CN114214218A - Engineering bacterium for producing astaxanthin and preparation method and application thereof - Google Patents

Abstract

The application discloses an astaxanthin-producing engineering bacterium, a preparation method and an application thereof. The preparation method of the astaxanthin-producing engineering bacteria comprises the following steps: the beta-carotene ketolase gene and the beta-carotene hydroxylase gene are separated or serially knocked into the genome of uracil and leucine auxotrophic yarrowia lipolytica engineering bacteria by using a CRISPR/Cas9 operating system or a random integration method. The high yield of the astaxanthin can be realized by fermenting the yarrowia lipolytica engineering bacteria for producing the astaxanthin and optimizing the fermentation conditions, and the astaxanthin is astaxanthin with a 3S-3' S configuration. The constructed engineering strain and product have good biological safety, simple production process, short period and good quality, and can be applied to products in various fields.

Description

Engineering bacterium for producing astaxanthin and preparation method and application thereof

Technical Field

The application relates to the technical field of synthetic biology and fermentation engineering, in particular to an engineering bacterium for producing astaxanthin and a preparation method and application thereof.

Background

Astaxanthin is a naturally-occurring carotenoid compound, has strong oxidation resistance and red color endowing performance, is the only carotenoid which can penetrate through blood brain and blood retina barriers and has positive effects on central nerves and brain functions, and can be widely applied to the fields of aquaculture, poultry egg industry, cosmetics, health care products and the like.

Natural producers of astaxanthin include certain species of algae, bacteria, fungi, plants, etc., and in addition, shrimp and crab also enrich astaxanthin in their shells by consuming astaxanthin-containing algae. However, the astaxanthin content in the organisms is very low, the culture and extraction processes are complex and inefficient, and the market application of the astaxanthin is seriously hindered. The chemical synthesis method is the main production mode of astaxanthin at present due to low price, but the safety is questionable due to the fact that the chemical synthesis method contains various optical isomers, and the pollution of the production process is serious, so that the Food and Drug Administration (FDA) of the United states prohibits the chemically synthesized astaxanthin from entering the field of health care products, only allows the astaxanthin with the 3S-3' S configuration to enter the field of food and health care products, and greatly limits the application field of the chemically synthesized astaxanthin.

The astaxanthin biosynthesis pathway is divided into two parts: synthesizing lycopene from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) synthesized by a mevalonate pathway (MVA pathway) and a 2-C-methyl-D-erythritol-4-phosphate synthesis pathway (MEP pathway) through multi-step reactions, and further synthesizing beta-carotene; beta-carotene can be converted under the action of beta-carotene ketolase (CrtW) and beta-carotene hydroxylase (CrtZ) to obtain the final product 3S-3' S type astaxanthin.

Natural pathways for biosynthesis of 3S-3' S type astaxanthin from β -carotene via CrtW and CrtZ exist in various algae such as Haematococcus pluvialis (Haematococcus pluvialis), Haematococcus zofingiensis (Chromochloris zofinensis), bacteria such as Pantoea ananatis (Pantoea ananatis), marine bacteria (Agrobacterium aurantiacu), and the like.

Yarrowia lipolytica, as used herein, is a yeast commonly found in dairy products and passes the general safety certification GRAS (generally approved as safe). It features that it can use multiple carbon sources including oil and fat and can synthesize and accumulate a great deal of oil and fat in cells. Therefore, yarrowia lipolytica is rich in acetyl-CoA as a precursor for carotenoid synthesis in cells, has enough storage space, and is very beneficial to the production of fat-soluble carotenoids. The introduction of the astaxanthin synthesis pathway in yarrowia lipolytica underpan cells to produce astaxanthin, and the production of high quality astaxanthin by yarrowia lipolytica, which is not available in the natural host, has become one of the hotspots of current research. Several patents and literature have previously been directed to the synthesis of carotenoids such as lycopene and beta-carotene by introducing heterologous pathway genes into yarrowia lipolytica. But lycopene and beta-carotene are rich in plant and have low value, so the value of fermentation production by engineering bacteria is not high. There are also some documents and patents that have also achieved the synthesis of astaxanthin in microorganisms by continuing the introduction of heterologous pathways from β -carotene to astaxanthin, the hosts being mainly escherichia coli, saccharomyces cerevisiae, etc., but these engineered bacteria still have the problem of low astaxanthin production. In addition, Escherichia coli has a safety problem caused by endotoxin, and is not enough to be applied to industrial production. Therefore, the development of the yarrowia lipolytica synthetic biological engineering bacteria for high-yield astaxanthin has important application value.

Disclosure of Invention

The application provides an engineering bacterium for producing astaxanthin, a preparation method and application thereof, which can realize high yield of astaxanthin by a biological fermentation method.

The application provides an engineering bacterium for producing astaxanthin, wherein the genome of the engineering bacterium for producing astaxanthin comprises a beta-carotene ketolase gene (CrtW) and a beta-carotene hydroxylase gene (CrtZ), and beta-carotene can be converted under the action of the beta-carotene ketolase and the beta-carotene hydroxylase to obtain a final product 3S-3' S type astaxanthin. The beta-carotene ketolase gene is selected from genes obtained by carrying out codon optimization on any one sequence shown in SEQ ID NO. 1-SEQ ID NO. 7; obtaining and screening a CrtW gene from naturally astaxanthin-producing algae and bacteria, wherein the CrtW gene is derived from the following sources: shortwave unicellular bacteria (Brevundimonas vesicularis SD212), thylakoid-free cyanobacteria (Gloeobacter violacea PCC 7421), Anabaena variabilis (Anabaena variabilis ATCC 29413), Nostoc punctiforme PCC 73102, Nostoc sp.PCC 7120, Chlamydomonas reinhardtii, and Agrobacterium aurantium (Agrobacterium aurantiacaum) from the sea. The CrtW gene derived from the above-mentioned naturally astaxanthin-producing algae and bacteria is codon-optimized according to the codon preference of yarrowia lipolytica.

Optionally, in some embodiments of the present application, the β -carotene hydroxylase gene is selected from the group consisting of a gene obtained by codon optimization of any one of the sequences shown in SEQ ID No.8 to SEQ ID No. 17; obtaining and screening a CrtZ gene from naturally astaxanthin-producing algae and bacteria, wherein the CrtZ gene is derived from the following sources: brevundimonas sp (Brevundimonas vesicularis DC263, Brevundimonas vesicularis SD212), maize bacterial wilt (Pantoea stewartii), Erwinia (Erwinia uredova), Sulfolobus (Sulfolobus solfataricus P2), Pantoea agglomerans (Pantoea agglomerans), blue algae (Anabaenana variabilis ATCC 29413), Synechocystis sp.PCC 6803), Haematococcus lacustris (Haematococcus lactis), and Pantoea ananatis (Pantoea ananatis). The CrtZ gene derived from the above-mentioned naturally astaxanthin-producing algae and bacteria is codon-optimized according to the codon preference of yarrowia lipolytica.

Optionally, in some embodiments of the present application, the engineered bacterium is yarrowia lipolytica.

Correspondingly, the application also provides a preparation method of the engineering bacteria for producing the astaxanthin, which comprises the steps of knocking the beta-carotene ketolase gene and the beta-carotene hydroxylase gene into the genome of the yarrowia lipolytica engineering bacteria auxotrophic for uracil and leucine, and supplementing the uracil and leucine screening markers back to obtain the engineering bacteria for producing the astaxanthin.

Alternatively, in some embodiments of the present application, the β -carotene ketolase gene is selected from the group consisting of genes codon-optimized for any one of the sequences shown in SEQ ID No.1 to SEQ ID No. 7.

Optionally, in some embodiments of the present application, the β -carotene hydroxylase gene is selected from the group consisting of a gene obtained by codon optimization of any one of the sequences shown in SEQ ID No.8 to SEQ ID No. 17.

Alternatively, in some embodiments of the present application, the β -carotene ketolase gene and the β -carotene hydroxylase gene are knocked into the genome of uracil and leucine auxotrophic yarrowia lipolytica engineering bacteria separately or in tandem using the CRISPR/Cas9 operating system or a random integration method.

Alternatively, in some embodiments of the present application, when gene knockin is performed using the CRISPR/Cas9 operating system, a Cas9/sgRNA expression plasmid and a homologous DNA donor plasmid are constructed, and the Cas9/sgRNA expression plasmid and the homologous DNA donor plasmid are transformed into uracil and leucine auxotrophic yarrowia lipolytica engineering bacteria.

Alternatively, in some embodiments of the present application, the expression plasmid includes a sgRNA (single guide RNA) fragment designed for the site of gene integration.

Alternatively, in some embodiments of the present application, the homologous donor plasmid comprises a segment of the homology arm at both ends of the gene integration site.

In addition, the application also provides an application of the astaxanthin-producing engineering bacterium in preparation of astaxanthin.

In addition, the application also provides a preparation method of astaxanthin, which comprises the step of preparing the astaxanthin with 3S-3' S configuration by fermentation by using the astaxanthin-producing engineering bacteria or the astaxanthin-producing engineering bacteria prepared by the preparation method.

Optionally, in some embodiments of the present application, the fermentation medium used for the fermentation comprises:

alternatively, in some embodiments of the present application, the feed medium comprises:

glucose: 400-600 g/L;

yeast extract (B): 10-20 g/L;

tryptone: 20-40 g/L.

Optionally, in some embodiments of the present application, the carbon and nitrogen sources may be fed separately after culturing for 16-24 hours, or the carbon and nitrogen sources may be fed separately after culturing for 17-23 hours, or the carbon and nitrogen sources may be fed separately after culturing for 20-22 hours.

Optionally, in some embodiments of the present application, the ratio of the carbon source and the nitrogen source in the feeding control may be 5-10: 1, or 6-9: 1, or 7-8: 1.

Optionally, in some embodiments of the present application, the dissolved oxygen may be controlled to be 30 to 60% of the calibrated saturated dissolved oxygen, or 35 to 55%, or 40 to 50% during the fermentation.

Optionally, in some embodiments of the present application, the ratio of astaxanthin in the fermentation product to carotenoid may be up to 60% to 85%, or up to 65% to 80%, or up to 70% to 75%.

Optionally, in some embodiments of the present disclosure, the fermentation time may be 140 to 150 hours, 142 to 148 hours, or 145 hours.

Optionally, in some embodiments of the present disclosure, the yield of astaxanthin may be 0.7-1.5 g/L, may also be 0.9-1.3 g/L, and may also be 1.0-1.1 g/L.

Optionally, in some embodiments herein, the astaxanthin is astaxanthin in the 3S-3' S configuration. Astaxanthin has 3 isomeric forms of 3S-3 ' S, 3R-3 ' S and 3R-3 ' R (also called L-, racemic-, D-isomers) due to the optical activity of the hydroxyl groups at both ends. Among them, 3S-3 'S configuration astaxanthin has the strongest biological activity, and FDA allows only 3S-3' S configuration astaxanthin to enter the fields of food and health care products.

The application constructs the yarrowia lipolytica engineering bacteria for producing the astaxanthin, and has the following beneficial effects:

by means of synthetic biology technology, CrtW and CrtZ from different natural hosts are introduced into uracil and leucine deficient yarrowia lipolytica genomes producing beta-carotene, and then a screening marker is complemented back to construct engineering bacteria of the yarrowia lipolytica producing astaxanthin in a 3S-3' S configuration, and high-yield bacteria are screened from the engineering bacteria. And then fermenting the constructed high-yield engineering bacteria on a 5L tank by using a specific feed culture medium and a feed batch fermentation control process, and finally realizing high yield of the astaxanthin. Because the yarrowia lipolytica has good biological safety and resistance marker genes are not introduced in the DNA recombination genetic modification process, the production strain and the astaxanthin thereof can be applied to products in various fields, including aquaculture, poultry egg industry, health products, functional food additives, cosmetics and the like.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present application, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts.

FIG. 1 is a schematic diagram of expression plasmid pCRISPRyl and homologous Donor plasmid HR Donor constructed in CRISPR/Cas9 operating system;

FIG. 2 is a schematic diagram of randomly integrated fragment assembly;

FIG. 3 is a schematic diagram of the anaplerotic scheme for uracil and leucine selection markers;

FIG. 4 is an electrophoretogram of PCR products of the target genes CrtW and CrtZ;

FIG. 5 is an electrophoretogram of pHR _ XPR2_ hrGFP plasmid and pHR _ A08_ hrGFP plasmid;

FIG. 6 is a schematic diagram of a gene site-directed integration scheme of CRISPR technology;

FIG. 7 shows the shake-flask horizontal astaxanthin production of engineering bacteria constructed by different CrtW and CrtZ recombination modes in different hosts;

FIG. 8 is a microscopic image of the broth during the course of the ECA-1 fermentation;

FIG. 9 is a graph of OD600 and residual sugar changes during ECA-1 fermentation;

FIG. 10(A) is an HPLC chart of the extract from the fermentation broth containing mycelia obtained by ECA-1 fermentation for 143 hours; FIG. 10(B) is an HPLC chart of astaxanthin standard;

FIG. 11 is an astaxanthin standard curve;

FIG. 12 is a graph showing the variation of astaxanthin production during fermentation of ECA-1 after 5L tank process optimization;

FIG. 13 is a graph showing the change in the yield of astaxanthin produced by batch culture before optimization of ECA-1 in a 5L tank (1 XYPD);

FIG. 14 is a graph showing the change in astaxanthin production by feed culture of ECA-1 (2 XYPD, 480g glucose feed) before optimization in 5L tanks.

FIG. 15 is a graph showing the change in the ratio of astaxanthin to carotenoid in the course of the ECA-1 fermentation;

FIG. 16 is an HPLC identification chart of astaxanthin structure; FIG. 16A is the HPLC identification chart of the extract from the fermentation broth of the engineering bacteria of this embodiment, and FIG. 16B is the HPLC chart of the extract from the fermentation broth of Phaffia rhodozyma.

Detailed Description

The technical solutions in the embodiments of the present application will be described clearly and completely below, and it should be understood that the described embodiments are only a part of the embodiments of the present application, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present application.

The application provides an engineering bacterium for producing astaxanthin and a preparation method and application thereof. The following are detailed below.

In this application, "codon optimization" refers to the redesign of a gene using codons that are favored and avoid poorly utilized or rare codons. Each organism exhibits some degree of codon usage difference or preference, those most frequently used being preferred codons.

In the present application, the CRISPR/Cas9 operating system is matched with a target DNA through a guide rna (grna), thereby guiding the Cas9 protein to bind to a specific gene site and perform cleavage.

The application relates to a strain source specification:

XK17 is a uracil and leucine auxotrophic yarrowia lipolytica engineered bacterium made in the referenced CN111321087A patent. YC607 is a uracil auxotrophic yarrowia lipolytica engineered bacterium prepared according to doctor's paper of Yi Sheng Ming 2017. IF015 is based on the published (Larroude, Celinska et al 2018) on ob-CHC^TEFC^TEFUracil and leucine auxotroph yarrowia lipolytica engineering bacteria prepared by the strain construction method.

Description of the origin of the plasmids to which this application relates:

plasmids pCRISPRyl _ XPR2 and pHR _ XPR2_ hrGFP were purchased from adddge, and numbered 84609 and 84614, respectively. pCRISPRIyl _ A08 and pHR _ A08_ hrGFP were purchased from addgene under the numbers 84610 and 84615, respectively. Plasmid pHR _ AXP _ hrGFP was purchased from addrene.

Plasmid pINA1269 was prepared according to the preparation described in the article by (Madzak, Tratton et al 2000) and plasmid pINA1312 was prepared according to the preparation described in the article by (Nicaud, Madzak et al 2002).

The present application relates to media composition descriptions:

the YPD medium consists of 2% of glucose, 2% of peptone and 1% of yeast extract, and the balance of water, wherein the percentages are mass percentages.

Example one, obtaining the CrtW Gene and CrtZ Gene

The method for obtaining the CrtW gene and the CrtZ gene provided in this example is as follows:

beta-carotene ketolase and beta-carotene hydroxylase coding genes are obtained from algae and bacteria which naturally produce astaxanthin, and enzyme combination screening is carried out to obtain the optimal combination.

Sources of beta-carotene ketolase: shortwave unicellular bacteria (Brevundimonas vesicularis SD212), thylakoid-free cyanobacteria (Gloeobacter violacea PCC 7421), Anabaena variabilis (Anabaena variabilis ATCC 29413), Nostoc punctiforme PCC 73102, Nostoc sp.PCC 7120, Chlamydomonas reinhardtii, and Agrobacterium aurantium (Agrobacterium aurantiacaum) from the sea. The beta-carotene ketolase gene obtained from algae and bacteria naturally producing astaxanthin is shown as SEQ ID NO. 1-SEQ ID NO. 7.

Sources of β -carotene hydroxylase: brevundimonas sp (Brevundimonas vesicularis DC263, Brevundimonas vesicularis SD212), maize bacterial wilt (Pantoea stewartii), Erwinia (Erwinia uredova), Sulfolobus (Sulfolobus solfataricus P2), Pantoea agglomerans (Pantoea agglomerans), blue algae (Anabaenana variabilis ATCC 29413), Synechocystis sp.PCC 6803), Haematococcus lacustris (Haematococcus lactis), and Pantoea ananatis (Pantoea ananatis). The beta-carotene hydroxylase genes obtained from algae and bacteria which naturally produce astaxanthin are shown as SEQ ID NO. 8-SEQ ID NO. 17.

The CrtW gene and CrtZ gene were PCR amplified using the primers shown in table 1, and the PCR product was purified using the Axygen PCR clean kit and stored for future use. FIG. 4 shows the electrophoretograms of the genes SEQ ID NO.1CrtW and SEQ ID NO.8CrtZ, in which the band 1 is a CrtW gene, and the size of which is about 1000bp, and the band 2 is a CrtZ gene, and the size of which is about 900 bp.

TABLE 1

The codons of CrtW and CrtZ are optimized according to the codon preference of yarrowia lipolytica and synthesized in the whole gene.

Example two Gene site-directed integration Using CRISPR/Cas9 operating System

The CRtW and CrtZ genes are separately inserted into the genome specific sites of the three yarrowia lipolytica engineering strains with high beta-carotene yield by using a CRISPR/Cas9 operating system or a random integration method or are inserted into the genome specific sites of the three yarrowia lipolytica engineering strains with high beta-carotene yield by using the following specific method:

based on CRISPR/Cas9 operating system, the yarrowia lipolytica is subjected to gene site-specific integration, namely, marker-free genes are targeted and integrated to specific positions of the yarrowia lipolytica genome. The system combines single-strand guide RNA (sgRNA) with RNA polymerase III (pol III) -tRNA hybrid promoter to construct CRISPR-Cas9 expression plasmid pCRISPRyl for gene knockout and integration. Meanwhile, a plurality of sites with high gene integration efficiency are screened out on the genome of yarrowia lipolytica model bacterium Po1f, and a homologous Donor plasmid HR Donor with an hrGFP expression cassette is constructed. Integration of the gene of interest was achieved by co-transformation of pCRISPRyl and recombinant HR Donor, as shown in FIG. 1.

The plasmid pairs constructed herein include:

(ii) construction of plasmid pairs pCRISPRIyl _ A3 and pHR _ A3_ CrtZ-CrtW. pCRISPRyl _ A3 was constructed by linearizing plasmid pCRISPRyl using AvrII restriction endonuclease and seamlessly cloning and ligating the sgRNA fragment designed for A3 site, wherein the nucleotide sequence of the sgRNA fragment designed for A3 site is SEQ ID No. 52: atacgagatgagtgccaaag are provided.

pHR _ A3_ CrtZ-CrtW takes the genome of yarrowia lipolytica as a template, 1000bp at each end of a sgRNA sequence at the site A3 is amplified by PCR respectively by using a primer pair SEQ ID NO.53: gtaccaaggaagcatgcggtggagtggaacttggacag/SEQ ID NO.54: cacagcttgtcactttgcg and SEQ ID NO.55: catgtccagtgaagcctcc/SEQ ID NO.56: agttcactttggacaccttctat as a left homologous arm and a right homologous arm, and a plasmid pHR _ AXP _ hrGFP is taken as a template, and a primer pair SEQ ID NO.57: ctgtccaagttccactccaccgcatgcttccttggtac and SEQ ID NO.58: atagaaggtgtccaaagtgaactcaagcccgacaactacgt are used for PCR amplification to obtain a plasmid basic skeleton and CrtZ-CrtW seamless cloning.

② the construction of plasmid pairs pCRISPRIyl _ XPR2 and pHR _ XPR2_ CrtW. pCRISPRIyl _ XPR2 and pHR _ XPR2_ hrGFP were purchased from addgene, pHR _ XPR2_ CrtW was obtained by double-enzymatic excision of the hrGFP gene of pHR _ XPR2_ hrGFP and CrtW using the restriction enzymes NheI and BssHII, and by seamless cloning.

Construction of plasmid pairs pCRISPRIyl _ A08 and pHR _ A08_ CrtZ. pCRISPRIyl _ A08 and pHR _ A08_ hrGFP were purchased from addge, pHR _ A08_ CrtZ was obtained by double-enzymatic excision of the hrGFP gene of pHR _ A08_ hrGFP with CrtZ using restriction enzymes NheI and BssHII.

The electrophoretogram of the gel recovery sample after double digestion of pHR _ XPR2_ hrGFP plasmid and pHR _ A08_ hrGFP plasmid is shown in FIG. 5, wherein the band 14 is the electrophoretogram of the gel recovery sample after double digestion of pHR _ XPR2_ hrGFP vector, and the band 15 is the electrophoretogram of the gel recovery sample after double digestion of pHR _ A08_ hrGFP vector.

Coli containing the corresponding plasmid was inoculated into 2mL of LB liquid medium containing the corresponding resistant carbenicillin or kanamycin to a final concentration of 100. mu.g/mL, cultured at 37 ℃ and 250rpm overnight with shaking for about 12-16h, and the extracted plasmid was manipulated according to the TIANGEN plasmid miniprep kit.

The plasmid pair constructed above was simultaneously transformed into β -carotene-producing yarrowia lipolytica strains (XK17, IF015, YC 607). Transformation was performed with reference to Frozen-EZ Yeast Transformation II^TM(available from Zymo Research) instructions. Then, the steps shown in FIG. 6 were carried out, wherein YNB means a yeast basal medium; YC refers to yeast colony; 5-FOA is 5-fluoroorotic acid, 5-FOA can kill non-URA-deficient strains, URA defects can survive. After transformation, the yarrowia lipolytica engineering bacteria which successfully knock in the CrtW gene and CrtZ gene and produce astaxanthin are obtained through screening plate and inserting site verification.

Example three integration of genes of interest by random integration

The method for integrating the target gene by the random integration method provided in this example is as follows:

as the research shows that the yarrowia lipolytica can absorb the exogenous DNA fragment with high efficiency, the random integration method is also used for integrating the target gene. Seven CrtW and ten CrtZ were randomly integrated into the genome of yarrowia lipolytica by the construction shown in FIG. 2, where URA could be removed by streaking on YPD plates containing 5-FOA (pentafluoroorotic acid) and markers recovered.

In yarrowia lipolytica, repair of a Double Strand Break (DSB) is preferentially dependent on non-homologous end joining (NHEJ), the gene of interest is introduced into the genome by random insertion and deletion, and integration efficiency of homologous recombination of its foreign DNA is low. Therefore, the plasmids pINA1269 and pINA1312 are linearized and then randomly integrated to complement LEU2 and URA3 nutritional markers. As shown in fig. 3, after single digestion of NotI, the linearized plasmid pINA1269 was transformed into a double-deficient strain with correct verification, and LEU2 nutritional markers were supplemented; after the NotI single enzyme digestion of the plasmid pINA1312, a long fragment containing URA3d1 is recovered and transformed into a defective strain which is supplemented with the LEU2 nutritional marker in the previous step, and the uracil URA3 nutritional defect marker is supplemented.

Example four screening of higher yield engineering bacteria

The high-yield candidate strain is obtained by shaking flask fermentation and measuring the astaxanthin yield of different engineering strains, and the specific steps are as follows:

and (3) shaking flask fermentation: selecting a colony with a darker color in the transformant, inoculating the colony in 2mL YPD liquid culture medium (1% yeast extract, 2% glucose and 2% tryptone), and carrying out shake culture at 30 ℃ and 220rpm for 16-24 h; taking 100 mu L of bacterial liquid to 50mL YPD liquid culture medium, carrying out shaking culture at 30 ℃ and 220rpm for 16-24 h; 500. mu.L of the bacterial solution was added to 50mL of YPD liquid medium and subjected to shaking culture at 30 ℃ and 220rpm for 96 hours.

Extracting carotenoid: taking 50 mu L of fermentation liquor to put in a 1.5mL Ep tube, and centrifuging for 3min at 12000 rpm; discarding the supernatant, adding 500 μ L DMSO, blowing, mixing, vortex oscillating for 30s, and storing at 65 deg.C in dark for 10 min; adding 500 μ L acetone, vortex oscillating for 30s, and storing at 65 deg.C in dark for 15 min; the supernatant was centrifuged at 12000rpm for 3min (at this time, the cells should be white), filtered through a 0.22 μm filter, and subjected to HPLC.

HPLC detection method:

mobile phase setting:

time (min)	Methanol	Methyl tert-butyl ether	1% phosphoric acid
				0	81％	15％	4％
15	66％	30％	4％
				23	16％	80％	4％
27	16％	80％	4％
				30	81％	15％	4％
35	81％	15％	4％

A chromatographic column: YMC carotenoid C₃₀(5μm,4.6×250mm)

Flow rate: 1mL/min

Wavelength: 480nm

Sample introduction amount: 20 μ L

Column temperature: at room temperature

And (3) dry weight determination: the EP tubes were pre-dried and weighed. Taking 1mL fermentation liquid in a 1.5mL Ep tube, centrifuging at 12000rpm for 3min, discarding the supernatant, washing twice with distilled water, removing water as much as possible, drying at 65 ℃ for more than 48h to constant weight, and finally weighing and calculating (g/L).

As shown in FIG. 7, it was found that the astaxanthin production by ECA-1 was high, and that the astaxanthin production by the ECA-1 strain after the leucine and uracil had been supplemented by the selection marker was the highest. As shown in Table 2, ECA-1 is an astaxanthin-producing recombinant strain which takes IF015 as an initial strain and is inserted with CrtZ (A08 site) and CrtW (XPR2 site) in sequence at fixed points, and ECA-1 is the strain with the highest astaxanthin yield screened by the application, and the astaxanthin yield at the shake flask level can reach 30-40 mg/L.

TABLE 2 genetic background of engineered strains

EXAMPLE V fermentative preparation of astaxanthin

In this embodiment, the yarrowia lipolytica engineering bacterium ECA-1 strain for producing astaxanthin, which is prepared as described above, is used to optimize a seed culture process, an inoculation ratio, a fermentation substrate medium composition, a feed method, a process parameter control method, and the like in a 5L bioreactor to obtain a high-yield fermentation process, and the specific conditions and steps are as follows:

preparing a seed solution: taking a strain preservation solution at the temperature of minus 80 ℃, carrying out streak culture for 36h, picking a single colony, inoculating to 50mL YPD, and culturing for 12-36 h. Sucking 100-500. mu.L to 100mL YPD for 12-36 h.

Inoculation amount: 5 to 20 percent.

Fermentation medium: 5-15g/L of yeast extract, 15-25g/L of glucose, 10-30g/L of tryptone, 1-10g/L of ammonium sulfate and 0.5-10g/L of magnesium sulfate.

A supplemented medium: 600g/L of glucose 400-. Feeding rate: carbon source 0-10 g/h.L and nitrogen source 0-2 g/h.L. After culturing for 16-24h, separately feeding carbon and nitrogen sources, wherein the carbon-nitrogen ratio is controlled to be 5-10: 1.

pH: the pH was controlled to range from 4 to 8 with 4.8M NaOH.

Temperature: the growth phase is 25-35 ℃, and the production phase is 20-30 ℃.

Dissolving oxygen: the dissolved oxygen in the process of jointly controlling the pressure, the ventilation capacity and the rotating speed of the tank is 30-60% of the calibrated saturated dissolved oxygen. The pressure in the tank is 0.03-0.06MPa, the ventilation rate is 0-2000sccm, and the rotation speed is 200-1000 rpm.

After the fermentation tank is completely consumed, the air flow is 1000-. The dissolved oxygen is marked as 100% in the next day, after inoculation, the tank pressure is kept at 0.03-0.06MPa in the fermentation process, and the rotation speed is adjusted to 200-1000rpm, so that the dissolved oxygen is kept at 30-60%. Starting to flow and add the carbon source at the speed of 1-5 g/(L.h) within 16-24h, and starting an automatic defoaming program. The nitrogen source is fed in 24-30h at 0.1-2 g/(L.h). The carbon source flow acceleration is increased by 1-5 g/(L.h) within 48-60 h. The carbon source flow acceleration is increased by 3-6 g/(L.h) within 72-90 h. And ending the nitrogen source feeding within 100-. And ending the carbon source feeding in the period of 120-135 h. 140 and 150h, and ending the fermentation.

FIG. 8 shows a microscopic image of the broth during fermentation. FIG. 9 shows the change in OD600 and residual sugar during fermentation. Therefore, the concentration of the bacterial liquid is gradually increased in the whole fermentation process and is kept stable until 100 hours later; at the same time, the residual sugar gradually decreased, and the decrease was most pronounced in the first 30 h.

As is clear from the comparison of the HPLC analysis results (FIG. 10A) of the cell-containing fermentation broth extract and the HPLC analysis results (FIG. 10B) of the astaxanthin standard substance, astaxanthin was present in the fermentation product at 143 hours, and the content was high, and the carotenoid intermediate impurity content was low. The astaxanthin titer was obtained by the astaxanthin standard curve of fig. 11.

As shown in fig. 12, which is a graph showing the variation of astaxanthin yield in the fermentation process after the 5L tank process optimization, it can be seen that the astaxanthin yield gradually increases and reaches the maximum in about 140 hours, in this example, the astaxanthin content reaches 1.0g/L, and the ratio of astaxanthin to carotenoid is high, the maximum astaxanthin content (82.47%) is reached in 72 hours of fermentation, and then gradually decreases, and 62.16% is still obtained in 143 hours of harvest (fig. 15). The extract of the fermentation broth of the engineered bacterium of this example was subjected to HPLC to identify the structure of astaxanthin, and compared with chemically synthesized astaxanthin (containing three isomers, 3S-3 'S, 3R-3' S and 3R-3 'R), as shown in FIG. 16A, the astaxanthin synthesized by the engineered bacterium of this example was 3S-3' S type; in contrast to FIG. 16B, FIG. 16B is an HPLC chart of an extract from fermentation broth of Phaffia rhodozyma showing that 3R-3' R type astaxanthin is mainly produced by Phaffia rhodozyma.

Compared with batch culture of ECA-1 on a 5L tank using 1 XYPD as fermentation medium, the present method has the advantage that the yield is improved by about 12.5 times compared with the optimized previous method, as shown in FIG. 13, when the fermentation is finished for 120h and the product titer is 80.067 mg/L.

Compared to the use of 2 × YPD as fermentation medium and the feeding of 480g glucose for the fermentation of ECA-1 in a 5L tank, as shown in FIG. 14, the end of the fermentation at 168h gave a product titer of 166.27mg/L, and the optimized fermentation process of the present application gave a yield increase of about 6-fold over the optimized front-end process.

The yarrowia lipolytica engineering bacterium for producing the astaxanthin is constructed by a CRISPR/Cas9 operation system or a random integration method, the yarrowia lipolytica engineering bacterium is fermented to prepare the astaxanthin, and the fermentation process is optimized, so that the yield of the astaxanthin is improved, the biological safety is good, and the production process is simple.

The astaxanthin-producing engineering bacteria provided by the embodiments of the present application, the preparation method and the application thereof are described in detail above, the principles and the embodiments of the present application are explained in the present application by applying specific examples, and the description of the above embodiments is only used to help understanding the method and the core ideas of the present application; meanwhile, for those skilled in the art, according to the idea of the present application, there may be variations in the specific embodiments and the application scope, and in summary, the content of the present specification should not be construed as a limitation to the present application.

Sequence listing

<110> university of east China's college of science

<120> astaxanthin-producing engineering bacterium and preparation method and application thereof

<141> 2021-11-30

<160> 62

<170> SIPOSequenceListing 1.0

<210> 1

<211> 723

<212> DNA

<213> Brevundimonas vesicularis

<400> 1

atggtcgctt cgtcggaacc ctatgtcgcg ccgcgccagg ccctgaaggg cctgatgctc 60

gccgccgccc tgatcggcgc ctggctgggg ctgcatatct acggcgtcta cctgtaccgg 120

tggaccgggt ggagcatcct ggtcgcatcg ctgtgcgtgg ctgtgcaaac ctggctttcg 180

gtcggactgt tcatcgtggc ccacgacgcc atgcatgggt cgctcgcgcc agggcgtccc 240

gctctgaacg ccgcgatcgg gcggttctgt ctggcgatct acgccggctt ccgcttcgac 300

cgcttgaaag ccgcgcactt cgagcaccat cgcgcacccg ggacggcgga cgacccggat 360

tttcatcccg acgacccccg agccttcggc gcctggtttc ttcgcttctt tcgcacctat 420

ttcggttggg ggcagatggc gatcgtgacc gcctacctca tcgccgcctt ggtgctgggc 480

gcccgtttgc cgaaccttct cgccttctgg gccgcgccag ccctgctctc ggcgctgcag 540

ctgttcacct ttggaacgtg gttgccgcat cgttcgggcg atcagccgtt cgcggatcat 600

cacaatgccc gcagcacgca gttcggcgac gtcttatcgt tgctgacctg cttccatttc 660

ggccgacatc atcagcatca cgaagagcct tggcgaccct ggtggcgact gaagggcctg 720

tga 723

<210> 2

<211> 774

<212> DNA

<213> Gloeobacter violaceus

<400> 2

atgatgcgtg gctcggcagt aaaggaacgt acttcgaagc ggcttgccga aggggttatc 60

acccataaga acgattcttc cggcctctgg tgggctctgg tgattatcgg cctgtggatc 120

ttcagtttcg ccgcagcgct gcgcttacct attggcgagt tatcgctgca ggccgtcatc 180

ggcgtggtga tcctcagaac ctttctgcac acaggtctat ttatcactgc ccacgacgcg 240

atgcaccgaa ccgtgtttcc cgccaatcac cgcatcaacg attggcttgg taccgccgcc 300

gtcggtctgt acgcctttat gccctatcgc gaactactga ttaaacatca gttgcaccac 360

cgctttccag ccaccggcaa agaccccgac taccacgacg gcgaacatag cggcttcttt 420

cagtggtact tgaaattcat gaaggactat atggagagcc ggaacacccc gtttttgatc 480

gcgggcatgg ccgtggtgtt cggggtgtgc acttggctga tgggcgttcc gctcgtcaac 540

ctggcgctgt tctggttgtt gccgctggtg ctcagttcct tgcaattgtt ctacttcggc 600

acctacttgc cccaccgaca acccgacggc ggctaccgca accgtcaccg ggccaccagc 660

aaccgtcttt cgagcttctg gtcatttgtc agctgctatc acttcggcta ccactgggag 720

caccacgaat acccgctcgt tccctggcat cggctgcccg aggcgcgccg ctag 774

<210> 3

<211> 777

<212> DNA

<213> Anabaena variabilis

<400> 3

atggttcagt gtcaaccatc atctctacgt gcagaaaaac tggttttatt gtcatcgaca 60

attagggatg ataaaaatat taataagggt atatttgttg cctgttttat cttattttta 120

tgggcaatta gtttaatctt attactctca atagatacat ccataattaa tcagggctta 180

ttaatcatag ccatgctttg gcagacattc ttatatacag gtttatttat tactgcccat 240

gatgccatgc acggcgtagt ttatcccaaa aatcccaaaa taaataattt tataggtaag 300

ctcactctca tcttgtatgg actatttcct tataaagatt tattgaaaaa acattggtta 360

caccacggac atcctggtac tgatttagac cctgattatt acaatggtca tccccaaaac 420

ttctttcttt ggtatctaca ttttatgaag tcttattgga gatggacaca aattttcgga 480

ttagtgatga tttttcacgg acttaaaagt attgtacata taccagaaaa taatttaatt 540

atattttgga tgatcccttc tattttaagt tcagtacaac tattttattt tggtacattt 600

ttaccgcata aaaagctaga aggtggttat actaaccccc attgtgcgcg cagtatccca 660

ttacctcttt tttggtcttt cgtcacttgc tatcacttcg gttaccacaa agagcatcac 720

gaatatcctc aacttccttg gtggaaatta ccggaagctt acaaaatatc tttataa 777

<210> 4

<211> 762

<212> DNA

<213> nostoc punctiforme

<400> 4

atgattcaat tagaacaacc acccagtcat caatcaaagc tgaccccagt ggtgaaaagt 60

aaatctcagt ttaaagggct tttcattgct attgtcattg ttagcgtatg ggtaattagt 120

ttgagtttat tactctccct tgacatctcc aaattacaat tttggatgct atttcccagc 180

atactttggc aaacattttt atatacagga ttatttatta catctcatga tgctatgcat 240

ggggtcgtgt ttcctcagaa cagcaaaatt aatcatctta ttgggacatt aactttatct 300

ttttatggac ttttaccata taaaaaatta ttgaaaaagc attggctaca ccatcacaat 360

ccagcaactc aagtagatcc agattttcat aatggtaact acaaaaactt ctttgcttgg 420

tatttacatt ttatgaaagg ttactggagt tggggacaaa taattgccct aaccctgatt 480

tataactttg ctaaatacat acttcatata cctagtgata atctaagtta cttttgggtc 540

tttccttcgc ttttaagttc attgcaatta ttttattttg gtactttcct cccacatagt 600

gaacctattg gaggttatat tcagcctcat tgtgcccaaa cgattaaccg tccaatttgg 660

tggtcattta ttacgtgcta tcatttcggc taccacgaag aacaccacga atatcctcat 720

attccttggt ggcagttacc agaaatttac aaagcaaaat ag 762

<210> 5

<211> 777

<212> DNA

<213> nostoc sp. PCC 7120

<400> 5

atggttcagt gtcaaccatc atctctgcat tcagaaaaac tggtgttatt gtcatcgaca 60

atcagagatg ataaaaatat taataagggt atatttattg cctgctttat cttattttta 120

tgggcaatta gtttaatctt attactctca atagatacat ccataattca taagagctta 180

ttaggtatag ccatgctttg gcagaccttc ttatatacag gtttatttat tactgctcat 240

gatgccatgc acggcgtagt ttatcccaaa aatcccagaa taaataattt tataggtaag 300

ctcactctaa tcttgtatgg actactccct tataaagatt tattgaaaaa acattggtta 360

caccacggac atcctggtac tgatttagac cctgattatt acaatggtca tccccaaaac 420

ttctttcttt ggtatctaca ttttatgaag tcttattggc gatggacgca aattttcgga 480

ttagtgatga tttttcatgg acttaaaaat ctggtgcata taccagaaaa taatttaatt 540

atattttgga tgataccttc tattttaagt tcagtacaac tattttattt tggtacattt 600

ttgcctcata aaaagctaga aggtggttat actaaccccc attgtgcgcg cagtatccca 660

ttacctcttt tttggtcttt tgttacttgt tatcacttcg gctaccacaa ggaacatcac 720

gaataccctc aacttccttg gtggaaatta cctgaagctc acaaaatatc tttataa 777

<210> 6

<211> 1335

<212> DNA

<213> Chlamydomonas reinhardtii

<400> 6

atgggccctg ggatacaacc cacttccgcg cgaccgtgtt ctaggaccaa acacagtcga 60

tttgcgctac ttgccgcagc gctgaccgca cgacgcgtca agcagttcac gaagcagttc 120

cgctcgcgta ggatggcgga ggacatactg aagctgtggc agcgccaata tcacctgccg 180

cgcgaggatt ctgacaagcg cacgctgcgc gagcgcgttc acctgtaccg cccgccgcgt 240

tcagacctag gtggcattgc ggtcgctgtg acagtcatcg cgctgtgggc gacgctgttt 300

gtctacgggc tgtggttcgt caagctgcca tgggcgctca aagtgggcga gacagccacg 360

tcctgggcaa ccattgctgc tgtattcttt agcctggaat tcctttacac cgggctcttc 420

atcaccacgc acgacgcgat gcatggcacc atcgcgctgc gcaaccggcg cctgaacgac 480

tttctgggcc agctggcaat cagcctatac gcctggtttg actactccgt cctgcaccgc 540

aagcactggg agcaccacaa ccacaccggg gagccgcgtg tggatccgga cttccaccgc 600

ggcaacccca acctggcggt gtggttcgcg cagttcatgg tgtcgtacat gaccctcagc 660

cagttcctca agatcgcggt ctggtccaac ctgctgctgc tggcgggtgc gccgctggcc 720

aaccagctgc tgttcatgac ggcggcgccc atcctgtccg ccttccgcct gttctactac 780

ggcacctacg tgccgcacca cccggagaag gggcacaccg gcgccatgcc ctggcaggta 840

tcccgcacca gctccgcctc ccggctgcag tcgttcctca cctgctacca cttcgacctg 900

cactgggagc accaccgctg gccctacgcg ccctggtggg agctgcccaa gtgccgccag 960

attgcccgcg gcgcagccct ggcgcccggg ccgctgcccg tgccggcagc ggcggcggct 1020

acagccgcca ccgcggcggc ggcagcagca gctacaggca gccccgctcc cgccagccga 1080

gcagggtcag cttcctccgc ctccgcagcg gcctccggat ttggatccgg acacagcggc 1140

tctgtggctg cgcagccgct gtcttcgctg cccttgctga gcgagggcgt gaaggggttg 1200

gtggaggggg cgatggagtt ggtggcaggt ggcagcagca gcggcggtgg tggagagggc 1260

ggcaagccgg gcgcggggga gcacgggctg ctgcagcggc agcggcagct ggcgcctgtt 1320

ggcgtgatgg cttga 1335

<210> 7

<211> 729

<212> DNA

<213> Agrobacterium aurantiacum

<400> 7

atgagcgcac atgccctgcc caaggcagat ctgaccgcca ccagcctgat cgtctcgggc 60

ggcatcatcg ccgcttggct ggccctgcat gtgcatgcgc tgtggtttct ggacgcagcg 120

gcgcatccca tcctggcgat cgcaaatttc ctggggctga cctggctgtc ggtcggattg 180

ttcatcatcg cgcatgacgc gatgcacggg tcggtggtgc cggggcgtcc gcgcgccaat 240

gcggcgatgg gccagcttgt cctgtggctg tatgccggat tttcgtggcg caagatgatc 300

gtcaagcaca tggcccatca ccgccatgcc ggaaccgacg acgaccccga tttcgaccat 360

ggcggcccgg tccgctggta cgcccgcttc atcggcacct atttcggctg gcgcgagggg 420

ctgctgctgc ccgtcatcgt gacggtctat gcgctgatcc ttggggatcg ctggatgtac 480

gtggtcttct ggccgctgcc gtcgatcctg gcgtcgatcc agctgttcgt gttcggcacc 540

tggctgccgc accgccccgg ccacgacgcg ttcccggacc gccacaatgc gcggtcgtcg 600

cggatcagcg accccgtgtc gctgctgacc tgctttcact ttggcggtta tcatcacgaa 660

caccacctgc acccgacggt gccgtggtgg cgcctgccca gcacccgcac caagggggac 720

accgcatga 729

<210> 8

<211> 528

<212> DNA

<213> pantoea ananatis

<400> 8

atgaagggcc tacgcccgag taggaggggc gggacgcgta gagaccgtcg cgggcgagat 60

cgcggtacag aaagggcctc gcagcggact tcaaaactgt ccccgccgcg tatctccttc 120

ggttttcttt gtgttggaag aaacggggac tgccgcacta cgtatgccac gcggtatatg 180

ttggcaaact ccatcgggaa cgcaccttat atcgccttac cggttgcaac tacgtggtcg 240

ggcagcacgt ggtattttat ctcattaggt atgcggcagt atggacgcgg ttaggtgacc 300

tcgccggtgt aaggacatga cgggtctatt tagtcgtcct agctattacg tcgtttttgg 360

tgccgtattt ctagcaattg aagtttgcgt ggaaatgcgc caagtactac actttctacg 420

gtaggggttg gggtcggcac gtactacata aacacacggt cacgtcgtta gtgaaggtac 480

ggttagtgcc attgcttttg ctagtcccgt aaggtttagg tgttgtat 528

<210> 9

<211> 486

<212> DNA

<213> Brevundimonas vesicularis

<400> 9

atgtcttggc cgacgatgat cctgctgttc ttcgccacct tcctggggat ggaggtcttc 60

gcctgggcga tgcatcgcta tgtcatgcac ggcctgctgt ggacctggca ccgtagccac 120

catgagccgc acgacgacgt gctggaaaag aacgacctgt tcgccgtggt gttcgccgcc 180

ccggccatca tcctcgtcgc cttgggcctg catctgtggc cttgggcgct gccgatcggc 240

ctgggcgtca cggcctatgg actggtctat ttcttcttcc acgacgggct ggtgcatcgc 300

cggttcccga cgggaatcgc tggccgctca gggttctgga cgcggcgcat tcaggcccac 360

cggctgcatc acgcggtgcg gacgcgtgag ggctgcgtgt cgttcggctt cctgtgggtg 420

cggtcggcgc gcgcgctgaa ggccgaactg tctcagaagc gcggcgcttc cagcaacggc 480

gcctga 486

<210> 10

<211> 486

<212> DNA

<213> Brevundimonas sp.

<400> 10

atgtccgtga tctccatgat cctgctgttt gtcgcgacgt tcgtcggcat ggaggcgttc 60

gcgtgggcga tgcaccgcta tgtgatgcat ggcccgatgt gggactggca tcgcagccac 120

catgagccgc acgacggggt gctggagaag aacgatctgt tcgccgtcgt atttgccgct 180

ccggcgatcg tgctgatcgc tcttggcctg catgtctggc cgtgggcgct gccggcggga 240

ttgggcgtga cggcctacgg gctggtttac ttcatcttcc acgacggcct ggttcaccgc 300

cgttttccca ccggcatcga cggccgctcg cccttctggc gccggcggat ccaggcccac 360

cggttgcacc acgcgatccg gacgcgcgag aactgcgtct cgtttggatt tctgtgggtt 420

cggtccgccc gctcgctgaa ggccgaactc gctcagaagc tcggctcttc cagaagcggc 480

gcctga 486

<210> 11

<211> 528

<212> DNA

<213> pantoea stewartii

<400> 11

atgttgtgga tttggaatgc cctgatcgtg tttgtcaccg tggtcggcat ggaagtggtt 60

gctgcactgg cacataaata catcatgcac ggctggggtt ggggctggca tctttcacat 120

catgaaccgc gtaaaggcgc atttgaagtt aacgatctct atgccgtggt attcgccatt 180

gtgtcgattg ccctgattta cttcggcagt acaggaatct ggccgctcca gtggattggt 240

gcaggcatga ccgcttatgg tttactgtat tttatggtcc acgacggact ggtacaccag 300

cgctggccgt tccgctacat accgcgcaaa ggctacctga aacggttata catggcccac 360

cgtatgcatc atgctgtaag gggaaaagag ggctgcgtgt cctttggttt tctgtacgcg 420

ccaccgttat ctaaacttca ggcgacgctg agagaaaggc atgcggctag atcgggcgct 480

gccagagatg agcaggacgg ggtggatacg tcttcatccg ggaagtaa 528

<210> 12

<211> 528

<212> DNA

<213> Erwinia uredovora

<400> 12

atgttgtgga tttggaatgc cctgatcgtt ttcgttaccg tgattggcat ggaagtggtt 60

gctgcactgg cacacaaata catcatgcac ggctggggtt ggggatggca tctttcacat 120

catgaaccgc gtaaaggtgc gtttgaagtt aacgatcttt atgccgtggt ttttgctgca 180

ttatcgatcc tgctgattta tctgggcagt acaggaatgt ggccgctcca gtggattggc 240

gcaggtatga cggcgtatgg attactctat tttatggtgc acgacgggct ggtgcatcaa 300

cgttggccat tccgctatat tccacgcaag ggctacctca aacgattgta tatggcgcac 360

cgtatgcatc acgccgtcag gggcaaagaa ggttgtgttt cttttggctt cctctatgcg 420

ccgcccctgt caaaacttca ggcgacgctc cgggaaagac atggcgctag agcgggcgct 480

gccagagatg cgcagggcgg ggaggatgag cccgcatccg ggaagtaa 528

<210> 13

<211> 456

<212> DNA

<213> Sulfolobus solfataricus

<400> 13

atgatgctca tatactatgt ggggatggcg gtactaacgt ttgtaggcat ggaattcgta 60

gccagattaa tgcataaata cgttatgcat ggtttactct ggtttatcca tgaggatcat 120

cataaggaaa aacaagctga gctcgaaaaa aatgacctat ttggtttagt gtttgccagt 180

gtgtcggttt accttttctt tttaggcata caaggaagtt atgtagcttt aagcatagct 240

attggtatga gtagttatgg aatagcttat ttcttcattc atgatatggt gatccacgat 300

agacatttac atttaagatc ttggggttta aagcatagac ctttcaagga tttgatactg 360

gttcacgaca ttcatcacaa ggaaggaaag ggcaattggg gatttttgtt cgttataaag 420

ggtttagata aggttccgat tttgaaggat gaatag 456

<210> 14

<211> 528

<212> DNA

<213> pantoea agglomerans

<400> 14

atgttgtgga tttggaatgc cctgattgtt ctggtcactg ttatcggaat ggagataacg 60

gctgcactgg cgcacagata cattatgcat ggctggggtt ggggctggca tctgtcacat 120

catgaaccgc ataaaggctg gtttgaggtt aatgacctct atgccgtagt gttcgccgct 180

ctgtcgattt tgctcattta tctgggcagt acgggtgtct ggcccttgca gtggatcggg 240

gcgggtatga cgctctacgg cctgctctat tttattgtgc atgacggcct ggtgcatcag 300

cgctggccat tccgctatgt tccgcgcagg ggttatttac gcaggcttta tatggcgcac 360

cgcatgcatc atgcggtacg aggcaaagag ggctgtgtct cgtttggctt tctttacgcg 420

ccgccgctgt caaaactgca ggcgacgctg cgagaacgcc atggcgttaa acggggcgct 480

gccagagatc agcggagcgt ggagcgtgac gcgccacccg ggaagtaa 528

<210> 15

<211> 882

<212> DNA

<213> Anabaena variabilis

<400> 15

atgctcacgt cggaggcaca aaagccactg acaatcccac ccaaagaact tttagcacct 60

cctggtgatt ttaatcccac actactcatg ttttttgtag tggtgacaat gttggtgtta 120

tctaactttg gttattgggt ttgggaatgg ccgcattggc tatgctttag cattaacact 180

ctggccttgc attgttctgg aacaataatt cacgatgctt gtcaccagtc agctcatcgc 240

aaccgtgtga ttaatgccat gttagggcat tgtagtgcct taattttagc ttttgctttt 300

ccagttttta cacgggtaca tttgcagcat catggtaatg tgaatcatcc tcaagatgac 360

cctgatcatt atgtctctac aggtggtcca ttgtggttga ttgcagtcag atttttatac 420

catgaggtat ttttctttca acggcaattg tggcggaaat atgagttact ggaatggttt 480

attagccgtt taattgtcat tactattgtt tatatttctg tccaatatca cttcttgggc 540

tatattctca atttttggtt tattccggcg ttcttggtag gaattgcctt ggggttattt 600

tttgattatt taccccatcg tccctttgtg gaaagaagtc gctggaaaaa tgcccgcgtc 660

tatcctggta aagttctcaa tatcctgatt ctggggcaga attaccattt agttcatcat 720

ttgtggcctt cgattccttg gtataattac cagccggctt attatttgat gaagccgtta 780

ttggatgaaa agggtagtcc gcaaacttca ggattgttgc agaaaaagga cttttttgag 840

tttgtctatg atgttttcat aggtattaga tttcatcact ga 882

<210> 16

<211> 939

<212> DNA

<213> Synechocystis PCC6803

<400> 16

atgtgccagg agtccgtcat agtaatgcag gcgacccaac cgctgcaaac cgtttcccaa 60

gctgtcccaa aagagttttt acaggcggac ggcggcttca atcccaacgt ggccatgttc 120

gggatagcta ttctcttaat gctcgctaac gtttttggct actggcaatg ggggctgccc 180

cactggcttt gttttagttg ttcggtgctg gcgctgcacc tgtcaggcac agtgatccat 240

gatgcatccc acaatgcggc ccatcggaac accattatta atgcagtgct tggccacggt 300

agtgccttaa tgttgggctt tgcttttccc gtctttaccc gggttcatct ccaacaccac 360

gccaacgtca atgaccctga aaatgaccca gaccattttg tttccaccgg cggtcccctc 420

ttcctcattg ccgcccggtt cttctaccat gagatctttt tctttaaacg gcggttatgg 480

cgcaaatatg agctactaga gtggttctta agtcggcttg tgttgttcac gatcgttttt 540

ctcggcattc attacggctt tatcggcttt gtgatgaatt actggtttgt gcctgcttta 600

attgttggca ttgccctggg actgtttttt gattacctgc cccatcgacc tttccaagaa 660

cgcaaccgtt ggaaaaatgc cagggtttat cccagcccca ttttaaattg gctcattttc 720

gggcaaaatt accacctgat ccaccacctt tggccttcta ttccttggta tcagtaccaa 780

aacacctatc acatcaccaa gcccattttg gatgagaagg gttgtgatca atccctggga 840

ttactggaag ggaaaaattt ctggagcttc ctctatgatg ttttccttgg tattcgtttt 900

cacggccata ataattctca atcatctgac aagccctag 939

<210> 17

<211> 879

<212> DNA

<213> haematococcus lacustris

<400> 17

atgctgtcga agctgcagtc aatcagcgtc aaggcccgcc gcgctgaact agcccgcgac 60

atcacgcggc ccaaagtctg cctgcatgct cagcggtgct cgttagttcg gctgcgagtg 120

gcagcaccac agacagaggg ggcggtggga accgtgcagg ctgccggcgc gggcgatgag 180

cacagcgccg atgtagcact ccagcagctt gaccgggcta tcgcagagcg tcgtgcccgg 240

cgcaaacggg agcagctgtc ataccaggct gccgccattg cagcatcaat tggcgtgtca 300

ggcattgcca tcttcgccac ctacctgaga tttgccatgc acatgaccgt gggcggcgca 360

gtgccatggg gtgaagtggc tggcactctc ctcttggtgg ttggtggtgc gctcggcatg 420

gagatgtatg cccgctatgc acacaaagcc atctggcatg agtcgcctct gggctggctg 480

ctgcacaaga gccaccacac acctcgcact ggaccctttg aagccaacga cttgtttgca 540

atcatcaatg gactgcccgc catgctcctg tgtacctttg gcttctggct gcccaacgtc 600

ctgggggcgg cctgctttgg cgcggggctg ggcatcacgc tatacggcat ggcatatatg 660

tttgtacacg atggcctggt gcacaggcgc tttcccaccg ggcccatcgc tggcctgccc 720

tacatgaagc gcctgacagt ggcccaccag ctacaccaca gcggcaagta cggtggcgcg 780

ccctggggca tgttcttggg gccacaggag ctgcagcaca ttccaggtgc ggcggaggag 840

gtggagcgac tggtcctgga actggactgg tccaagcgg 879

<210> 18

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 18

atgaagggcc tacgcccg 18

<210> 19

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 19

atacaacacc taaaccttac gggac 25

<210> 20

<211> 31

<212> DNA

<213> Artificial Sequence

<400> 20

attcaaaggc gcgccatggt cgcttcgtcg g 31

<210> 21

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 21

ttacatgagg ctagctcaca ggcccttcag tcg 33

<210> 22

<211> 31

<212> DNA

<213> Artificial Sequence

<400> 22

attcaaaggc gcgccatgat gcgtggctcg g 31

<210> 23

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 23

ttacatgagg ctagcctagc ggcgcgcc 28

<210> 24

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 24

attcaaaggc gcgccatggt tcagtgtcaa ccatcatc 38

<210> 25

<211> 50

<212> DNA

<213> Artificial Sequence

<400> 25

ttacatgagg ctagcttata aagatatttt gtaagcttcc ggtaatttcc 50

<210> 26

<211> 41

<212> DNA

<213> Artificial Sequence

<400> 26

attcaaaggc gcgccatgat tcaattagaa caaccaccca g 41

<210> 27

<211> 48

<212> DNA

<213> Artificial Sequence

<400> 27

ttacatgagg ctagcgccta ttttgctttg taaatttctg gtaactgc 48

<210> 28

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 28

attcaaaggc gcgccatggt tcagtgtcaa ccatcatc 38

<210> 29

<211> 50

<212> DNA

<213> Artificial Sequence

<400> 29

ttacatgagg ctagcttata aagatatttt gtgagcttca ggtaatttcc 50

<210> 30

<211> 31

<212> DNA

<213> Artificial Sequence

<400> 30

attcaaaggc gcgccatggg ccctgggata c 31

<210> 31

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 31

ttacatgagg ctagctcaag ccatcacgcc aac 33

<210> 32

<211> 31

<212> DNA

<213> Artificial Sequence

<400> 32

attcaaaggc gcgccatgag cgcacatgcc c 31

<210> 33

<211> 32

<212> DNA

<213> Artificial Sequence

<400> 33

ttacatgagg ctagctcatg cggtgtcccc ct 32

<210> 34

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 34

attcaaaggc gcgccatgtc ttggccgacg atg 33

<210> 35

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 35

ttacatgagg ctagctcagg cgccgttgc 29

<210> 36

<211> 37

<212> DNA

<213> Artificial Sequence

<400> 36

attcaaaggc gcgccatgtc cgtgatctcc atgatcc 37

<210> 37

<211> 31

<212> DNA

<213> Artificial Sequence

<400> 37

ttacatgagg ctagctcagg cgccgcttct g 31

<210> 38

<211> 37

<212> DNA

<213> Artificial Sequence

<400> 38

attcaaaggc gcgccatgtt gtggatttgg aatgccc 37

<210> 39

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 39

ttacatgagg ctagcttact tcccggatga agacgtatcc 40

<210> 40

<211> 37

<212> DNA

<213> Artificial Sequence

<400> 40

attcaaaggc gcgccatgtt gtggatttgg aatgccc 37

<210> 41

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 41

ttacatgagg ctagcttact tcccggatgc ggg 33

<210> 42

<211> 42

<212> DNA

<213> Artificial Sequence

<400> 42

attcaaaggc gcgccatgat gctcatatac tatgtgggga tg 42

<210> 43

<211> 45

<212> DNA

<213> Artificial Sequence

<400> 43

ttacatgagg ctagcctatt catccttcaa aatcggaacc ttatc 45

<210> 44

<211> 37

<212> DNA

<213> Artificial Sequence

<400> 44

attcaaaggc gcgccatgtt gtggatttgg aatgccc 37

<210> 45

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 45

ttacatgagg ctagcgctta cttcccgggt ggcg 34

<210> 46

<211> 31

<212> DNA

<213> Artificial Sequence

<400> 46

attcaaaggc gcgccatgct cacgtcggag g 31

<210> 47

<211> 48

<212> DNA

<213> Artificial Sequence

<400> 47

ttacatgagg ctagctcagt gatgaaatct aatacctatg aaaacatc 48

<210> 48

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 48

attcaaaggc gcgccatgtg ccaggagtcc gtc 33

<210> 49

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 49

ttacatgagg ctagcctagg gcttgtcaga tgattgag 38

<210> 50

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 50

attcaaaggc gcgccatgct gtcgaagctg cag 33

<210> 51

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 51

ttacatgagg ctagcccgct tggaccagtc cag 33

<210> 52

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 52

atacgagatg agtgccaaag 20

<210> 53

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 53

gtaccaagga agcatgcggt ggagtggaac ttggacag 38

<210> 54

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 54

cacagcttgt cactttgcg 19

<210> 55

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 55

catgtccagt gaagcctcc 19

<210> 56

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 56

agttcacttt ggacaccttc tat 23

<210> 57

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 57

ctgtccaagt tccactccac cgcatgcttc cttggtac 38

<210> 58

<211> 41

<212> DNA

<213> Artificial Sequence

<400> 58

atagaaggtg tccaaagtga actcaagccc gacaactacg t 41

<210> 59

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 59

atgctgtcga agctgcag 18

<210> 60

<211> 48

<212> DNA

<213> Artificial Sequence

<400> 60

gctgcccggg ccaccgctgc caccgccacc ccgcttggac cagtccag 48

<210> 61

<211> 46

<212> DNA

<213> Artificial Sequence

<400> 61

ggtggcggtg gcagcggtgg cccgggcagc atgggccctg ggatac 46

<210> 62

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 62

tcaagccatc acgccaac 18

Claims (11)

1. An engineering bacterium for producing astaxanthin, which is characterized in that the genome of the engineering bacterium for producing astaxanthin comprises a beta-carotene ketolase gene and a beta-carotene hydroxylase gene, wherein the beta-carotene ketolase gene is selected from genes obtained by performing codon optimization on any one sequence shown in SEQ ID No. 1-SEQ ID No. 7; and/or the beta-carotene hydroxylase gene is selected from a gene obtained by performing codon optimization on any one sequence shown in SEQ ID NO. 8-SEQ ID NO. 17.

2. The engineered bacterium of claim 1, wherein said engineered bacterium is yarrowia lipolytica.

3. A method for preparing an engineering bacterium for producing astaxanthin is characterized by knocking beta-carotene ketolase gene and beta-carotene hydroxylase gene into the genome of yarrowia lipolytica engineering bacterium auxotrophic for uracil and leucine, and replenishing screening markers for uracil and leucine to obtain the engineering bacterium for producing astaxanthin.

4. The process according to claim 2, wherein the β -carotene ketolase gene is selected from the group consisting of genes obtained by codon-optimizing any one of the sequences represented by SEQ ID No.1 to SEQ ID No. 7; and/or the beta-carotene hydroxylase gene is selected from a gene obtained by performing codon optimization on any one sequence shown in SEQ ID NO. 8-SEQ ID NO. 17.

5. The method of claim 2, wherein the β -carotene ketolase gene and the β -carotene hydroxylase gene are knocked into the genome of the uracil and leucine auxotrophic yarrowia lipolytica engineering bacterium separately or in tandem using the CRISPR/Cas9 operating system or random integration method.

6. The method according to claim 2, wherein the yarrowia lipolytica auxotrophic for uracil and leucine is a β -carotene-producing yarrowia lipolytica.

7. The preparation method of claim 4, wherein when the CRISPR/Cas9 operation system is adopted for gene knock-in, a Cas9/sgRNA expression plasmid and a homologous DNA donor plasmid are constructed, and the Cas9/sgRNA expression plasmid and the homologous DNA donor plasmid are transformed into the uracil and leucine auxotrophic yarrowia lipolytica engineering bacterium.

8. Use of the astaxanthin-producing engineered bacterium of claim 1 in the preparation of astaxanthin.

9. A method for producing astaxanthin, which comprises fermenting the astaxanthin-producing engineered bacterium according to claim 1 or the astaxanthin-producing engineered bacterium produced by the production method according to any one of claims 2 to 6 to produce astaxanthin having a 3S-3' S configuration.

10. A process for the production of astaxanthin according to claim 8, wherein the fermentation medium used for the fermentation comprises:

the components of the feed medium include:

glucose: 400-600 g/L;

yeast extract (B): 10-20 g/L;

tryptone: 20-40 g/L.

11. The method for producing astaxanthin according to claim 8, wherein separate feeding of the carbon source and the nitrogen source is started after 16 to 24 hours of cultivation, and the ratio of the carbon source to the nitrogen source is controlled to 5 to 10: 1; and/or controlling the dissolved oxygen to be 30-60% of the calibrated saturated dissolved oxygen in the fermentation; and/or the astaxanthin accounts for 60-85% of the carotenoid in the fermentation product.

Images