CN105274135A - RNAi vector widely used for multi-plant gene silencing and application - Google Patents
RNAi vector widely used for multi-plant gene silencing and application Download PDFInfo
- Publication number
- CN105274135A CN105274135A CN201510521004.9A CN201510521004A CN105274135A CN 105274135 A CN105274135 A CN 105274135A CN 201510521004 A CN201510521004 A CN 201510521004A CN 105274135 A CN105274135 A CN 105274135A
- Authority
- CN
- China
- Prior art keywords
- carrier
- cmv
- ocs
- phannibal
- rnai
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The present invention discloses a RNAi vector widely used for multi-plant gene silencing and application, and belongs to the field of biotechnology. The vector is constructed by use of pCAMBIA1300 carrier as a skeleton and insertion of Promoter (CMV), PDK and Terminator 1 (OCS) sequence into pHANNIBAL carrier, the vector construction comprises the following steps: first, through PCR amplification and restriction endonuclease enzyme digestion connection technology, CMV and OCS containing enzyme digestion sites are sequentially connected with the pCAMBIA1300 carrier; and second, PDK is inserted between the CMV and OCS for eventually forming pC1300-pHANNIBAL carrier. The vector is a binary expression vector which can be integrated into a plant genome, and can be stably inherited and expressed in a plant host cell, and the vector is a convenient, reliable, economical and practical means of gene silencing.
Description
Technical field
The present invention relates to biological technical field, be specifically related to a kind of structure and the application thereof that are widely used in the RNAi carrier of various plants gene silencing.
Background technology
Gene silencing is research gene expression regulation and discloses the important way that essence is expressed in body molecular genetic aspect.RNA interference (RNAi) is a kind of conventional gene silencing methods, realizes expression of specific gene lower by artificially design and the RNA interfering of specific gene mRNA homology.
RNAi carrier is the prerequisite successfully realizing silencing specific genes, can carry out gene removal, and gene functional research or genetically modified crops are cultivated.Existing commercial RNAi carrier is used for animal host cell, and minority can be used for the RNAi carrier of plant, as pHANNIBAL, but is non-binary expression vector, can not be used for agriculture bacillus mediated Genetic Transformation in Higher Plants.
Through finding prior art literature search, not yet find the report about pC1300-pHANNIBAL plant gene silencing carrier and structure.
Summary of the invention
The object of the invention is to enrich plant RNA i carrier storehouse, the RNAi carrier being widely used in plant gene silencing that is new be provided---pC1300-pHANNIBAL carrier.Another object of the present invention is to provide the above-mentioned construction process and the application thereof that are widely used in the RNAi carrier of various plants gene silencing.
Main technical schemes of the present invention is: by point fragment of the CMV-PDK-OCS on pHANNIBAL by pcr amplification and digestion with restriction enzyme, interconnection technique, and the multiple clone site being connected into pCAMBIA1300 binary vector successively builds and obtains pC1300-pHANNIBAL carrier.The pC1300-pHANNIBAL carrier that the present invention obtains is a binary expression vector that can express in bacterium and can express in plant.By by positive and negative for target gene fragment insertion pC1300-pHANNIBAL carrier PDK two ends, obtain the RNAi carrier of target gene; Through gene transformation, obtain corresponding transgenic line; Finally realize the target of gene silencing or gene functional research.
A first aspect of the present invention, there is provided a kind of rna interference vector, i.e. a kind of RNAi carrier being widely used in various plants gene silencing, this carrier is based on plant binary expression vector pCAMBIA1300, the CMV promoter deriving from pHANNIBAL carrier is inserted at multiple clone site place, PDK intron and OCS terminator, final formation pC1300-pHANNIBAL carrier.
Wherein, described CMV and OCS is obtained by pcr amplification, cuts, connects and insert pCAMBIA1300 successively, obtain pC1300-CMV-OCS through enzyme; Described PDK directly cuts from pHANNIBAL enzyme and obtains, and between CMV and OCS then inserting pC1300-CMV-OCS, obtains pC1300-pHANNIBAL;
In this carrier, containing 3 polyclone restriction enzyme sites (SacI, NcoI and KpnI) between described CMV and PDK, the fragment of target gene can be inserted by forward; Containing 4 restriction enzyme sites (HindIII, BamHI, XbaI and SalI) between PDK and OCS, BamHI, XbaI and SalI are single endonuclease digestion site, oppositely can insert the fragment of target gene.
Wherein said CMV promoter, its nucleotides sequence is classified as shown in SEQIDNO:1.
Wherein said PDK intron, its nucleotides sequence is classified as shown in SEQIDNO:2.
Wherein said OCS terminator, its nucleotides sequence is classified as shown in SEQIDNO:3.
Wherein said pC1300-pHANNIBAL carrier, its nucleotides sequence is classified as shown in SEQIDNO:4.
A second aspect of the present invention, there is provided the above-mentioned construction process being widely used in the RNAi carrier of various plants gene silencing, comprises following steps:
Step one, utilizes F35S, and the promotor CMV on R35S amplification pHANNIBAL, connects Blunt-zero carrier, obtain correct intermediate carrier Blunt-CMV;
Step 2, double digestion Blunt-CMV, is connected on pCAMBIA1300, obtains 1300-CMV;
Step 3, utilizes OCSF, and the terminator OCS on OCSR amplification pHANNIBAL, connects Blunt-zero carrier, obtain correct intermediate carrier Blunt-OCS;
Step 4, double digestion Blunt-OCS, is connected on 1300-CMV, obtains 1300-CMV – OCS;
Step 5, the PDK fragment on double digestion pHANNIBAL, is connected on 1300-CMV – OCS, and final structure obtains pC1300-pHANNIBAL carrier.
F35S is utilized wherein described in step one, the R35S promotor CMV increased on pHANNIBAL refers to the F35S containing EcoRI restriction enzyme site and the R35S containing SacI and NcoI restriction enzyme site as primer, described F35S is as shown in SEQIDNO:5, and R35S is as shown in SEQIDNO:6.
OCSF is utilized wherein described in step 3, the OCSR terminator OCS increased on pHANNIBAL refers to the OCSF containing XbaI and SalI restriction enzyme site and the OCSR containing HindIII restriction enzyme site as primer, described OCSF is as shown in SEQIDNO:7, and OCSR is as shown in SEQIDNO:8.
Further, present invention also offers a kind of host cell, this host cell comprises the gene shown in SEQIDNO:4.
Described host cell is intestinal bacteria (Escherichiacoli) or Agrobacterium (Agrobacterium).
A third aspect of the present invention, there is provided the above-mentioned application of RNAi carrier in gene transformation being widely used in various plants gene silencing.
Further, present invention also offers the above-mentioned application of RNAi carrier in preparation transgenic plant being widely used in various plants gene silencing.
RNAi carrier mentioned by the present invention is a kind of general utility tool, and the application in gene transformation and in preparation transgenic plant, specifically can see embodiment 3 and embodiment 4.
Beneficial effect of the present invention is as follows:
The present invention successfully obtains and can be incorporated in various plants genome, and can genetic stability, expression for gene silencing RNAi carrier---pC1300-pHANNIBAL, be a kind of convenient and reliable, economical and practical gene silencing means; In addition, this carrier has been used successfully to and has built sweet wormwood TAR1 gene, woaded blue PLR gene, and the isogenic RNAi carrier of the red sage root MYC2a, MYC2b, realize TAR1 gene, PLR gene and the isogenic silence of MYC2a, MYC2b like a bomb, and successfully carry out correlation function research and the Plant secondary metabolic engineering of these genes.
PC1300-pHANNIBAL carrier can be widely used in the research of multiple species gene function, genetic modification, and molecular breeding etc. all have very important value in fundamental research and agriculture production.
Accompanying drawing explanation
Fig. 1 is pC1300-pHANNIBAL vector construction schematic diagram.
Fig. 2 is TAR1-RNAi carrier schematic diagram.
Fig. 3 is that TAR1-RNAi transgene abrotanum PCR identifies that electrophorogram: 1-28 represents different TAR1-RNAi transgenic lines, and P represents positive control, and M is that MakerDL2000, N represent negative control.
Fig. 4 is TAR1-RNAi transgene abrotanum quantitative PCR result: Control, is wild type control; RNAi-numeral is different TAR1-RNAi transgenic line.
Fig. 5 is TAR1-RNAi transgene abrotanum assay result: A-C, respectively Artemisinin, arteannuinic acid and the dihydroartemisinic acid assay result in leaf; D-F, respectively Artemisinin, arteannuinic acid and the dihydroartemisinic acid assay result in petal.
Fig. 6 is PLR-RNAi carrier schematic diagram.
Fig. 7 is that PLR-RNAi transgenosis woaded blue hairly root PCR identifies that electrophorogram: M is that MakerDL2000, P represent positive control, and WT represents negative control, and 1-5 represents different PLR-RNAi transgenosis woaded blue hairly root.Rolb is a fragment gene sequence of Ri plasmid; Hpt is one section of sequence of hygromycin gene; Intron, gene order and partial vector sequences.
Fig. 8 is PLR-RNAi transgenosis woaded blue hairly root quantitative PCR result: WT is wild type control; CK is empty carrier non-transgenic control; I-numeral is different PLR-RNAi transgenosis woaded blue hairly root.
Fig. 9 is PLR-RNAi transgenosis woaded blue hairly root lariciresinol content situation: A, lariciresinol Content measurement result; B, PLR-RNAi positive woaded blue hairly root Phloroglucinol-hydrochloric acid coloration result.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.These embodiments are only not used in for illustration of the present invention and limit the scope of the invention.When not deviating from spirit of the present invention and essence, the amendment make the inventive method, step or condition or replacement all belong to scope of the present invention.
The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition, such as Sambrook equimolecular clone: laboratory manual (NewYork:ColdSpringHarborLaboratoryPress, 1989) condition described in, or according to the condition that manufacturer advises.
The clone of embodiment 1:CMV promotor and OCS terminator
1.pHANNIBAL plasmid extraction
Picking contains the Trans1-T1 intestinal bacteria (purchased from TransGenBiotech) of pHANNIBAL carrier, (yeast extract 5g is taken prior to 750 μ lLB substratum, Tryptones 10g, NaCl10g is dissolved in 1L water jointly, regulate pH=7.0, after 121 DEG C of sterilizings, be cooled to 50 DEG C, add the ammonia benzyl microbiotic that final concentration is 100mg/L) middle overnight incubation; Inoculate 20 μ l bacterium liquid in 20mlLB substratum, incubated overnight; Thalline (every 5ml bacterium liquid is collected as a pipe) is collected with the centrifugal 1min of 1.5mlEP pipe 12000rpm.
100 μ l solution I (glucose 50mmol/L, Tris-Cl25mmol/L, EDTA10mmol/L, pH=8.0) are added, resuspended precipitation in thalline; Add 200 μ l solution II (H again
2o8ml, 10%SDS1ml, 2MNaOH1ml), soft upset EP manages, and becomes clarification 5 ~ 6 times to solution; Add 150 μ l solution III (H
2o28.5ml, glacial acetic acid 11.5ml, 5MKAc60ml), softly overturn, to solution, occur white suspension thing, EP pipe is positioned over 15min, the then centrifugal 10min of 12000rpm under-20 DEG C of conditions; Supernatant is proceeded in another clean EP pipe; Add 2 times of volume dehydrated alcohols, place 30min for-20 DEG C; 12000rpm is centrifugal, and 10min abandons supernatant, and precipitation uses 75% washing with alcohol; 12000rpm is centrifugal, and 3min abandons supernatant, and precipitation room temperature is dried, and finally adds 40 μ l water dissolution, namely can be used for vector construction or transform using.
2.CMV promotor is cloned
With the plasmid obtained in the abovementioned steps 1 of the present embodiment for template, with the F35S:GC containing EcoRI restriction enzyme site
gAATTCtCGACGAATTAATTCCAATCCCACA (SEQIDNO:5) and the R35S:CC containing SacI and NcoI restriction enzyme site
gAGCTCCCATGGcGTGTCCTCTCCAAATGAAATG (SEQIDNO:6) is primer (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd), with EasyPfuDNAPolymerase (purchased from TransGenBiotech company) for enzyme carries out amplified reaction.
PCR reaction system and condition as follows: plasmid template (pHANNIBAL carrier) 1 μ L, each 1.5 μ L, the EasyPfuDNAPolymerase1 μ L of forward and reverse primer, 10 × EasyPfuBuffer5 μ L, 2.5mMdNTPs5 μ L, deionized water 35 μ L, total reaction system 50 μ l.PCR reaction conditions is: denaturation: 94 DEG C of 4min, sex change: 94 DEG C of 30sec, annealing: 50 DEG C of 30sec, extends: 72 DEG C of 1min30sec continue to extend: 72 DEG C of 10min, wherein sex change-annealing-extension experience 35 circulation.
The PCR primer obtained carries out agarose gel electrophoresis, it is the band of 1346bp that glue reclaims size, utilize pEasyTM – BluntZero test kit (purchased from TransGenBiotech), connect BluntZero carrier (purchased from TransGenBiotech), transform Trans1-T1 competent escherichia coli cell.
Picking mono-clonal, cultivate 4 hours laggard performing PCRs for 37 DEG C identify and send mono-clonal to check order (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd), choose the correct mono-clonal containing SEQIDNO:1 sequence of order-checking and extract plasmid, method, with reference to the present embodiment (1), obtains intermediate carrier Blunt-CMV.
3.OCS terminator is cloned
With the plasmid obtained in the abovementioned steps 1 of the present embodiment for template, with the OCSF:GC containing XbaI and SalI restriction enzyme site
tCTAGAcACGTGGTCGACGTCCTGCTTTAA (SEQIDNO:7) and the OCSR:AG containing HindIII restriction enzyme site
aAGCTTaGATTTAGGTGACACTATAGAA (SEQIDNO:8) is primer (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd), is that enzyme reacts with EasyPfuDNAPolymerase.
PCR reaction system and condition as follows: plasmid template (pHANNIBAL carrier) 1 μ L, each 1.5 μ L, the EasyPfuDNAPolymerase1 μ L of forward and reverse primer, 10 × EasyPfuBuffer5 μ L, 2.5mMdNTPs5 μ L, deionized water 35 μ L, total reaction system 50 μ l.PCR reaction conditions is: denaturation: 94 DEG C of 4min, sex change: 94 DEG C of 30sec, annealing: 50 DEG C of 30sec, extends: 72 DEG C of 50sec continue to extend: 72 DEG C of 10min, wherein sex change-annealing-extension experience 35 circulation.
The PCR primer obtained carries out agarose gel electrophoresis, and it is the band of 766bp that glue reclaims size, utilizes the pEasyTM – BluntZero test kit of full formula gold, connects BluntZero carrier, transforms Trans1-T1 competent escherichia coli cell.Picking mono-clonal, cultivate 4 hours laggard performing PCRs for 37 DEG C identify and send mono-clonal to check order (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd), choose the correct mono-clonal containing SEQIDNO:3 sequence of order-checking and extract plasmid, with reference to the present embodiment 1, obtain intermediate carrier Blunt-OCS.
The structure of embodiment 2:pC1300-pHANNIBAL carrier
1.1300-CMV the structure of carrier
Utilize EcoRI and SacI double digestion two kinds of plasmids respectively.It is as follows that enzyme cuts system:
After having prepared above-mentioned mixed solution, blow and beat mixing gently, 37 DEG C of incubators hatch 3.5 hours, and then electrophoresis, glue reclaim, connect.
According to object band brightness after electrophoresis, the glue that the amount being 3:1 ~ 7:1 according to fragment and carrier mol ratio adds respective volume reclaims solution, utilizes T4 ligase enzyme, CMV is connected into pCAMBIA1300 carrier.Linked system is as follows:
After having prepared above-mentioned mixed solution, blow and beat mixing gently, 16 DEG C of connections of spending the night (about 8 ~ 9 hours).Connect product conversion Trans1-T1 intestinal bacteria, picking mono-clonal, through checking order correctly, final acquisition 1300-CMV carrier.
2.1300-CMV-OCS the structure of carrier
Utilize XbaI and HindIII double digestion two kinds of plasmids respectively.Enzyme cuts system with in the present embodiment 1; After having made above-mentioned mixed solution, blow and beat mixing gently; 37 DEG C of incubators hatch 3.5 hours, and rear electrophoresis, glue reclaim, connection.
According to object band brightness after electrophoresis, the glue that the amount being 3:1 ~ 7:1 according to fragment and carrier mol ratio adds respective volume reclaims solution, utilizes T4 ligase enzyme, OCS is connected into 1300-CMV carrier.Linked system is with abovementioned steps in the present embodiment 1; After having prepared above-mentioned mixed solution, blow and beat mixing gently; 16 DEG C of connections of spending the night (about 8 ~ 9 hours).Connect product conversion Trans1-T1 intestinal bacteria, picking mono-clonal, through checking order correctly, final acquisition 1300-CMV-OCS carrier.
3.pC1300-pHANNIBAL the structure of carrier
Utilize KpnI and BamHI double digestion two kinds of plasmids respectively.Enzyme cuts system with in the present embodiment 1; After having made above-mentioned mixed solution, blow and beat mixing gently; 37 DEG C of incubators hatch 3.5 hours, and rear electrophoresis, glue reclaim, connection.
According to object band brightness after electrophoresis, the glue that the amount being 3:1 ~ 7:1 according to fragment and carrier mol ratio adds respective volume reclaims solution, utilizes T4 ligase enzyme, PDK is connected into 1300-CMV-OCS carrier.Linked system linked system is with in the present embodiment 1; After having prepared above-mentioned mixed solution, blow and beat mixing gently; 16 DEG C of connections of spending the night (about 8 ~ 9 hours).Connect product conversion Trans1-T1 intestinal bacteria, picking mono-clonal, through checking order correctly, final acquisition pC1300-pHANNIBAL carrier, schematic diagram as shown in Figure 1.
Embodiment 3: TAR1 gene RNAi vector construction and application in sweet wormwood
1.TAR1-RNAi vector construction
TAR1 sequence (EZ159016) is obtained, near the forward primer TAR1-RNAiF:aaa of 3 ' end design band restriction enzyme site from NCBI
tCTAGaaaaCCATGGcctcttaacaagccagagtc (SEQIDNO:9) (containing NcoIandXbaI restriction enzyme site) and reverse primer TAR1-RNAiR:aaa
gGATCCaaa
gGTACCccttggatgagatacactgtc (SEQIDNO:10) (containing BamHIandKpnI restriction enzyme site), utilizes EasyPfuDNAPolymerase enzyme to carry out pcr amplification.PCR system and condition are with reference to embodiment 2, and the extension time is 30sec.
First with the plasmid of gained pC1300-pHANNIBAL carrier in step gained TAR1 gene fragment plasmid upper in NcoI and KpnI double digestion the present embodiment and embodiment 2, glue reclaims, connect with T4 ligase enzyme, TAR1 gene fragment forward is connected into pC1300-pHANNIBAL, obtains 35S:TAR1F::PDK::OCS carrier; Then use BamHI and XbaI enzyme cutting TAR1 gene fragment plasmid and 35S:TAR1F::PDK::OCS carrier, glue reclaims and connects with T4 ligase enzyme, and TAR1 gene fragment is oppositely connected into 35S:TAR1F::PDK::OCS, obtains the whole carrier of TAR1-RNAi.Schematic diagram as shown in Figure 2.
2.TAR1-RNAi vector sweet wormwood explant
Extract TAR1-RNAi plasmid, Transformed E HA105 Agrobacterium, recycling agrobcterium-mediated transformation, transforms sweet wormwood explant.Use calli induction media (6-BA0.5mg/L respectively, NAA0.05mg/L, Totomycin 30mg/L and carbenicillin sodium 500mg/L), inducing clumping bud substratum (6-BA0.5mg/L, NAA0.05mg/L, Totomycin 50mg/L and carbenicillin sodium 500mg/L), root media (1/2MS+ Totomycin 100mg/L) cultivates sweet wormwood explant, and the final hygromycin resistance that obtains regenerates sweet wormwood plant.
3.TAR1-RNAi transgene abrotanum Molecular Identification
Extract the DNA of TAR1-RNAi transgene abrotanum, with JDPDKF:acagtggtcccaaagatgga (SEQIDNO:11) and JDPDK-1R:cttcttcgtcttacacatcac (SEQIDNO:12) for primer, rTaq enzyme is utilized to carry out PCR qualification.PCR identification system is as follows:
Reaction conditions is as follows:
PCR identifies electrophoresis result as shown in Figure 3, strain containing 700bp specific band in Fig. 3 is positive plant, the positive control that it is template that P represents with TAR1-RNAi plasmid, M is DNA molecular marker (MakerDL2000), the N negative control that to represent with wild-type sweet wormwood DNA be template.
Choose PCR and be accredited as positive plant, extract RNA; Reverse transcription TansScriptFirst-StrandcDNASynthesisSupermix test kit (purchased from TransGenBiotech) is utilized to be inverted to cDNA; Take cDNA as template, carry out quantitative PCR (qRT-PCR), detect TAR1 expression conditions.QRT-PCR result as shown in Figure 4, filters out the strain that TAR1 gene obviously reduces, and carries out follow-up TAR1-RNAi transgene abrotanum assay.
4.TAR1-RNAi transgene abrotanum assay
Choose positive TAR1-RNAi transfer-gen plant, carry out Artemisinin, arteannuinic acid and dihydroartemisinic acid assay.Get wild-type sweet wormwood in contrast simultaneously.Collect transgenosis and the fresh blade of wild-type sweet wormwood and petal material respectively, oven dry of spending the night, abundant abrasive substance, take about 0.1g dry powder in 2mLEppendorf pipe, add 1.5mL ethanol, with 40W ultrasonication 30min, the centrifugal 10min of 5000rpm, gets supernatant 0.22 μm of membrane filtration.Filtrate can be directly used in Liquid Chromatography-Tandem Mass Spectrometry analyser (LC-MS/MS), carries out assay.Cubage method: two-point method, calculation formula: A
0/ C
0=A
x/ C
x.Assay result as shown in Figure 5.
Result shows, in TAR1-RNAi transgene abrotanum leaf, the content of Artemisinin, arteannuinic acid and dihydroartemisinic acid is all lower than the content in wild-type sweet wormwood Plant Leaf; And in corresponding plant petal the amount of Artemisinin, arteannuinic acid and dihydroartemisinic acid also lower than wild-type sweet wormwood plant.Illustrate that the silence of TAR1 gene in sweet wormwood causes the content of Artemisinin, arteannuinic acid and dihydroartemisinic acid to reduce.
Embodiment 4: PLR gene RNAi vector construction and application in woaded blue
1.PLR-RNAi vector construction
According to the sequence (JF264893) of PLR gene, at the forward primer PLR1-F:CCATGGGTCGACTGCCTCCGGGAAGAGAA (SEQIDNO:13) of its non-conservative zone design containing NcoI and SalI restriction enzyme site, containing the reverse primer PLR1-R:GGTACCGGATCCGAGTTTAGAAGCTTCTT (SEQIDNO:14) of KpnI and BamHI restriction enzyme site, EasyPfuDNAPolymerase enzyme is utilized to carry out pcr amplification.PCR system and condition are with reference to embodiment 2, and the extension time is 30sec.
First with the plasmid of gained pC1300-pHANNIBAL carrier in step gained PLR gene fragment plasmid upper in SalI and BamHI double digestion the present embodiment and embodiment 2, glue reclaims, connect with T4 ligase enzyme, PLR gene fragment forward is connected into pC1300-pHANNIBAL, obtains 35S:PLRF::PDK::OCS carrier; Then PLR gene fragment plasmid and 35S:PLRF::PDK::OCS carrier is cut with NcoI and KpnI enzyme, glue reclaims and connects with T4 ligase enzyme, PLR gene fragment is oppositely connected into 35S:PLRF::PDK::OCS, obtains the whole carrier of the PLR-RNAi simultaneously inserting forward and reverse fragment.Schematic diagram as shown in Figure 6.
2.PLR-RNAi vector woaded blue explant
Extract PLR-RNAi plasmid, get 5-10 μ L Plastid transformation C58C1 competent cell, utilize leaf disk method to transform woaded blue explant.The C58C1 bacterium immersion of activation dye is utilized to be cut into 1cm
2woaded blue leaf dish, then take out, be inoculated on Dual culture substratum (MS), be placed in constant incubator (25 soil 1) DEG C light culture 2d.Then be transferred to for 5 times except (1/2MS+Cef500mg/L) on bacterium culture medium is in (25 soil 1) DEG C light culture with aseptic water washing, after about 15d, hairly root is grown from leaf dish edge of wound, every 7d subculture once, and constantly reduce Cef concentration (250mg/L → 100mg/L → 50mg/L → 0mg/L) subculture is degerming repeatedly.Screen with Totomycin (Hygr10mg/L).
Select growth root of hair system rapid, in good condition and proceed to 1/2MS liquid nutrient medium, carry out enlarged culturing (lucifuge, 120rpm) in constant-temperature shaking incubator, 45d gathers in the crops hairly root and is used for subsequent analysis.DNA extraction, RNA extract, compound extracts and Phloroglucinol-hydrochloric acid dyeing.
3.PLR-RNAi woaded blue transgenic hairy root Molecular Identification
Extract root of hair STb gene, carry out PCR qualification with three couple in table 1.PCR identification system is with reference to (3) in embodiment 3.React rear use 1% agarose gel electrophoresis to detect.
PCR identifies electrophoresis result as shown in Figure 7, and comprise rolb in figure, the strain of hpt and JDPDK band is positive plant, and P represents positive control simultaneously, and M is DNA molecular marker (MakerDL2000), CK is empty vector control, and WT is wild-type.
Table 1PLR-RNAi transgenic hairy root Molecular Identification primer sequence
Choose PCR and be accredited as positive plant, extract RNA; Reverse transcription TansScriptFirst-StrandcDNASynthesisSupermix test kit is utilized to be inverted to cDNA; Take cDNA as template, carry out quantitative PCR (qRT-PCR), detect PLR expression conditions.QRT-PCR result as shown in Figure 8, filters out the strain that PLR gene obviously reduces, and carries out follow-up PLR-RNAi lariciresinol assay.
4.PLR-RNAi woaded blue transgenic hairy root assay
The content of lariciresinol in PLR-RNAi transgenic hairy root is measured by LC/MS/MS.Assay result as shown in Figure 9 A.Result display is compared with WT and CK, and in PLR-RNAi transgenic hairy root, the content of lariciresinol significantly reduces (P<0.05).By Phloroglucinol-hydrochloric acid dyeing, find that PLR-RNAi transgenic hairy root colouring degree obviously dies down, as shown in Figure 9 B.These results suggest that PLR1-RNAi transgenic hairy root has less lignanoid and phenol derivatives accumulation, show that PLR down-regulated expression can reduce the biosynthesizing of lariciresinol,
In a word, the invention provides a kind of RNAi carrier---pC1300-pHANNIBAL carrier of plant binary expressing gene silence.This carrier can be widely used in silence and the biological function research of various plants target gene, and for carrying out, plant technology engineering significance is great.Above-described embodiment shows, this carrier to be used successfully in sweet wormwood PLR gene and the isogenic silence of the red sage root MYC2a, MYC2b in TAR1 gene, woaded blue, realize the reduction of Artemisinin in Artemisia annuna, arteannuinic acid and dihydroartemisinic acid content, in woaded blue, in the decline of larch turpentine cellulose content and the red sage root, the compounds content such as salvianolic acid reduces.Along with the popularization of genetic engineering technique, the application of pC1300-pHANNIBAL carrier in fundamental research and agriculture production will be more and more extensive.
Below the invention is described in detail, but on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Under the prerequisite without prejudice to the invention spirit, also can make all equivalent modification or replacement, these all belong to the scope of protection of present invention.
Claims (14)
1. one kind is widely used in the RNAi carrier of various plants gene silencing, this carrier is based on plant binary expression vector pCAMBIA1300, insert the CMV promoter, PDK intron and the OCS terminator that derive from pHANNIBAL carrier at multiple clone site place, form pC1300-pHANNIBAL carrier.
2. a kind of RNAi carrier being widely used in various plants gene silencing according to claim 1, it is characterized in that, wherein said CMV and OCS is obtained by pcr amplification, cuts, connects and insert pCAMBIA1300 successively, obtain pC1300-CMV-OCS through enzyme; Described PDK directly cuts from pHANNIBAL enzyme and obtains, and between CMV and OCS then inserting pC1300-CMV-OCS, obtains pC1300-pHANNIBAL.
3. a kind of RNAi carrier being widely used in various plants gene silencing according to claim 1, is characterized in that, in this carrier, containing 3 polyclone restriction enzyme site SacI, NcoI and KpnI between described CMV and PDK, forward inserts the fragment of target gene; Containing 4 restriction enzyme site HindIII between PDK and OCS, BamHI, XbaI and SalI, wherein BamHI, XbaI and SalI are single endonuclease digestion site, oppositely insert the fragment of target gene.
4. a kind of RNAi carrier being widely used in various plants gene silencing according to claim 1, it is characterized in that, wherein said CMV promoter, its nucleotides sequence is classified as shown in SEQIDNO:1.
5. a kind of RNAi carrier being widely used in various plants gene silencing according to claim 1, is characterized in that, wherein said PDK intron, its nucleotides sequence is classified as shown in SEQIDNO:2.
6. a kind of RNAi carrier being widely used in various plants gene silencing according to claim 1, is characterized in that, wherein said OCS terminator, its nucleotides sequence is classified as shown in SEQIDNO:3.
7. a kind of RNAi carrier being widely used in various plants gene silencing according to claim 2, is characterized in that, wherein said pC1300-pHANNIBAL carrier, its nucleotides sequence is classified as shown in SEQIDNO:4.
8. the construction process being widely used in the RNAi carrier of various plants gene silencing according to claim 1, comprises following steps:
Step one, utilizes F35S, and the promotor CMV on R35S amplification pHANNIBAL, connects Blunt-zero carrier, obtain correct intermediate carrier Blunt-CMV;
Step 2, double digestion Blunt-CMV, is connected on pCAMBIA1300, obtains 1300-CMV;
Step 3, utilizes OCSF, and the terminator OCS on OCSR amplification pHANNIBAL, connects Blunt-zero carrier, obtain correct intermediate carrier Blunt-OCS;
Step 4, double digestion Blunt-OCS, is connected on 1300-CMV, obtains 1300-CMV – OCS;
Step 5, the PDK fragment on double digestion pHANNIBAL, is connected on 1300-CMV – OCS, and final structure obtains pC1300-pHANNIBAL carrier.
9. the construction process being widely used in the RNAi carrier of various plants gene silencing according to claim 8, it is characterized in that, F35S is utilized wherein described in step one, the R35S promotor CMV increased on pHANNIBAL refers to the F35S containing EcoRI restriction enzyme site and the R35S containing SacI and NcoI restriction enzyme site as primer, described F35S is as shown in SEQIDNO:5, and R35S is as shown in SEQIDNO:6.
10. the construction process being widely used in the RNAi carrier of various plants gene silencing according to claim 8, it is characterized in that, OCSF is utilized wherein described in step 3, the OCSR terminator OCS increased on pHANNIBAL refers to the OCSF containing XbaI and SalI restriction enzyme site and the OCSR containing HindIII restriction enzyme site as primer, described OCSF is as shown in SEQIDNO:7, and OCSR is as shown in SEQIDNO:8.
11. 1 kinds of host cells, this host cell comprises the gene shown in SEQIDNO:4.
12. a kind of host cells according to claim 11, is characterized in that, described host cell is intestinal bacteria or Agrobacterium.
The application of the RNAi carrier being widely used in various plants gene silencing in gene transformation described in 13. claims 1.
14. application of RNAi carrier in gene transformation being widely used in various plants gene silencing according to claim 13, is characterized in that, the application of described RNAi carrier in gene transformation refers to the application of RNAi carrier in preparation transgenic plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510521004.9A CN105274135A (en) | 2015-08-24 | 2015-08-24 | RNAi vector widely used for multi-plant gene silencing and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510521004.9A CN105274135A (en) | 2015-08-24 | 2015-08-24 | RNAi vector widely used for multi-plant gene silencing and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105274135A true CN105274135A (en) | 2016-01-27 |
Family
ID=55143968
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510521004.9A Pending CN105274135A (en) | 2015-08-24 | 2015-08-24 | RNAi vector widely used for multi-plant gene silencing and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105274135A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107236756A (en) * | 2016-03-28 | 2017-10-10 | 中国科学院青岛生物能源与过程研究所 | A kind of RNAi carrier and its application for micro- plan ball algae gene silencing |
| CN109207510A (en) * | 2018-09-19 | 2019-01-15 | 深圳大学 | A kind of construction method of the efficient silent carrier of monocotyledon miRNA |
| CN109439685A (en) * | 2018-12-26 | 2019-03-08 | 菏泽学院 | A kind of construction method of the plant expression vector that can express gypsymoth USP gene dsRNA and its application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220361A (en) * | 2011-04-26 | 2011-10-19 | 山东农业大学 | Tobacco virus-resisting RNAi carrier |
| CN103014030A (en) * | 2013-01-10 | 2013-04-03 | 重庆大学 | RNAi (Ribonucleic acid interference) carrier of three genes of collard DWARF, SP and GA20ox, and building method and application thereof |
| CN103525828A (en) * | 2013-10-17 | 2014-01-22 | 重庆大学 | Tomato S1EBI gene as well as RNAi (ribonucleic acid interference) expression vector and applications thereof |
-
2015
- 2015-08-24 CN CN201510521004.9A patent/CN105274135A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220361A (en) * | 2011-04-26 | 2011-10-19 | 山东农业大学 | Tobacco virus-resisting RNAi carrier |
| CN103014030A (en) * | 2013-01-10 | 2013-04-03 | 重庆大学 | RNAi (Ribonucleic acid interference) carrier of three genes of collard DWARF, SP and GA20ox, and building method and application thereof |
| CN103525828A (en) * | 2013-10-17 | 2014-01-22 | 重庆大学 | Tomato S1EBI gene as well as RNAi (ribonucleic acid interference) expression vector and applications thereof |
Non-Patent Citations (3)
| Title |
|---|
| 任丽蓉等: "野生罂粟RNAi表达载体的构建及遗传转化", 《生物技术通报》 * |
| 张树武: "美洲南瓜种皮PAL基因RNAi表达载体构建及品种抗病性研究", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
| 杨飞等: "苎麻雄性不育相关基因atp6 和atp9 RNA干扰载体的构建", 《中国农学通报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107236756A (en) * | 2016-03-28 | 2017-10-10 | 中国科学院青岛生物能源与过程研究所 | A kind of RNAi carrier and its application for micro- plan ball algae gene silencing |
| CN107236756B (en) * | 2016-03-28 | 2021-04-23 | 中国科学院青岛生物能源与过程研究所 | RNAi vector for nannochloropsis oculata gene silencing and application thereof |
| CN109207510A (en) * | 2018-09-19 | 2019-01-15 | 深圳大学 | A kind of construction method of the efficient silent carrier of monocotyledon miRNA |
| CN109207510B (en) * | 2018-09-19 | 2022-05-03 | 深圳大学 | Construction method of monocotyledon miRNA (micro ribonucleic acid) efficient silencing vector |
| CN109439685A (en) * | 2018-12-26 | 2019-03-08 | 菏泽学院 | A kind of construction method of the plant expression vector that can express gypsymoth USP gene dsRNA and its application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105543270A (en) | Double resistance CRISPR/Cas9 carrier and application | |
| CN105087640B (en) | Adjust gene and its application of vegetable seeds development | |
| CN102834517A (en) | Polynucleotides encoding nf-yb originating in jatropha and utilization thereof | |
| CN102712929B (en) | Identification and use of plant root-specific expression promoter | |
| CN105274135A (en) | RNAi vector widely used for multi-plant gene silencing and application | |
| CN103732747A (en) | Method for identification and isolation of terminator sequences causing enhanced transcription | |
| CN112126707B (en) | Nucleic acid molecules from corn event CA09328 and methods for detecting same | |
| CN103275983A (en) | Gene promoter for stress induction expression and application of gene promoter | |
| CN116640195B (en) | Citrus CsPIF4 gene, protein coded by same and application thereof | |
| CN103201389A (en) | Sugarcane bacilliform viral (SCBV) enhancer and its use in plant functional genomics | |
| US20130097732A1 (en) | Composition and Method for Prolonging the Shelf Life of Banana by Using Interfering RNA | |
| CN103290014A (en) | Adversity inducible expression gene promoter and application thereof | |
| CN105462987A (en) | New application of OsBBTI4 (oryza sativa Bowman-Birk trypsin inhibitor 4) gene | |
| CN105039345A (en) | Clone of miRNA for improving salt resistance capacity of mulberries and application thereof | |
| CN110904109B (en) | miR1866 gene for controlling rice seed germination, overexpression vector, gRNA expression vector, preparation method and application thereof | |
| CN104109682B (en) | A kind of pectin lyase BnPL gene and promoter thereof and application | |
| CN108795942B (en) | Rice exogenous stress induced expression promoter Psubs3 and application thereof | |
| CN103923922B (en) | Heavy metal evoked promoter is cultivating the application in heavy metal pollution of soil early warning transgenic plant | |
| CN105886528A (en) | Method for acquiring transgenic hevea plant by virtue of laticifer specific promoter | |
| CN104805100A (en) | Application of paddy rice gene OsS[mu]BP-2 in delaying plant leaf senescence | |
| CN110863006B (en) | Method for improving tillering and regeneration of rice | |
| CN110511932B (en) | Cotton fiber length-related microRNA477, precursor DNA thereof and application thereof | |
| CN104910264B (en) | A kind of mao bamboon brassinosteroid receptor protein and its encoding gene and application | |
| CN117362405A (en) | Salicylic acid pathway gene PbNPR3 and protein affecting sensitivity of plants to anthracnose and application thereof | |
| CN101613713A (en) | A kind of plant recombination expression vector and comprise the transformant of this carrier |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160127 |