298th phenylalanine；The amino acid sequence of SEQ ID NO:13 is compiled in sequence table
Code beta carotene assimilation enzyme be named as OBKTM, relative to its 165th Histidine mutagenesis of wild type at arginine,
264th valine mutation becomes threonine at aspartic acid, the 298th phenylalanine.
It recombinantly expresses and carries the invention further relates to the saccharomyces cerevisiae comprising beta carotene assimilation enzyme gene of the invention
Body.The expression vector constructs obtain by the following method: by SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ
ID NO:4, SEQ ID NO:5, beta carotene assimilation enzyme gene shown in SEQ ID NO:6 or SEQ ID NO:7
ObktM1, ObktM2, ObktM3, ObktM12, ObktM13, ObktM23, ObktM are inserted into saccharomyces cerevisiae integrating vector
In PUMRI-11 (No. NCBI: KM216413), obtain comprising ObktM1, ObktM2, ObktM3, ObktM12, ObktM13,
The saccharomyces cerevisiae of ObktM23, ObktM gene integrated expression plasmid PUMRI-11-ObktM1, PUMRI-11-ObktM2,
PUMRI-11-ObktM3, PUMRI-11-ObktM12, PUMRI-11-ObktM13, PUMRI-11-ObktM23, PUMRI-11-
ObktM.
The invention further relates to the engineered strains of corresponding expression beta carotene assimilation enzyme gene, by the wine brewing ferment
Female integrated plasmid is transformed into saccharomyces cerevisiae, so that beta carotene assimilation enzyme gene table in transgenic Saccharomyces
It reaches.
The present invention also provides the methods that ketonization carotenoid is generated using beta carotene assimilation enzyme.It will be described
Beta carotene assimilation enzyme specifically produce beta carotene bacterial strain in expressed.
The invention further relates to the carotenoids that culture yeasts bacterial strain under conditions of production carotenoid and extracting generate
The step of element.
Compared with prior art, the invention has the following advantages that
The present invention is with haematococcus pluvialis source and according to the beta carotene after the progress codon optimization in saccharomyces cerevisiae
Assimilation enzyme OBKT is research object, establishes beta-carotenone using saccharomyces cerevisiae expression system using fallibility round pcr
Change enzyme mutant library, the mutant strain improved to beta carotene catalysis activity is filtered out by high-throughput screening method, and pass through base
Because of sequencing analysis, catastrophe point is combined mutation, further increases catalysis activity, and the wine that the mutant strain screened is applied
In the production of brewer yeast ketonization carotenoid.
Detailed description of the invention
Fig. 1 is the plasmid map for directed evolution.
Fig. 2 is the policy map of directed evolution beta carotene assimilation enzyme.
Fig. 3 is the expression activitiy figure of beta carotene assimilation enzyme mutant and wild type.
Fig. 4 is figure compared with analyzing containing OBTKM with the Wine brewing yeast strain carotenoid HPLC of wild type.
Specific embodiment
The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in
This:
The molecular cloning of 1 beta carotene assimilation enzyme mutant gene of embodiment and expression
1.1 materials and methods
1.1.1 reagent and culture medium prescription
High fidelity enzyme archaeal dna polymerase Prime STARTMIn HS DNA polymeras, T4DNA ligase, DNA are restricted
Enzyme cutting is purchased from Takara company, and Easy Taq archaeal dna polymerase is purchased from Beijing Quanshijin Biotechnology Co., Ltd, DNA
Marker (1kb DNAL ladder) (Thermo Scientific), PCR product purification kit, DNA gel purified reagent
The molecular biology kits such as box (Axygen, Hangzhou) are for the operation such as gene cloning；PCR primer synthesis and sequencing service are by upper
Marine growth Engineering Co., Ltd or Bo Shang biotech firm provide.
Without amino yeast nitrogen base (Yeast nitrogen base without amino acids, YNB) (green enlightening medical treatment
Instrument, Shanghai) it is used for the preparation of synthetic media；Astaxanthin standard items are new by Zhejiang and provide at Co., Ltd, canthaxanthin mark
Quasi- product are purchased from Aladdin company, and the standard items of beta carotene are purchased from Sigma-Aldrich company；0.22 μm of cellulose mixture needle
Formula filter is purchased from Shanghai bioengineering Co., Ltd；Other reagents for not doing specified otherwise and drug are that domestic analysis is pure.
100mg/mL ampicillin (Ampicillin): it weighs 1g ampicillin and is placed in 15mL centrifuge tube, with going out
After bacterium water constant volume is sufficiently mixed dissolution to 10mL, using sterile 0.22 μm of syringe filter filtration sterilization, be dispensed into 1.5mL from
It is saved after heart pipe in -20 DEG C.Working concentration is 100 μ g/mL.
50mg/ml kanamycins:
0.1mol/L CaCl2-MgCl2Solution (MgCl containing 80mmol/L2, 20mmol/L CaCl2): weigh MgCl2·
6H2O16.26g, CaCl22.22g with deionized water dissolving and is settled to 1L, 121 DEG C of sterilizing 15min, in 4 DEG C of refrigerators after cooling
It saves.
Glycerol-CaCl2Solution (the CaCl containing 0.1mol/L2With 20% glycerol): weigh CaCl211.1g with 20% it is sweet
Simultaneously constant volume saves after cooling in 4 DEG C of refrigerators to 1L, 121 DEG C of sterilizing 15min for oil solution dissolution.
1mol/L sorbierite: weighing 182.17g sorbierite, adds deionized water constant volume to 1L, 121 DEG C of high pressure sterilization 15min,
It is saved after cooling in 4 DEG C of refrigerators.
Luria-Bertani (LB) culture medium: NaCl 10g/L, peptone 10g/L, yeast extract 5g/L, 1mol/L
NaOH is adjusted to pH=7.2, the agar powder of solid LB media addition 2%, 121 DEG C of sterilizing 15min.
Yeast Extract Peptone Dextrose (YPD) culture medium: yeast extract 10g/L, peptone 20g/
L, glucose 20g/L, the agar powder of solid YPD culture medium addition 2%, 115 DEG C of sterilizing 15min.
10 × amino acid liquid storage (10 × Dropout Solution, 10 × DO): weighing following various amino acid, mix,
It is dissolved in aqua sterilisa, keeps its final concentration of: L-Adenine hemisulfate salt 200mg/L, L-Arginine HCl
200mg/L, L-Histidine HCl monohydrate 200mg/L, L-Isoleucine 300mg/L, L-Leucine
1000mg/L, L-Lysine HCl 300mg/L, L-Methionine 200mg/L, L-Phenylalanine 500mg/L, L-
Threonine 2000mg/L, L-Tryptophan 200mg/L, L-Tyrosine 300mg/L, L-Uracil 200mg/L,
L-Valine 1500mg/L.When preparing above-mentioned amino acid liquid storage, according to required for screening different selected markers, missing is corresponding
Amino acid.Span amino acid mother liquor utilizes 0.22 μm of syringe filter filtration sterilization, stores in 4 DEG C of refrigerators.
10 × glucose solution (20g/L): weighing 20g glucose, adds water constant volume to 1L, 115 DEG C of sterilizing 15min, 4 DEG C of ice
Case saves.
10 × galactose solution (20g/L): weighing 20g galactolipin, adds water constant volume to 1L, 115 DEG C of sterilizing 15min, 4 DEG C of ice
Case saves.
Synthetic Defined culture medium: YNB 1.7g, anhydrous slufuric acid ammonia 5g, agar powder 20g (production plate are weighed
Shi Tianjia), 10 × DO 100mL adds water to be settled to 900mL, 115 DEG C of sterilizing 15min.It is to be cooled to after room temperature, according to experiment need
10 × glucose of 100mL is added, and perhaps 10 × galactose solution is configured to corresponding SD SG culture medium.If culture medium
In lack corresponding nutritional ingredient in DO and then mark behind, as SD-URA indicates the SD culture medium of no bird pyrimidine.
1.1.2 prepared by bacillus coli DH 5 alpha competence
The MgCl of Escherichia coli2-CaCl2Competent cell production method and conversion are referring to molecular cloning protocols handbook.If nothing
It illustrates, escherichia coli plasmid extracting, DNA gel recycling, the connection of DNA fragmentation, RNA extracting etc. are according to corresponding reagent
The specification of box is operated.
Escherichia coli cloning after conversion is identified using the method for bacterium solution PCR.Single bacterium colony is picked from the plate, is connect
Kind is into the LB test tube containing corresponding antibiotic.Thallus grow to slight mist it is flower-shaped after, take bacterium solution as template, utilize Easy Taq
Archaeal dna polymerase carries out bacterium solution PCR verifying.It selects positive colony and corresponds to test tube progress plasmid extraction, and DNA is carried out to clone's section
Sequencing identification.
1.1.3 the preparation and conversion of saccharomyces cerevisiae Electroporation-competent cells
Yeast Electroporation-competent cells manufacturing process is as follows:
(1) it picks from the plate yeast colony to be inoculated into the YPD culture medium of 5mL, 30 DEG C of culture 12h.Turn 50 μ l culture
Into 50mL YPD culture medium, 30 DEG C are incubated overnight object, make cell concentration to OD600=2 or so.
(2) bacterium solution is transferred in 50mL centrifuge tube, and 3000 × g is centrifuged 5min, removes supernatant.
(3) cell is resuspended using the aqua sterilisa that 30mL is pre-chilled on ice, supernatant is removed in 3000 × g centrifugation 5min centrifugation.
(4) using the sorbitol washes cell precipitation of the 20mL 1M being pre-chilled on ice, 3000 × g is centrifuged 5min, and supernatant is removed in centrifugation.
(5) cell is resuspended using the sorbierite of 200 μ l-500 μ l 1M, and is transferred in the 1.5mL centrifuge tube of pre-cooling, i.e.,
It is made into competent yeast cells.Each yeast electrotransformation should prepare fresh competent cell to guarantee enough conversion ratios.
Steps are as follows for yeast conversion:
(1) 2-5 μ l plasmid or linearized fragment are taken, is added in the 1.5mL centrifuge tube of pre-cooling.
(2) if using 2mm electric revolving cup, the competent cell of 40 μ l is added into centrifuge tube；If the electricity using 1mm turns
The competent cell of 20 μ l is added in cup.Cell and DNA are transferred in electric revolving cup after gently blowing and beating mixing with rifle in centrifuge tube,
5min is pre-chilled on ice.
(3) water of electrotransformation cup periphery is wiped clean with blotting paper, is shocked by electricity under the electric shock intensity of 750V/mm.
(4) 1mL YPD culture medium is added into the electric revolving cup after electric shock, gently suspension cell, is transferred to 1.5mL centrifuge tube
In, recovery 2h is stood in 30 DEG C of incubators.
(5) cell after recovering is cleaned twice with aqua sterilisa, and suitable cell is taken to be applied to corresponding agar plate.30℃
Incubator culture 2-3 days to single colonie occurs.
1.2 obtain beta carotene mutated gene by fallibility PCR
The Obkt gene synthesized after codon optimization (No. NCBI: KP866870) is cloned into p416XWP-P firstCYC1
On plasmid, then with p416XWP-PCYC1- Obkt t is template, with PCYC1F2 (ACACACACTAAATTAATAGAATTCAAC)
Pass through the method for fallibility PCR using Taq archaeal dna polymerase as primer with ADH1tR2 (CAACCTTGATTGGAGACTTGAC)
Obtain Obkt mutant library.Due to Mn2+The base mispairing rate that PCR process can be increased, when carrying out fallibility PCR using Taq enzyme,
A certain amount of MnCl is added in system2To increase the gene mutation rate during PCR.Error-prone PCR systems are as follows:
PCR reaction condition are as follows: 95 DEG C of 3min of initial denaturation, subsequently into temperature cycles, denaturation, 95 DEG C of 30s；Annealing, 54
℃30s；Extend 72 DEG C, 1min, totally 30 circulations, last 72 DEG C of extensions 5min, final temperature is 4 DEG C.
By the p416XWP-P after the cleaning of fallibility PCR product with linearisationCYC1Plasmid (carries out double enzymes with NotI and SacI
Cut), it is transferred to the YXWP- of the production beta carotene containing tHMG1, crtE, crtYB, crtI gene jointly by the method that electricity turns
It in 77 bacterial strains, is coated on the plate of SD-URA defect, cultivates 3 days；Then, by dithering, picking color reddens intensification
Bacterial strain.Positive mutants strain plasmid is extracted with saccharomyces cerevisiae extracts kit, the plasmid of extraction is gone in bacillus coli DH 5 alpha
Amplification, sequencing.
The sequencing results of mutant are as shown in table 1 below
Embodiment 2 includes the building and linearisation of the saccharomyces cerevisiae expression of beta carotene assimilation enzyme mutant
2.1 expression vector establishment
By the plasmid NotI and SacI double digestion containing Positive mutants strain obtained in embodiment 1.2, β-Hu Luo is obtained
Bu Su assimilation enzyme mutant gene is connect with the PUMRI-11 plasmid (No. NCBI: KM216413) after same NotI and SacI double digestion
It converts.
Double digestion system: 20 μ l of total system
Gene/plasmid: 17 μ l
10×buffer:2μl
NotI enzyme: 0.5 μ l
SacI enzyme: 0.5 μ l
Digestion condition: 37 DEG C are placed, 1.5-2 hour of digestion
Linked system:
Gene: 1 μ l, T4DNA ligase of 5.5 μ l, 3 μ l, 10 × T4DNA ligase buffer of plasmid；0.5μl.
The conversion of competent cell: the connection product of 10 μ l being added in the competent cell that 100 μ l melt on ice, is used
Liquid-transfering gun mixes gently, ice bath 20-40min；42 DEG C of thermal shock 90s, are put into ice rapidly, ice bath 5min；Add 1ml LB culture
Base, 37 DEG C, 220rpm shake culture 50min, 1200rpm are centrifuged in 1min, remove supernatant, 200 μ l of residue mix be coated on card that
On the LB plate of resistance, plasmid extraction is used in the positive colony that 37 DEG C of overnight incubations obtain.
The expression vector linearisation of 2.2 recombinations
Recombinant vector contains DPP1 homology arm, and the site SfiI is contained at homology arm, is linearized by SfiI enzymatic cleavage methods.
Digestion system: 5 μ l, SfiI enzyme of 50 μ l of total system, 43.5 μ l, 10 × G buffer of plasmid, 1.5 μ l.
Digestion condition: 2-3 hour of 50 DEG C of digestions is placed
The dyeing for the saccharomyces cerevisiae that beta carotene assimilation enzyme mutant strain is integrated into production beta carotene by embodiment 3 is enterprising
One step card
The plasmid that recombination linearisation is obtained in embodiment 2 is integrated into according to the method in embodiment 1.1.3 produces β-carrot
On the S. cerevisiae chromosomal of element, it is coated on the YPD plate containing G418 resistance.Mutant OBKTM1, OBKTM2, OBKTM3
Display activity improves, and promotes conversion of the beta carotene to astaxanthin.It is as shown in Figure 3 with wild type comparison result.
Embodiment 4 further improves the vigor of beta carotene assimilation enzyme by combinatorial mutagenesis
Embodiment 1.2 is obtained into three catastrophe points and is combined mutation, is obtained containing there are two the mutant of catastrophe point
OBKTM12 (H165R/V264D), OBKTM13 (H165R/F298Y), OBKTM23 (V264D/F298Y) and the point containing there are three
Mutant OBKTM (H165R/V264D/F298Y), by these mutant according to embodiment 2 construct integrating vector, go to
In the saccharomyces cerevisiae for producing beta carotene.The vigor of combinatorial mutagenesis is higher than simple point mutation, and preferred three point mutation body OBKTM are living
Property highest, first improves 2.5 times than wild type, precursor beta carotene is converted into echinenone and canthaxanthin, thus β-Hu Luo
The yield of Bu Su has dropped 50%, and concrete outcome is as shown in Figure 3.Wine brewing yeast strain containing OBKTM and wild type gene is all kinds of
Carrotene ingredient liquid phase analysis is as shown in Figure 4.For doing the primer of rite-directed mutagenesis and for the primer GAL10F of PCR sequencing
It is as shown in table 2 with ADH1tR2
ObktM mutant and beta carotene hydroxylase are integrated into saccharomyces cerevisiae to produce astaxanthin by embodiment 5
Using PUMRI-11-ObktM as template Obkt-F1 (BamHI) (CAGGGATCCATGCACGTTGCTTCTGCT) and
Obkt-R(SalI)(GGAAGTCGACTTAAGCCAAAGCTGGAACCA is that primer amplification contains BamHI and SalI restriction enzyme site
ObktM gene, then and the same carrier with after BamHI and SalI double digestion and it is used into BamHI and SalI double digestion,
PIMRI-11-OcrtZ connection conversion is cloned, and the recombinant plasmid pUMRI-11-OcrtZ- that will be obtained with embodiment 2 is operated
ObktM and the pUMRI-11-OcrtZ-Obkt constructed before (Zhou et al., 2015) are respective after being linearized with SfiI
It goes in the saccharomyces cerevisiae containing beta carotene.It obtains bacterial strain and finds the astaxanthin being mutated containing OBKTM after HPLC is analyzed
Yield is than improving 48% containing wild type.
Embodiment 6 extracts carotenoid from brewing yeast cell and analyzes the yield of carotenoid by HPLC
The saccharomyces cerevisiae engineered yeast picking single bacterium for producing carotenoid is dropped down onto 5mlYPD test tube, 30 DEG C of 220rpm into
Row is incubated overnight, and being then transferred in 50mlYPD culture medium to whole OD is 0.05.30 DEG C of 220rpm are cultivated 84 hours.Class Hu trailing plants
The extracting of Bu Su takes hot acid method to carry out, and operating method is as follows:
(1) for culture 1mL in 15mL centrifuge tube, 4000 × g centrifugation 1min removes supernatant after taking fermentation.
(2) the cell precipitation pure aqueous suspension of 5mL, 4000 × g centrifugation 1min remove supernatant.
(3) 1mL 3M hydrochloric acid suspension cell is used, 3min carries out clasmatosis in boiling water bath, is placed in ice-water bath immediately after
Cooling 3-5min, removes supernatant after centrifugation.
(4) cell precipitation is resuspended using 5mL pure water, 4000 × g centrifugation 1min outwells supernatant to remove wherein remaining hydrochloric acid.
(5) 4mL acetone is added in centrifuge tube, covers tightly centrifuge tube, vortex oscillation disperses cell precipitation thoroughly, extracts it
In carotenoid.
(6) the above-mentioned centrifuge tube containing extract is placed in ultrasound 10min in ultrasonic cleaning instrument, thoroughly extracts class therein
Carrotene.
(7) 4 DEG C, 4000 × g is centrifuged 2min, supernatant is filtered with 0.45 μm of organic system pin type filter, filtrate can
For total carotinoid measurement and HPLC analysis.
Bacterium solution is being collected for taking 2mL bacterium solution into 2mL centrifuge tube while extracting carotenoid, 12000 × g is centrifuged
1min removes culture medium, adds water washing one time, then be centrifuged supernatant.The centrifuge tube that carrier precipitates is placed in 90 DEG C of baking ovens
Middle processing 8h or so is to obtain dry mycelium.The dry weight of the carotenoid and thallus that are obtained according to extracting calculates carotenoid
Per dry wt content (mg/g DCW).
Using following condition, carotenoid composition and content in saccharomyces cerevisiae are detected by HPLC.Liquid phase analysis instrument
For the LC-20AT of Shimadzu, chromatographic column be Amethyst C18-H reversed-phase column (4.6 × 150mm, 5 μm, Sepax
Technologies,Inc).40 DEG C of column temperature, Detection wavelength 470nm.Using gradient elution, mobile phase is that A pump is acetonitrile and water
(90:10), B pump are that methanol and isopropanol (60:40), flow velocity 1mL/min, elution requirement are as follows: 0-15min, B pump mobile phase
90% is raised to from 0；15-30min keeps the mobile phase 90% of B pump；30-35min B pumps mobile phase and drops to 0 from 90%.It is below
Various carotenoid retention times: astaxanthin, 7.6min；Canthaxanthin, 11.5min；Echinenone, 17.6min；β-carrot
Element, 24.5min.
Claims (8)
1. a kind of beta carotene assimilation enzyme mutant, it is characterised in that: encode the beta carotene assimilation enzyme mutant
Nucleotides sequence is classified as nucleotide sequence shown in SEQ ID NO:7；The amino acid sequence of the beta carotene assimilation enzyme mutant
It is classified as amino acid sequence shown in SEQ ID NO:14.
2. recombinant expression carrier, which is characterized in that the recombinant expression carrier includes nucleotide sequence described in claim 1.
3. recombinant expression carrier according to claim 2, which is characterized in that the carrier is saccharomyces cerevisiae integrated plasmid.
4. genetic engineering bacterium, which is characterized in that the genetic engineering bacterium by recombinant expression carrier as claimed in claim 2 convert to
It is obtained in host microorganism.
5. genetic engineering bacterium according to claim 4, which is characterized in that the host microorganism is saccharomyces cerevisiae.
6. application of the genetic engineering bacterium as described in claim 4 or 5 in preparation ketonization carotenoid.
7. the method for preparing ketonization carotenoid, which is characterized in that by beta carotene assimilation enzyme described in claim 1
Mutant is expressed in the bacterial strain for producing beta carotene.
8. the method for preparation ketonization carotenoid according to claim 7, which is characterized in that produce beta carotene
Bacterial strain is genetic engineering bacterium described in claim 4 or 5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610903201.1A CN106520712B (en) | 2016-10-17 | 2016-10-17 | Beta carotene assimilation enzyme mutant, recombinant expression carrier, genetic engineering bacterium and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610903201.1A CN106520712B (en) | 2016-10-17 | 2016-10-17 | Beta carotene assimilation enzyme mutant, recombinant expression carrier, genetic engineering bacterium and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106520712A CN106520712A (en) | 2017-03-22 |
| CN106520712B true CN106520712B (en) | 2019-07-23 |
Family
ID=58331930
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610903201.1A Active CN106520712B (en) | 2016-10-17 | 2016-10-17 | Beta carotene assimilation enzyme mutant, recombinant expression carrier, genetic engineering bacterium and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106520712B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107987138B (en) * | 2017-12-22 | 2020-09-04 | 浙江大学 | Gal4 temperature-sensitive mutant, recombinant expression vector, temperature regulation system and application thereof |
| CN108977414B (en) * | 2018-08-16 | 2020-09-04 | 中国科学院昆明植物研究所 | Artificially synthesized mutant of beta-carotene ketolase and coding sequence and application thereof |
| CN112852764B (en) * | 2020-08-12 | 2021-11-16 | 中国科学院天津工业生物技术研究所 | Mutant protein of ketonizing enzyme and application |
| CN115074410A (en) * | 2022-06-30 | 2022-09-20 | 武汉合生科技有限公司 | Method and carrier for biologically synthesizing astaxanthin |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2007502605A (en) * | 2003-08-18 | 2007-02-15 | サンジーン ゲーエムベーハー | Method for producing ketocarotenoids in genetically modified non-human organisms |
| WO2007120426A1 (en) * | 2006-03-30 | 2007-10-25 | E. I. Du Pont De Nemours And Company | Mutant carotenoid ketolases |
| CN105316357A (en) * | 2015-10-14 | 2016-02-10 | 华东理工大学 | Method for producing astaxanthin by using transgenic microalgae |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7074604B1 (en) * | 2004-12-29 | 2006-07-11 | E. I. Du Pont De Nemours And Company | Bioproduction of astaxanthin using mutant carotenoid ketolase and carotenoid hydroxylase genes |
-
2016
- 2016-10-17 CN CN201610903201.1A patent/CN106520712B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2007502605A (en) * | 2003-08-18 | 2007-02-15 | サンジーン ゲーエムベーハー | Method for producing ketocarotenoids in genetically modified non-human organisms |
| WO2007120426A1 (en) * | 2006-03-30 | 2007-10-25 | E. I. Du Pont De Nemours And Company | Mutant carotenoid ketolases |
| CN105316357A (en) * | 2015-10-14 | 2016-02-10 | 华东理工大学 | Method for producing astaxanthin by using transgenic microalgae |
Non-Patent Citations (1)
| Title |
|---|
| 通过定向进化策略提高酯酶立体选择性的研究;汤晓玲等;《高校化学工程学报》;20110415(第02期);283-288 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106520712A (en) | 2017-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106520712B (en) | Beta carotene assimilation enzyme mutant, recombinant expression carrier, genetic engineering bacterium and its application | |
| KR100626511B1 (en) | Improved production of isoprenoids | |
| CN113621630B (en) | 3-ketoacyl-CoA thiolase gene RkACAA1-1 and application thereof | |
| CN113621631A (en) | Mevalonate kinase gene RKMK and application thereof | |
| CN113652440A (en) | 3-ketoacyl-coenzyme A thiolase gene RKACAA1-2 and application thereof | |
| WO2019094447A2 (en) | Production of mycosporine-like amino acids in cyanobacteria | |
| CN109943493B (en) | Mutant strain for realizing diversity of general enzyme catalytic functions and construction method thereof | |
| CN115851779B (en) | Glucose-6-phosphate dehydrogenase gene RkZWF1 and application thereof | |
| CA2498800A1 (en) | Sqs gene | |
| CN108823236A (en) | A kind of method that gene editing technology target practice OsELF3 gene extends Rice Heading | |
| CN112608936B (en) | Promoter for regulating and controlling expression of exogenous gene of yeast, regulating and controlling method and application thereof | |
| WO2019207443A1 (en) | An enzymatic process for the preparation of (r)-sitagliptin | |
| WO2021019409A1 (en) | Astaxanthin over-producing strains of phaffia rhodozyma | |
| CN104278015B (en) | One plant height effect is overexpressed the phaffia rhodozyma bacterial strain of endogenous chemical activators enzyme gene | |
| WO2024026963A1 (en) | Construction method and use of astaxanthin synthesis pathway in chlamydomonas reinhardtii | |
| CN111411101B (en) | Linalool synthetase mutant, recombinant expression vector and linalool production engineering bacterium | |
| CN112852764B (en) | Mutant protein of ketonizing enzyme and application | |
| CN110004099A (en) | A kind of fermentation method for producing of rhodioside | |
| CN104962530B (en) | A kind of enzyme amalgamation and expression albumen and its application in terms of production of astaxanthin | |
| CN111196845B (en) | Gal4 protein mutant and application thereof | |
| CN116904412B (en) | Construction method and application of saccharomyces cerevisiae strain with optimized cannabis diphenolic acid synthetase sequence | |
| CN114410659B (en) | Phaeodactylum tricornutum CRTISO5 gene, protein and application thereof in fucoxanthin synthesis | |
| CN114395571B (en) | Phaeodactylum tricornutum ZEP1 gene, protein and application | |
| TWI521060B (en) | A method for culturing the larvae of Cordyceps sinensis, a composition comprising Cordyceps sinensis and its use | |
| CN113755458B (en) | CYP82AR2 protein involved in shikonin and/or acarnine biosynthesis, and encoding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |