CN105039345A - Clone of miRNA for improving salt resistance capacity of mulberries and application thereof - Google Patents
Clone of miRNA for improving salt resistance capacity of mulberries and application thereof Download PDFInfo
- Publication number
- CN105039345A CN105039345A CN201510589099.8A CN201510589099A CN105039345A CN 105039345 A CN105039345 A CN 105039345A CN 201510589099 A CN201510589099 A CN 201510589099A CN 105039345 A CN105039345 A CN 105039345A
- Authority
- CN
- China
- Prior art keywords
- mirna
- mirn1
- mulberry tree
- seq
- mul
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to the technical field of gene engineering and provides clone of miRNA for improving the salt resistance capacity of mulberries and application thereof. The miRNA is named as mul-miRn1 and is represented by an RNA sequence SEQ.ID.NO.1 shown in a sequence table, and a precursor RNA and an encoding gene sequence of the miRNA are respectively represented by nucleotide sequences SEQ.ID.NO.2 and SEQ.ID.NO.3 shown in the sequence table. By the adoption of the miRNA represented by the overexpression SEQ.ID.NO.1 of the mulberries, transgenic mulberries having stronger salt resistance can be cultivated. The mul-miRn1 provides novel gene resources for cultivation of new species of salt-resisting mulberries and meanwhile has important significance and potential application value on cultivation of salt-resisting crops.
Description
Technical field
The present invention relates to gene engineering technology field, provide a kind of clone and the application thereof that strengthen the miRNA of mulberry tree salt resistance ability.
Background technology
Soil drought and salinification are the major issues that in world wide, restriction agroforestry are produced, and have caused the extensive concern of international community.China is one of country that Drought and salt stainization is the most serious in the world, and Arid&semi-arid area area and salinization land account for more than 50% and 20% of national arable area respectively.Soil drought and salinification become the important factor of the agroforestry development of restriction China and improvement of the ecological environment.Mulberry tree is perennial economic tree, as the feed seeds of silkworm, is the important substance basis of silk industry.Simultaneously, mulberry tree has extremely strong adaptability to environment, there is drought-enduring, Salt And Alkali Tolerance, impoverishment tolerant, the physiological and ecological characteristic such as cold-resistant, waterlogging, be widely used in green barren hill, defend and control sand, Rocky Desertification Control, soil conservation, Saline-alkali Field Control, the aspect such as conceding the land to forestry, there is good ecology, economic and social benefit, become one of important ecological seeds in improvement of the ecological environment at present.Therefore, cultivating resistance new variety is strengthen mulberry tree adaptability, expands cultivated area, realizes the important channel of its economy and the ecological value.
MiRNAs is the non-coding strand microRNA that a class length is about 20-25nt, can special modification be carried out at transcriptional level to genome area and suppress target gene to be transcribed, also can have the target gene mRNA cracking of homologous sequence in post-transcriptional level mediation or suppress it to translate, its function relate to grow, all respects of the life process such as signal transduction and environmental response.Research shows that miRNA experiences Salt Strees Condition plant and produces in adaptive process and also plays an important role, plant can regulate and control related gene expression level by inducing or suppressing corresponding miRNA to express, and forms complicated response mechanism and adapts to Salt Strees Condition environment.Obtain multiple miRNAs gene from diversiform-leaved poplar, upland cotton, Soybean and Other Crops clone and be applied to molecular breeding and have multinomial achievement in research application patent both at home and abroad at present.Comprising " a kind of miRNA relevant to plant salt endurance and application thereof " (Chinese patent CN103114091A) that Zhang Quan etc. invents, disclose a kind of miRNA relevant to plant salt endurance deriving from salt mustard, in crop is as wheat, paddy rice, corn, cotton, process LAN miRNA can cultivate the genetically modified crops with high-salt tolerance." deriving from miRNA-GramiRn22 and the application thereof of cotton " (the Chinese patent CN102250899A) of the invention such as Liu Jinyuan, disclose a kind of miRNA-GramiRn22, apply this miRNA and be expected to obtain the plant having important phenotype in stress tolerant is coerced and grown." a kind of salt mustard salt tolerance regulation and control miRNA-tsa-miRn1927 and application thereof " (the Chinese patent CN103146701A) of the invention such as Wang Xingjun, discloses a kind of salt mustard salt tolerance regulation and control miRNA-tsa-miRn1927 and application thereof.The salt mustard salt tolerance regulation and control miRNA provided plays an important role in plant stress tolerance especially salt tolerance.The patents of invention such as Li Xia (Chinese patent CN102220334A, CN102220331A, CN102220332A, CN102220333A), disclose several miRNAs relevant to plant salt endurance, in soybean, these miRNAs of process LAN can cultivate the genetically engineered soybean with high-salt tolerance.The patents of invention " the cloning and analysis method of diversiform-leaved poplar microRNAs precursor " (Chinese patent CN103361346A) such as Xiaxin jasmine, disclose the cloning and analysis method of a kind of and high salt environment stress relevant diversiform-leaved poplar microRNAs precursor.But about the effect of miRNA in mulberry tree breeding for salt resistance, yet there are no report.
Summary of the invention
The present inventor is for the situation of above-mentioned prior art, provide a kind of clone and the application thereof that strengthen the miRNA of mulberry tree salt resistance ability, this miRNA called after mul-miRn1, it has the RNA sequence in sequence table shown in SEQ.ID.NO.1, and its precursor RNA and coding gene sequence have the nucleotide sequence in sequence table shown in SEQ.ID.NO.2 and SEQ.ID.NO.3 respectively.Utilize the miRNA shown in SEQ.ID.NO.1, the transgenosis mulberry tree with high-salt tolerance can be cultivated; Mul-miRn1 of the present invention cultivates salt tolerance New Mulberry Variety to provide new genetic resources, has great importance and potential using value in the cultivation of salt tolerant crop simultaneously.
Contriver provide firstly a kind of miRNA strengthening mulberry tree salt resistance ability, this miRNA called after mul-miRn1, and it has the RNA sequence in sequence table shown in SEQ.ID.NO.1;
Its precursor RNA has the nucleotide sequence in sequence table shown in SEQ.ID.NO.2;
Its coding gene sequence is the nucleotide sequence shown in SEQ.ID.NO.3;
Except the nucleotide sequence such as shown in SEQ.ID.NO.3, also comprise and can transcribe the miRNA precursor RNA sequence shown in SEQ.ID.NO.2 and with sequence shown in SEQ.ID.NO.3, there is the nucleotide sequence of more than 90% similarity in plant materials; Can be transcribed into miRNA precursor after this sequence is imported into vegetable cell, described miRNA precursor can be processed into ripe miRNA in vegetable cell, therefore also at the row of protection scope of the present invention.
The present invention constructs the overexpression vector pBI121mul-miRn1 of mulberry tree mul-miRn1 gene, this expression vector is proceeded to Agrobacterium GV3101 competent cell, screening transformant, adopts leaf disc transformation method to transform mulberry tree.Carry out salt resistance analysis to the transgenosis mulberry tree plant obtained to show, the salt resistance ability of transgenosis mulberry tree plant significantly improves, and has a good application prospect.
The present invention relates to a kind of plant expression vector, include the nucleotide sequence as shown in SEQ.ID.NO.1 or SEQ.ID.NO.2 or SEQ.ID.NO.3, for improving the salt resistance ability of mulberry tree.
The invention provides the method that mulberry tree mul-miRn1 gene is applied in plant, the salt resistance ability of plant can be improved.Step is:
1) mul-miRn1 gene order is placed under CaMV35S strong promoter, builds plant expression vector pBI121mul-miRn1;
2) expression vector of structure is proceeded to Agrobacterium competent cell, filter out transformant;
3) 2 are utilized) transformant that obtains transforms mulberry tree, obtains turning mul-miRn1 gene mulberry tree.
Based on above-mentioned discovery, contriver, further by genetic engineering technique overexpression mul-miRn1 gene in mulberry tree, can cultivate the transgenosis mulberry tree with higher salt resistance ability; Mul-miRn1 of the present invention cultivates anti-salt New Mulberry Variety to provide new genetic resources, and this gene can be used for mulberry tree or the breeding research of other plant salt resistance.
Accompanying drawing explanation
Fig. 1 is the secondary structure figure of mul-miRn1 precursor sequence,
MiRNA provided by the invention derives from mulberry tree, called after mul-miRn1, and its precursor sequence can be folded into a kind of stable loop-stem structure, belongs to the typical secondary structure of miRNA precursor, meets the constitutional features of miRNA precursor;
Fig. 2 is the design of graphics of mulberry tree mul-miRn1 gene plant overexpression vector pBI121mul-miRn1;
Fig. 3 is overexpression vector pBI121mul-miRn1 through the electrophoretogram of BamH Ι and Sac Ι double digestion,
M:MarkerDL2000 in figure; P: digestion products,
Mulberry tree mul-miRn1 gene nucleotide series is inserted in plant expression vector pBI121 by we as seen from the figure, successfully constructs mul-miRn1 gene plant overexpression vector;
Fig. 4 is the PCR qualification result schematic diagram of transfer-gen plant,
WT in figure: wild-type mulberry tree contrasts; L1-L3: the positive strain of transgenosis mulberry tree; M:MarkerDL2000;
With the DNA of the positive plant filtered out for template, the pcr amplification of corresponding transgenic line is carried out according to 35S promoter sequences Design a pair special primer, result all can increase and arrive about 530bp band, illustrate that mul-miRn1 gene successfully proceeds in mulberry tree body by we, and obtain transfer-gen plant;
Fig. 5 is the detection of expression result histogram of the ripe body of mul-miRn1 in transfer-gen plant,
WT in figure: wild-type mulberry tree contrasts; L1-L3: the positive strain of transgenosis mulberry tree,
In transgenosis mulberry tree plant, the gene expression abundance of the ripe body of mul-miRn1, apparently higher than WT lines, illustrates that the ripe body of mul-miRn1 is able to high expression in transgenosis mulberry tree as seen from the figure;
Fig. 6 is transgenosis mulberry tree and the upgrowth situation comparative result histogram of wild-type mulberry tree under different concns Salt Strees Condition of overexpression mul-miRn1, and wherein Fig. 6 A is plant height comparison diagram, and Fig. 6 B is total biomass comparison diagram;
Under different concns Salt Strees Condition, the plant height (A) of the transgenosis mulberry tree plant of overexpression mul-miRn1 and total biomass (B), all apparently higher than wild-type mulberry tree plant, show that the salt resistance ability of the transgenosis mulberry tree plant of overexpression mul-miRn1 is apparently higher than wild-type mulberry tree plant as seen from the figure.
Embodiment
The present invention is defined further in following examples, according to above description and these embodiments, those skilled in the art can determine essential characteristic of the present invention, and when not departing from spirit and scope of the invention, various change and amendment can be made, to make its applicable various uses and condition to the present invention.Except special indicating, be of the present inventionly state of the art;
The cloning process of embodiment 1. mulberry tree mul-miRn1 gene
1, conventional CTAB method is adopted to extract mulberry leaf DNA;
2, according to the nucleotide sequence of transcript profile order-checking gained mul-miRn1 gene, design a pair special primer, miRn1-5 ' (CTCATACACACAGAGATAGACC) its nucleotide sequence as shown in SEQ.ID.NO.4 and miRn1-3 ' (CAGAAGATTGTGTTGACAGAAG) its nucleotide sequence as shown in SEQ.ID.NO.5, with mulberry leaf DNA for template carries out pcr amplification, system is as follows:
Response procedures is as follows:
The agarose gel electrophoresis that reaction terminates rear use 1% detects PCR primer, reclaim object fragment and carry out Clone and sequence analysis, sequencing result shows its nucleotide sequence as shown in SEQ.ID.NO.3, this sequence can be folded into the typical loop-stem structure of miRNA precursor (as shown in Figure 1), meet the constitutional features of miRNA precursor, show we successful clone obtain mul-miRn1 gene.
The structure of embodiment 2. mulberry tree mul-miRn1 plant expression vector pBI121mul-miRn1
1, according to the nucleotide sequence of isolated mulberry tree mul-miRn1 gene, design primer miRn1-F (GGATCCCTCATACACACAGAGATAG) its nucleotide sequence as shown in SEQ.ID.NO.6 and miRn1-R (GAGCTCCAGAAGATTGTGTTGACAG) its nucleotide sequence as shown in SEQ.ID.NO.7, the DNA extracted with mulberry leaf, for template, carries out pcr amplification.
2, get PCR primer to be connected with pMDl8-TSimple cloning vector, connect product conversion bacillus coli DH 5 alpha competent cell, penbritin (50mg/L) resistance screening positive colony, bacterium liquid PCR extracts recombinant plasmid dna after identifying, enzyme cuts the laggard row sequencing of qualification.
3, the recombinant plasmid BamHI and SacI enzyme that contain the correct fragment of mulberry tree mul-miRn1 gene through sequencing are cut, reclaim mul-miRn1 gene fragment and connect (as shown in Figure 2) with the pBI121 expression vector of identical digestion with restriction enzyme.Connect product conversion bacillus coli DH 5 alpha competent cell, kantlex (50mg/L) resistance screening positive colony, the enzyme positive colony chosen being carried out to bacterium liquid PCR qualification and plasmid DNA cuts qualification (as shown in Figure 3).
4, the mulberry tree mul-miRn1 gene plant expression vector transformation Agrobacterium GV3101 competent cell adopting freeze-thaw method to build, kantlex (50mg/L) resistance screening positive colony.
The acquisition of embodiment 3. transgenosis mulberry tree plant
1, picking Agrobacterium (the single bacterium colony of the Agrobacterium of carrying recombinant plasmid obtained in embodiment 2) is inoculated in the LB liquid nutrient medium containing kantlex 50mg/L, 28 DEG C, 250rpm, and shaking culture is about 48h to the logarithmic growth later stage; Bacterium liquid MS nutrient solution is diluted 10 times, for subsequent use;
2, get mulberry tree tests for sterility, be cut into small pieces (0.5 × 0.5cm), as explant, is placed in the pre-division culture medium of MS (MS+TDZ1.0mg/L+NAA0.2mg/L), 28 DEG C, light application time 16h/d, intensity of illumination 2000Lux, preculture 2d.
3, the explant after preculture is immersed bacterium liquid 2-l0min, then blot unnecessary bacterium liquid with the filter paper of sterilizing, access MS minimum medium; Under the low light level, 28 DEG C of Dual culture 2d.
4, the outside shade after Dual culture first washs 3 times with the sterilized water containing cephalo penicillin 250mg/L, 1 time is washed again with the MS nutrient solution containing cephalo penicillin 250mg/L, then blot with aseptic filter paper, proceed to containing kantlex 100mg/L, on the MS Selective agar medium (MS+6-BA3.0mg/L+NAA0.2mg/L+ kantlex 50mg/L+ cephalo penicillin 250mg/L) of cephalo penicillin 250mg/L, 28 DEG C, light application time 16h/d, intensity of illumination 2000Lux cultivate; Every 15d switching once.
5, when Bud Differentiation grows to about lcm, cut Bud Differentiation and proceed in MS root media (MS+ kantlex 50mg/L+ cephalo penicillin 250mg/L), short its is taken root.
6, when differentiation seedling grows to 5-6 sheet leaf, after root system development is good, moves into and fill in the flowerpot of sterile soil, room temperature Routine Management.
The PCR qualification of embodiment 4. transgenosis mulberry tree plant
1, CTAB method is adopted to extract the DNA of resistant plant and WT lines.
2, according to 35S promoter sequences Design a pair its nucleotide sequence of special primer 35S-5 (GGCCATGGAGTCAAAGATTC) as shown in SEQ.ID.NO.8 and 35S-3 (CCGTGTTCTCCAAATG) its nucleotide sequence as shown in SEQ.ID.NO.9, respectively with the resistant plant extracted and the DNA of WT lines for template, carry out PCR, amplification 35S promoter, reaction system is as follows:
Response procedures is as follows:
The agarose gel electrophoresis that reaction terminates rear use 1% detects PCR primer.By agarose gel electrophoresis detected result, as shown in Figure 4, all can amplify the band of an about 530bp in resistant plant genomic dna, and native plant gene group DNA fails to amplify this band, show us successfully by mul-miRn1 channel genes in mulberry tree genome.
The detection of expression of the ripe body of embodiment 5.mul-miRn1 in transgenosis mulberry tree
1, the expression amount of method to the ripe body of mul-miRn1 in transgenosis mulberry tree of quantitative fluorescent PCR is adopted to detect.
2, extract the total serum IgE of wild-type and transgenosis mulberry tree by Trizol method, use DNaseI to remove genomic dna, with the OneStep of precious biotechnology company limited
miRNAcDNASynthesisKit carries out the reverse transcription of miRNA.
3, with mulberry tree U6 for reference gene, with the reverse transcription product of wild-type and transgenosis mulberry tree miRNAs for template, reaction system and reactions steps reference
premixExTaq
tMiI specification sheets reacts, and maps according to reaction result Excel, analyzes the ripe body of mulberry tree mul-miRn1 success in transgenosis mulberry tree and expresses and gene expression abundance.The ripe body of mul-miRn1 is all able to high expression in transgenosis mulberry tree as seen from Figure 5, show the mulberry tree mul-miRn1 gene that proceeds to can in mulberry tree overexpression, and be successfully processed to form ripe body.
Embodiment 6. transgenosis mulberry tree salt resistance ability is analyzed
1, by transgenosis and wild-type mulberry tree seedling replanting to diameter 40cm, in the flowerpot of high 27cm, every basin field planting 1 strain.
2, after seedling replanting, choose growth phase and salt stress process is carried out to consistent seedling.Establish 4 process altogether, each process 6 strain repeats, respectively pouring containing 50,100,150, the 1/2Hoagland complete nutrition liquid of the NaCl of 200mmol/L, to water 1/2Hoagland complete nutrition liquid for contrast (CK), water 1 time every 5d, each flowerpot waters 1000mL at every turn.
3, after seedling salt alkaline purification 30d, its plant height and total biomass is measured respectively.
Find out by analyzing (as shown in Figure 6) to transgenosis mulberry tree salt resistance ability, transgenosis mulberry tree has stronger salt resistance ability relative to wild-type mulberry tree, has good application prospect.
Claims (4)
1. strengthen a miRNA for mulberry tree salt resistance ability, it is characterized in that: this miRNA called after mul-miRn1, it has the RNA sequence in sequence table shown in SEQ.ID.NO.1.
2. miRNA according to claim 1, is characterized in that: its precursor RNA sequence is as shown in SEQ.ID.NO.2.
3. miRNA according to claim 1, is characterized in that: its coding gene sequence is the nucleotide sequence shown in SEQ.ID.NO.3.
4. miRNA according to claim 1 strengthens the application of the saline-alkaline tolerance of mulberry tree in mulberry tree.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510589099.8A CN105039345B (en) | 2015-09-16 | 2015-09-16 | The clone of miRNA for enhancing mulberry tree salt resistance ability a kind of and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510589099.8A CN105039345B (en) | 2015-09-16 | 2015-09-16 | The clone of miRNA for enhancing mulberry tree salt resistance ability a kind of and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105039345A true CN105039345A (en) | 2015-11-11 |
| CN105039345B CN105039345B (en) | 2018-07-06 |
Family
ID=54446319
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510589099.8A Expired - Fee Related CN105039345B (en) | 2015-09-16 | 2015-09-16 | The clone of miRNA for enhancing mulberry tree salt resistance ability a kind of and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039345B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108588069A (en) * | 2018-03-07 | 2018-09-28 | 承德医学院 | The precursor-gene of mulberry tree miR171a and its application in enhancing plant salt endurance |
| CN111849989A (en) * | 2020-07-30 | 2020-10-30 | 山东农业大学 | Method for enhancing salt tolerance of mulberry by utilizing long-chain non-coding RNA transgenic rootstock |
| CN116083432A (en) * | 2023-03-17 | 2023-05-09 | 西南大学 | Mulberry U6 promoter and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102277357A (en) * | 2011-07-28 | 2011-12-14 | 清华大学 | miRNA (Micro Ribonucleic Acid)-GhmiR156 from cotton and application thereof |
-
2015
- 2015-09-16 CN CN201510589099.8A patent/CN105039345B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102277357A (en) * | 2011-07-28 | 2011-12-14 | 清华大学 | miRNA (Micro Ribonucleic Acid)-GhmiR156 from cotton and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| GAI YING-PING，等: "Analysis of phytoplasma-responsive sRNAs provide insight into the pathogenic mechanisms of mulberry yellow dwarf disease", 《SCIENTIFIC REPORTS》 * |
| NAGESHBABU R.ET AL: "Expression of miRNAs confers enhanced tolerance to drought and salt stress in Finger millet (Eleusine coracona)", 《JOURNAL OF STRESS PHYSIOLOGY & BIOCHEMISTRY》 * |
| 何沉峰: "一种基于能量和结构的microRNA成熟体预测方法", 《中国优秀硕士学位论文全文数据库 基础科技辑》 * |
| 桑树基因组研究团队: "桑树（川桑Ｍｏｒｕｓ ｎｏｔａｂｉｌｉｓ）全基因组测序", 《蚕学通讯》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108588069A (en) * | 2018-03-07 | 2018-09-28 | 承德医学院 | The precursor-gene of mulberry tree miR171a and its application in enhancing plant salt endurance |
| CN108588069B (en) * | 2018-03-07 | 2021-11-30 | 承德医学院 | Precursor gene of mulberry miR171a and application thereof in enhancing salt tolerance of plants |
| CN111849989A (en) * | 2020-07-30 | 2020-10-30 | 山东农业大学 | Method for enhancing salt tolerance of mulberry by utilizing long-chain non-coding RNA transgenic rootstock |
| CN111849989B (en) * | 2020-07-30 | 2021-11-23 | 山东农业大学 | Method for enhancing salt tolerance of mulberry by utilizing long-chain non-coding RNA transgenic rootstock |
| CN116083432A (en) * | 2023-03-17 | 2023-05-09 | 西南大学 | Mulberry U6 promoter and application thereof |
| CN116083432B (en) * | 2023-03-17 | 2023-07-04 | 西南大学 | Mulberry U6 promoter and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105039345B (en) | 2018-07-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105543270A (en) | Double resistance CRISPR/Cas9 carrier and application | |
| CN114752599B (en) | Verticillium dahliae VdNRPS3 gene antipathogen target gene fragment, interference vector and application thereof | |
| CN102943091B (en) | Method for cultivating tobacco capable of resisting various viruses by adopting RNAi (RNA interference) technique | |
| CN115820685A (en) | Citrus CsGSTF1 gene and application thereof | |
| CN105039345A (en) | Clone of miRNA for improving salt resistance capacity of mulberries and application thereof | |
| CN104711268A (en) | Insect-resistant gene Zm-Cry1A(h), biological material related to gene and application of gene | |
| CN104928318A (en) | Application of rice OsLEA5c-1 gene in heavy metal resisting rice variety cultivation | |
| CN103602705A (en) | Method for obtaining safely and optionally killed transgenic rice by using artificial micro ribonucleic acids (amiRNAs) | |
| CN105779492A (en) | Application of rice miR396c | |
| CN105112423A (en) | Clone of miRNA for enhancing disease resistance of mulberry and application thereof | |
| CN115820686A (en) | Citrus CsGSTU18 gene and application thereof | |
| CN105274135A (en) | RNAi vector widely used for multi-plant gene silencing and application | |
| CN101914571A (en) | Method for cleaning DNA transformation plant without choosing marker gene | |
| CN104928301B (en) | Verticillium dahliae thiamine transport protein course of disease key target gene and its interference carrier and application | |
| CN104628840B (en) | Plant stress tolerance correlative protein VrDREB2A and its encoding gene and application | |
| CN105039389B (en) | Sugarcane carrier-free frame transgenic method | |
| CN108424910A (en) | A kind of RNA segments and its application for target gene interference | |
| CN103361348B (en) | Relevant microRNA and coding nucleic acid molecule thereof and application is regulated and controled to rice leaf width | |
| CN103320441B (en) | Plant promoter and application thereof | |
| CN102382852A (en) | Method for obtaining tomatoes with high lycopene content and resistance to bacterial wilt through recombining genes | |
| CN110904109A (en) | miR1866 gene for controlling rice seed germination, overexpression vector, gRNA expression vector, preparation method and application thereof | |
| CN105255909B (en) | Verticillium dahliae oligosaccharyl transferase target fragment and interference carrier thereof and application | |
| CN104164425B (en) | miRNA, precursor of miRNA, their coding gene and application thereof | |
| CN110863006B (en) | Method for improving tillering and regeneration of rice | |
| CN116926088B (en) | Verticillium dahliae VdNRPS6 gene antipathogenic target gene fragment, interference vector and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180706 Termination date: 20190916 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |