CN113293107B - Saccharomyces cerevisiae for industrial production with high organic acid tolerance and construction method thereof - Google Patents

Abstract

The invention discloses a saccharomyces cerevisiae strain for industrial production with high organic acid tolerance performance and a construction method thereof, wherein the construction method comprises the steps of knocking out a protease A (PrA) coding allele and carrying out sequence recombination modification on a second PrA coding allele; compared with the original strain, under the YPD culture condition of pH3.0, the growth inhibition rate of citric acid on the recombinant strain is reduced by 33.0%, the growth inhibition rate of tartaric acid on the recombinant strain is reduced by 26.0%, and the growth inhibition rate of malic acid on the recombinant strain is reduced by 77.1%; meanwhile, the recombinant strain constructed by the invention shows higher ethanol fermentation generating capacity than that of the original strain in an anaerobic fermentation experiment; the invention provides a new thought and a new method for solving the problem of the inhibition of organic acid on fermentation on the premise of not adding an acid reducing agent and changing the production process, and has practical value and guiding significance for stabilizing industrial production, reducing production cost and protecting environment.

Description

Saccharomyces cerevisiae for industrial production with high organic acid tolerance and construction method thereof

Technical Field

The invention belongs to the technical field of bioengineering, relates to gene recombination of industrial microorganisms, and particularly relates to a saccharomyces cerevisiae strain with high organic acid tolerance for industrial production and a construction method thereof.

Technical Field

A large amount of organic acid is generated in the fermentation production process of the yeast, so that the acidity of a fermentation system is increased, and the pH value is reduced. Due to the limitation of acid resistance of saccharomyces cerevisiae, the increase of acidity in the fermentation mash can lead to the reduction of fermentation performance of the yeast, and influence the production. For some fermented foods (wine, bread, soy sauce, vinegar and the like), organic acids are also important flavor development substances and flavor precursors, and are indispensable for improving the flavor quality of foods. In the yeast fermentation production process, because various organic acids as fermentation byproducts are continuously generated, the pH value of fermentation mash is continuously reduced, and the acidity is continuously improved. However, the increase in acidity is detrimental to the production, including: firstly, inhibiting the generation of ethanol in the alcohol-producing fermentation to reduce the yield; secondly, beneficial bacteria such as yeast and the like are inhibited, and the growth and fermentation activity is reduced; thirdly, the activity of fermentation metabolism related enzyme is influenced, the consumption of raw materials is increased, and the production efficiency is reduced; fourthly, the output level of the product is reduced, the product yield is reduced, and even the fermentation is stopped and stopped early; for the 'double-side fermentation' production of simultaneous saccharification and fermentation, when the acidity is increased, the fermentation activity of yeast is weakened, but the saccharification is relatively enhanced, so that the sugar content in mash is greatly increased, the yeast cannot be fully utilized in time, rich nutrition is provided for the growth of mixed bacteria, and the advantage of fermentation strains is not utilized to inhibit the mixed bacteria. The growth of mixed bacteria is increased, the acidity is further improved, and the waste of materials such as sugar, starch and the like is caused. Meanwhile, the fermented product has foreign flavor, toxic substances are generated, the sensory quality of the product is influenced, and even the edible safety of the product is influenced.

The following methods are generally used in the production process to reduce the acidity of the fermentation system: directly adding alkali, such as NaOH and Na, for neutralization₂CO₃、NaHCO₃And so on. The use of strong alkali is easy to damage a buffer system, causes the components of a culture medium to be hydrolyzed, and simultaneously causes the salinity of fermentation liquor to be increased, the quality of products is damaged or the extraction difficulty of the products is increased, and the extraction efficiency is reduced; ② adjusting ventilation volume, accelerating oxidation of fatty acid, reducing acidity rise caused by accumulation of fatty acid. However, in order to ensure the fermentation, the method needs to use more types and quantities of antifoaming agents at the same time; supplementing physiological alkaline matrix such as ammonia water and urea by direct addition, fed-batch addition or batch addition. The method not only increases the production labor cost and the input of the raw material cost, but also influences the quality and the flavor of the product, and meanwhile, the method of adding the chemicals is the same as the method I, does not belong to an environment-friendly production process, and causes environmental pollution and increase of harmful emissions to a certain extent. In addition, an unavoidable excess of ammonia or ammonium (NH) is added in such a process₃Or NH₄ ⁺) Can cause the poisoning of microorganisms, so that the respiratory intensity of the microorganisms is greatly reduced, even fermentation stagnation is caused, and the generation of ethyl carbamate is increased through a urea circulation way, so that the edible safety of the product is influenced; fourthly, maintaining and improving the metabolic activity of the bacterial strain by using a mode of multiple feeding, and reducing the acidity of the fermentation system. The method has the effects of reducing acidity, supplementing nutrition and reducing fermentation repression caused by product inhibition, but has very limited acidity reduction amplitude, high requirement on the automation degree of production and greatly increases the energy consumption and labor cost of production.

Based on the current situation, a method with low energy consumption, low additional raw material and labor cost input and environmental friendliness is an ideal scheme for solving the practical problems in fermentation production. The inhibition effect of the acidity pressure of a fermentation system on fermentation is reduced, the quality of the product can be guaranteed to the greatest extent, the fermentation stability can be kept at the lowest economic cost, and meanwhile, the environment-friendly production process is favorably constructed. Therefore, how to improve the acidity tolerance of the production strain becomes a core idea for solving the key problems in such fermentation processes. The acid-resistant yeast can grow and ferment under the conditions of low pH and high organic acidity, and can synthesize self protein and propagate by using organic substances in fermentation waste liquid with high acidity, so that the acid-resistant yeast can also be used for treating organic fermentation waste liquid and producing single-cell protein or used as a host to express foreign protein, and the waste is changed into treasure.

Abundant organic acid generated in wine brewing production, especially in fruit wine fermentation production, can cause a high organic acid acidity environment of fermentation mash. The severe low pH pressure caused by a large amount of organic acid generated in the fermentation process can cause adverse effect on the activity of yeast, harm the physiology and metabolism of the saccharomyces cerevisiae, prolong the fermentation time, even influence the quality of the fermented product, and cause serious reduction of the quality of the final product. Meanwhile, the improvement of the acid resistance of the yeast may also play an important role in stabilizing the gene expression metabolism of the yeast. Studies have shown that changes in pH result in changes in the expression of hundreds of genes in the yeast genome. Thus, improving cell viability and fermentation performance of yeast strains in acidic environments is crucial for fermentative production.

Disclosure of Invention

Aiming at the defects, the invention provides the saccharomyces cerevisiae strain for industrial production with high organic acid tolerance and the construction method thereof, which obviously improve the tolerance to organic acids.

In order to achieve the purpose, the invention discloses the following technical scheme:

a Saccharomyces cerevisiae strain with high organic acid tolerance for industrial production, wherein the Saccharomyces cerevisiae contains an improved allele PEP4 'for encoding PrA, and the sequence of the allele PEP 4' is shown as SEQ ID NO: 2, respectively.

Further, the construction method of the saccharomyces cerevisiae strain for industrial production with high organic acid tolerance performance is characterized in that the construction method comprises the steps of carrying out sequence modification on a specific part of one allele PEP4 coding PrA on the basis of knocking out one allele PEP4 coding PrA of the initial saccharomyces cerevisiae; the nucleotide sequence of the knock-out allele PEP4 is shown as SEQ ID NO: 1 is shown in the specification; the nucleotide sequence of the modified allele PEP 4' is shown as SEQ ID NO: 2, respectively.

Further, according to the construction method of the saccharomyces cerevisiae strain with high organic acid tolerance for industrial production, the starting saccharomyces cerevisiae is commercially available yellow wine yeast.

Further, the construction method of the saccharomyces cerevisiae strain for industrial production with high organic acid tolerance performance comprises the following construction steps:

(1) an upstream segment DNA fragment 'U-PO' and a downstream segment DNA fragment 'D-PO' specified by a PrA coding sequence PEP4 are amplified by PCR using Saccharomyces cerevisiae genomic DNA as a template, and the two DNA fragments are ligated to obtain a DNA fragment 'PO'.

(2) After the DNA fragment ' PO ' is connected to the vector pMD19, inserting the DNA fragment ' Kan ' between the upstream and downstream of the ' PO ' sequence to replace part of the original PrA coding ORF sequence to obtain a recombinant plasmid, using the recombinant plasmid as a template, obtaining a recombinant DNA fragment through PCR amplification, and transforming a protease A coding sequence allele knockout strain with the recombinant DNA fragment to obtain a recombinant strain with one PrA allele PEP4 knockout and the other PrA allele coding sequence modified into PEP4 '.

Further, the construction method of the saccharomyces cerevisiae strain for industrial production with high organic acid tolerance performance comprises the following construction steps:

(1) construction of recombinant plasmid

Firstly, taking Saccharomyces cerevisiae genome DNA as a template, and obtaining an upstream segment 'U-PO' of a PEP4 gene coding ORF sequence through PCR amplification; the downstream segment D-PO of the PEP4 gene coding ORF sequence is obtained by PCR amplification by using Saccharomyces cerevisiae genome DNA as a template. Then connecting the DNA fragment 'U-PO' and the 'D-PO' to obtain a DNA fragment 'PO', and introducing 2 enzyme cutting sites into a connection product;

Secondly, cloning the DNA fragment PO into a vector pMD19 to obtain a recombinant plasmid. Using the plasmid pUG6 as a template, obtaining a DNA fragment 'Kan' through PCR amplification, and directionally inserting the obtained DNA fragment into a cloning site introduced by the 'PO' segment of the plasmid obtained in the step (1) to obtain a recombinant plasmid;

(2) sequence modification of a second allele of a PrA coding sequence

Taking the recombinant plasmid constructed in the step (1) as a template, and obtaining a recombinant DNA fragment 'REC-PO' used and substituted for the middle section of the ORF sequence of the PrA coding part by PCR amplification;

secondly, an electric shock transformation method is used, the recombinant DNA fragment REC-PO is transformed to complete the strain with the first PrA coding sequence allele knockout, and a recombinant strain with one PrA allele knockout and the other PrA allele coding sequence modification is obtained.

Further, the construction method of the saccharomyces cerevisiae strain with high organic acid tolerance for industrial production specifically comprises the following steps:

(1) construction of a PrA allele sequence knockout strain

Amplifying a DNA fragment 'REC-Kan' for PrA coding allele knockout by PCR by taking the plasmid pUG6 as a template;

secondly, the recombinant DNA fragment REC-Kan is transformed into a wild saccharomyces cerevisiae initial strain for industrial production to obtain a PrA allele knock-out recombinant strain.

(2) Construction of recombinant plasmid pSH/Zeo

PCR amplification of a DNA fragment "Zeocin Cassette" using the plasmid pTEF1/ZEO as a template;

② a DNA fragment 'Gal 1 promoter' is amplified by PCR by taking the plasmid pSH47 as a template;

PCR amplification of DNA fragment "TEF 1 promoter" using plasmid pTEF1/Zeo as template;

fourthly, connecting the DNA fragment Zeocin Cassette and the Gal1 promoter to obtain the DNA fragment EM7P-Sh ble-CYC1T-Gal 1P;

connecting the DNA fragment 'EM 7P-Sh ble-CYC1T-Gal 1P' and 'TEF 1 promoter' to obtain a DNA fragment 'TEFP-Sh ble-Gal 1P';

sixthly, the DNA fragment TEFP-Sh ble-Gal1P is connected to the plasmid pSH47 to obtain a recombinant plasmid pSH/Zeo.

(3) Rescue of recombinant selectable markers

Firstly, transforming a PrA allele knockout recombinant strain by using a recombinant plasmid pSH/Zeo electric shock;

secondly, a galactose culture medium is used for culturing the transformant strain, the expression of Cre recombinase is induced, and the KanMX screening marker introduced into the first PrA coding allele knockout is realized.

(4) Modification of the second PrA allele coding sequence

Firstly, using Saccharomyces cerevisiae SWY85 genome DNA as a template, and respectively obtaining DNA fragments 'U-PO' and 'D-PO' through PCR amplification;

② connecting the DNA fragment 'U-PO' and 'D-PO' to obtain the DNA fragment 'PO';

Thirdly, inserting the DNA fragment 'PO' into a plasmid pUC19 to obtain a recombinant plasmid 'pHR';

inserting the DNA fragment 'Kan' amplified by using the plasmid pUG6 as a template into the 'PO' sequence on the recombinant plasmid pHR to obtain a recombinant plasmid pHR 31;

fifthly, amplifying the recombinant DNA fragment REC-PO by PCR by using the recombinant plasmid pHR31 as a template, and screening and marking the recombinant DNA fragment in the step (3) by electric shock transformation to obtain a rescued strain, thereby obtaining a final recombinant strain named as SWY-ZH.

The invention has at least the following beneficial effects:

1. the recombinant strain constructed by the invention has obviously improved tolerance to organic acid, and cell growth experiment results of enhancing the acidity of the culture medium by respectively using citric acid, tartaric acid and malic acid show that, compared with the original strain, under the YPD culture condition of pH3.0, the growth inhibition rate of citric acid to the recombinant strain is reduced by 33.0%, the growth inhibition rate of tartaric acid to the recombinant strain is reduced by 26.0%, and the growth inhibition rate of malic acid to the recombinant strain is reduced by 77.1%. The tolerance performance of the recombinant strain to organic acid is obviously better than that of the original strain.

2. The recombinant strain constructed by the invention shows higher ethanol fermentation generation capacity than that of the original strain in an anaerobic fermentation experiment, and the conversion rate of a carbon source in the anaerobic fermentation is obviously higher than that of the original strain.

3. The saccharomyces cerevisiae strain with high organic acid tolerance performance constructed by the invention is realized by modifying part of allele of another PrA coding sequence after knocking out one allele of the PrA coding sequence, and provides a new direction for breeding excellent saccharomyces cerevisiae strains with high organic acid tolerance.

Drawings

FIG. 1 shows the construction process of recombinant strain SWY-ZH;

FIG. 2 is an electrophoretogram of a recombinant DNA fragment for the first PrA-encoding allelic knockout, with a target band size of 1702bp, DL2000 DNA Ladder Marker in lane 1, and target bands in lanes 2 and 3;

FIG. 3 shows the first PCR identification result electrophoresis of PrA encoded allele knocked-out colonies, the first lane is 250bp DNA Ladder Marker, the left is a target product band with the size of 798bp, and the right is a target product band with the size of 722 bp;

FIG. 4 shows an electrophoretogram of the constructed plasmid pSH/Zeo, wherein the first lane is Supercoid DNA Ladder Marker, and the second lane is the constructed recombinant plasmid pSH/Zeo;

FIG. 5 shows the identification result of the screening Marker sequence of the recombinant strain after the rescue of the screening Marker, wherein the first lane is a 250bp DNA Ladder Marker, and the remaining lanes are amplification products, and the screening Marker sequence is not amplified, indicating that the rescue is successful;

FIG. 6 is a structural map of a recombinant plasmid pHR31 constructed;

FIG. 7 shows a recombinant DNA electropherogram used to engineer the coding sequence of a second PrA allele, in which the first lane is a 250bp DNA Ladder Marker, and lanes 2 and 3 are PCR product recombinant DNA fragment "REC-PO" bands, 2605bp in size;

FIG. 8 shows an electrophoretogram of recombinants after yeast strains are transformed with recombinant DNA fragment "REC-PO" by electric shock, wherein the first lane is 250bp DNA Ladder Marker, the left lanes 2, 3 and 4 are 1228bp DNA bands, and the right lanes 2, 3 and 4 are 1277bp DNA bands;

FIG. 9 inhibition of cell growth performance of the strain by acidification of YPD medium with organic acid to pH 3.0;

FIG. 10 inhibition of cell growth performance of strains by acidification of YPD medium with organic acid to pH 2.7;

FIG. 11 shows the inhibition of the cell growth performance of the strain when the SD medium is acidified to pH3.0 with an organic acid;

FIG. 12 shows the inhibition of the cell growth performance of the strain when the SD medium is acidified to pH2.7 with an organic acid;

FIG. 13 shows the difference between the tolerance of the constructed Saccharomyces cerevisiae strain and the tolerance of the original strain to organic acids under solid culture conditions;

FIG. 14 shows the alcohol content of fermentation broth after anaerobic fermentation for 124 h;

FIG. 15 shows the residual sugar concentration in the fermentation broth after 124h of anaerobic fermentation using the strain;

FIG. 16 shows the alcohol content of the fermentation broth after fermentation for 124h, wherein the initial pH of the fermentation broth is adjusted to 3.0 by citric acid;

FIG. 17 shows the alcohol content of the fermentation broth after fermentation for 124h, wherein malic acid is used to adjust the initial pH to 3.0;

FIG. 18 shows the alcoholic strength of the fermentation broth after fermentation for 124h with the initial pH adjusted to 3.0 using citric acid.

Detailed Description

The invention will be further illustrated by the following specific examples, which are given by way of illustration only and not by way of limitation, and the reagents described are commercially available without further description.

The whole recombinant strain SWY-ZH was constructed as shown in FIG. 1. The starting yeast is commercially available yellow wine yeast (available from Angel Yeast), designated SWY85 in the present invention for convenience of description; SWY85F is an intermediate strain in the construction process of the invention, and SWY-ZH is the strain number of the recombinant yeast finally constructed.

Example 1

Construction of a PrA-encoding allele knock-out and a PrA-encoding allele-modified strain

(1) Knockout of PrA-encoding alleles

PCR amplifying kanamycin resistant fragment by using plasmid pUG6 as a template, adding homologous arms in front and back of the sequence, knocking out PrA encoding allele PEP4 (the full-length sequence in a genome is SEQ ID NO: 1 and comprises an original 1kb promoter coding region and an original 1kb terminator coding region), wherein the amplified DNA fragment is REC-Kan;

An upstream primer Rec-F:

5’-GTATTTAATCCAAATAAAATTCAAACAAAAACCAAAACTAACATGCAGCTGAAGCTTCGTACGC-3’,SEQ ID NO：3；

the downstream primer Rec-R:

5’-ATGGCAGAAAAGGATAGGGCGGAGAAGTAAGAAAAGTTTAGCTCGCATAGGCCACTAGTGGATC TG-3’，SEQ ID NO：4

the thick part is a homologous arm

The conditions of the PCR reaction were: 5 minutes at 94 ℃, 30 seconds at 94 ℃, 40 seconds at 58 ℃, 1 minute 50 seconds at 72 ℃ (30 cycles), 7 minutes at 72 ℃. The PCR amplification products were identified by electrophoresis on a 1% agarose gel as shown in FIG. 2;

PCR reaction System (50. mu.l)

Primer concentration is 0.3. mu.M, containing template DNA 30ng, the other components according to the PCR reagent product supplier provided instructions for adding;

secondly, transforming the saccharomyces cerevisiae cells by using the DNA fragments obtained by PCR amplification through an electric shock transformation method;

thirdly, colony PCR is used, primer combinations of A, U-PEP-F/I-Kan-R and B, I-Kan-F/D-PEP-R are used for identifying the transformant strains, and the sequences of the primers are as follows:

U-PEP-F：5’-AGGATTTGCCACTGAGGTTC-3’；SEQ ID NO：5；

I-Kan-R:5’-TCACCGAGGCAGTTCCAT-3’；SEQ ID NO：6；

I-Kan-F:5’-CTATGGAACTGCCTCGGTG-3’；SEQ ID NO：7；

D-PEP-R:5’-CGCTTCTGCTTACATTGCTTTA-3’；SEQ ID NO：8；

the conditions of the PCR reaction were: 94 ℃ for 5 minutes, 94 ℃ for 30 seconds, 56 ℃ for 40 seconds, 72 ℃ for 50 seconds (32 cycles), 72 ℃ for 7 minutes. Identifying the PCR amplification product by using 1% agarose gel electrophoresis;

the sizes of the PCR products obtained by amplification are 798bp (primer combination A) and 722bp (primer combination B) respectively, and the PCR products are recombinants strains which are named as SWY85F and are shown in figure 3;

(2) construction of plasmid pSH/Zeo

PCR amplification of DNA fragment "Zeocin Cassette" with plasmid pTEF1/ZEO as template;

primer sequence E-PF: 5' -GG GGTACCGGGGCGGTGTTGACAATTA-3’；SEQ ID NO：9

Primer sequence C-PR: 5'-CAGATTGTACTGAGAGTGCACCATAT-3', respectively; SEQ ID NO: 10;

② a DNA fragment 'Gal 1 promoter' is amplified by PCR by taking the plasmid pSH47 as a template;

primer sequence Gal1P-PF 5' -GGGAATTCGCTCTAGTACGGATTAGAAGCC-3’；SEQ ID NO：11；

Primer sequence Gal1P-PR 5'-CGGTATCGATAAGCTTGATATCGAA-3'; SEQ ID NO: 12;

③ using the plasmid pTEF1/Zeo as a template to amplify a DNA fragment "TEF 1 promoter" by PCR;

a primer sequence TEFP-PF: 5'-GGGAGCTCTAGGTCTAGAGATCTGTTTAGCTTGCC-3'; SEQ ID NO: 13;

5'-GGGGTACCGGTTGTTTATGTTCGGATGTGATG-3' as primer sequence TEFP-PR; SEQ ID NO: 14;

the underlined part is the restriction site;

the conditions of the PCR reaction were: 94 ℃ for 5 minutes, 94 ℃ for 30 seconds, 58 ℃ for 40 seconds, 72 ℃ for 40 seconds (30 cycles), 72 ℃ for 7 minutes.

Fourthly, connecting the DNA fragment 'Gal 1 promoter' obtained by PCR amplification with 'Zeo Cassette' to obtain a DNA fragment 'EM 7P-Sh ble-CYC1T-Gal 1P';

connecting the DNA fragment 'EM 7P-Sh ble-CYC1T-Gal 1P' and 'TEF promoter' to obtain a DNA fragment 'TEFP-Sh ble-Gal 1P';

sixthly, inserting the DNA fragment TEFP-Sh ble-Gal1P into the plasmid pSH47 to obtain a recombinant plasmid pSH/Zeo, and showing in a figure 4;

(3) recombinant strain selection Marker rescue (Marker rescue)

Transforming the recombinant strain obtained in the step (1) by using a plasmid pSH/Zeo electric shock;

inducing the Cre recombinase expression in the plasmid pSH/Zeo by using YPG liquid culture medium;

thirdly, PCR identification is carried out on the rescue result of the screening marker by the primer combination InKan-PF/InKan-PR;

primer sequence InKan-PF: GGATTTGCCACTGAGGTTCTTCTT, respectively; SEQ ID NO: 15;

primer sequence InKan-PR: CACATACGATTGACGCATGATATTACTT, respectively; SEQ ID NO: 16;

the conditions of the PCR reaction were: 5 minutes at 94 ℃, 30 seconds at 94 ℃, 40 seconds at 56 ℃, 1 minute 40 seconds at 72 ℃ (30 cycles), 7 minutes at 72 ℃.

The colony which can not amplify the 1084bp DNA fragment is the target colony, and the FIG. 5 shows the target colony;

(4) construction of recombinant DNA sequences that modified the PrA allele-encoding sequence (the modified full-length sequence PEP 4' is shown in SEQ ID NO: 2, comprising the original 1kb promoter-encoding region and the original 1kb terminator-encoding region)

Taking saccharomyces cerevisiae genome DNA as a template, and carrying out PCR amplification to obtain a DNA fragment 'U-PO';

primer sequence A-PO-F: 5' -GCGGGATCCTGGCCTTGTTGTTGGTCAG-3’；SEQ ID NO：17；

Primer sequence A-PO-R: 5' -GCGGAATTCGCGAAGTCTTGTTTTGGAATG-3’；SEQ ID NO：18；

Secondly, using Saccharomyces cerevisiae genome DNA as a template, and carrying out PCR amplification to obtain a DNA fragment D-PO;

primer sequence B-PO-F: 5' -GCGGGTACCCTGAAAATGGCGGTGAAGC-3’；SEQ ID NO：19；

Primer sequence B-PO-R: 5' -GCGGTCGACTTGCCCAAATCGTAAATAGAATA-3’；SEQ ID NO：20；

Thirdly, DNA fragments 'U-PO' and 'D-PO' are taken as templates, and the DNA fragments 'PO' are obtained through PCR amplification;

Primer sequences Inter-PO:

5’-CATTCCAAAACAAGACTTCGCGAATTCCCGCGGTACCCTGAAAATGGCGGTGAAGC-3’；SEQ ID NO：21；

inserting the DNA fragment 'PO' into a plasmid pMD19 to obtain a recombinant plasmid named 'pHR';

using plasmid pUG6 as template, obtaining DNA fragment 'Kan' by PCR amplification;

primer sequence Kan-U: 5'-GCGGAATTCCAGCTGAAGCTTCGTACGC-3'; the amino acid sequence of SEQ ID NO: 22;

primer sequence Kan-D: 5'-GCGGGTACCGCATAGGCCACTAGTGGATCTG-3'; SEQ ID NO: 23;

the conditions of the PCR reaction were: 5 minutes at 94 ℃, 30 seconds at 94 ℃, 40 seconds at 58 ℃, 1 minute 40 seconds at 72 ℃ (30 cycles), 7 minutes at 72 ℃.

Sixthly, inserting the DNA fragment 'Kan' into the plasmid pHR to obtain a recombinant plasmid pHR 31;

seventhly, obtaining a recombinant DNA fragment 'REC-PO' with the size of 2605bp by PCR amplification by taking the plasmid pHR31 as a template;

primer sequence REC-PO-F: 5'-TGGCCTTGTTGTTGGTCAG-3', respectively; SEQ ID NO: 24;

a primer sequence REC-PO-R: 5'-TTGCCCAAATCGTAAATAGAATA-3'; SEQ ID NO: 25;

(viii) using recombinant DNA fragment "REC-PO" electric shock to convert the screened and labeled rescued yeast;

ninthly, identifying the recombinant strain by a colony PCR method, wherein U-PEkno-F: AAGGGGCGGAGGCG, respectively; SEQ ID NO: 26; U-Kakono-R: GTCTGTGAGGGGAGCGTTT, respectively; SEQ ID NO: 27; D-Kakno-F: CGTATGTGAATGCTGGTCGC, respectively; SEQ ID NO: 28 and D-PEkno-R: CCTGGGTGAAGGAAGGGAT, respectively; SEQ ID NO: 29; the conditions of the PCR reaction were: 5 minutes at 94 ℃, 30 seconds at 94 ℃, 40 seconds at 58 ℃, 1 minute 40 seconds at 72 ℃ (32 cycles), 7 minutes at 72 ℃. When the length of the specific DNA fragment obtained by amplification by using the primer combination U-PEkno-F/U-Kakno-R is 1228bp and the length of the specific DNA fragment obtained by amplification by using the primer combination D-Kakno-F/D-PEkno-R is 1277bp, the recombinant sub-colony with accurate site recombination is generated. The experimental result shows that the target recombinant yeast strain is obtained through the experiment, and FIG. 8 is an electrophoretogram for identifying the recombinant strain SWY-ZH.

Example 2

Comparison of tolerance to organic acids in liquid culture

The Saccharomyces cerevisiae strains SWY85, SWY85F and SWY-ZH were activated and cultured in YPD liquid medium with natural acidity under the conditions of 30 ℃ and 160rpm for 48 hours. Adjusting pH of YPD medium and synthetic nitrogen source limiting medium (SD medium) to 30 and 27 with citric acid, tartaric acid and malic acid, respectively, inoculating the cells of the strain activated in advance with natural acidity YPD liquid medium to natural acidity YPD liquid medium at an inoculation amount of 01% and adjusting pH to 30 and 27 with organic acid, culturing at 30 deg.C and 160rpm to middle and late logarithmic growth, and measuring cell growth (OD₆₀₀Value) of the amount of growth (OD) of the cells cultured in YPD medium of natural acidity for the same period of time₆₀₀Value) as a control, the cell growth inhibition rate was calculated according to the formula ir (inhibition rate) ═ OD₆₀₀N-OD₆₀₀A)/OD₆₀₀N, wherein: OD₆₀₀N is the growth amount of the strain in YPD medium with natural acidity, OD₆₀₀A is the amount of growth of the strain in YPD medium acidified with an organic acid. The IR value indicates the degree of inhibition of the growth of the strain by the organic acid, and the smaller the IR value, the smaller the inhibition of the growth of the strain by the organic acid, and the stronger the tolerance to the organic acid. The experimental result shows that after the experimental method is used for carrying out different modification on two encoding alleles of PrA of Saccharomyces cerevisiae SWY85, the tolerance performance of the strain to organic acid is remarkably improved under the conditions of sufficient nitrogen source and liquid medium culture limited by the nitrogen source (figures 9-12).

Example 3

Comparison of solid culture organic acid tolerance

Preparation of a culture medium: the culture medium was prepared by referring to the experiment of the acid-resistant portion of the liquid culture, and the solid culture medium required 2% agar to be added to the liquid culture medium for solidification. After adjusting the pH of the solid YPD medium to 30 and 27 using citric acid, tartaric acid and malic acid, respectively, the plate was poured for use.

Centrifuging at 5000rpm, collecting cell culture solution cultured for 48 hours by using a liquid YPD culture medium under the culture conditions of 28-30 ℃ and 160rpm, washing bacterial cells for 2 times by using sterilized water, suspending to the same cell concentration, diluting according to the gradient concentration of a multiple of 10, inoculating 3 microliters of the cell culture solution on a prepared organic acidification solid culture medium, statically culturing for 48-72 hours at 28-30 ℃, observing colony formation, and comparing between a constructed strain and a wild strain, wherein the constructed saccharomyces cerevisiae strain SWY-ZH has stronger tolerance to organic acids than an original strain SWY85 as shown in figure 13.

Example 4

Comparison of fermentation Performance of Natural acidity Medium alcohol

The YPD medium is used for activating strain cells to the middle and later logarithmic growth period, and the strain cells are inoculated into the YPD fermentation medium (the content of D-glucose is increased to 200g/L) according to the inoculation amount of 1 percent, and the fermentation volume is as follows: 35L, fermentation temperature: constant temperature 30 ℃, stirring speed: 120. + -.1 rpm, aeration: anaerobic (N) ₂) And the fermentation period is as follows: for 72 hours. And after the fermentation is finished, measuring the alcoholic strength in the fermentation liquor by using a gas chromatography. The experimental result is shown in figure 14, after the fermentation medium containing 200g/L glucose carbon source is subjected to anaerobic fermentation for 124 hours, the alcoholic strength generated by the PrA allele modified strain SWY-ZH is extremely higher than that generated by the original strain SWY85, the residual sugar concentration in the fermentation liquid has no significant difference, and the carbon source conversion rate of the recombinant strain SWY-ZH is higher than that of the original strain.

Example 5

Comparison of fermentation Performance of alcohol under organic acidic conditions

YPD fermentation medium was acidified to pH30 with an organic acid, and fermentation test was carried out in the same manner as in example 4. In all three organic acid fermentation groups, the alcohol production of the recombinant strain SWY-ZH was significantly higher than that of the original strain (p < 0.01), FIGS. 15-18.

Sequence listing

<110> Shaoxing academy of culture and literature

<120> high organic acid tolerance saccharomyces cerevisiae for industrial production and construction method thereof

<130> 2021

<140> 2021102289143

<141> 2021-03-02

<160> 29

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3218

<212> DNA

<213> Saccharomyces cerevisiae

<400> 1

gccagttagc gatacaaata ataacggcaa taattcggta ctaaacgact tggtagagtc 60

accgattaat gcgaatacgg ggaacatttt gaagagaata cattcggtaa gtttatcgca 120

atcacaaatt gatcctagta agaaggttaa aagggcaaaa ttggaccaaa cctcaaaagg 180

ccccgagaat ttgcaatttt cgtaaccaag gacaaatacc catagaaaat gctgcccctt 240

tttaagagag aagatggtag ataccaatac tcagaattca tctattcata actttttggg 300

tttttattac atatagagtg acgttttgat acgatttaca ttttgaaata tatagatttt 360

tgtatattaa taagttttga ttttcagttt tagttatgct taatgaattt ttgaatcaga 420

aaaagaagtt ctgaaaaaaa cataatcctg cttgatgtgg tacaacaagc tcataaataa 480

ttttaaaaag tttgttaatc cgttttcaat atcttgagct cctcaattgt atttgctgag 540

gtctgattat ttctataacc aaaagcggtt attgaatcta tggagaggct gtaacccgtc 600

ttatgccttc cgggtactat atttcatttg cgggtgtcga tggattaagg ggcggaggcg 660

gcccttttta ggatttatat aaaaagccat acttccgtac ttcgtaacct cttatcaact 720

ggttaaggga acagagtaaa gaagtttggg taattcgctg ctatttattc attccacctt 780

cttctttttt gagcgaagcc tttataatca aattttagtg gtcttttcta tttttatttg 840

agaagcctac cacgtaaggg aagaataaca aaaagtatat ctcaccctac tgtattcata 900

aaaagttttt tctattagaa ttctataaga aaagaaaaaa aaaaagccta gtgacctagt 960

atttaatcca aataaaattc aaacaaaaac caaaactaac atgttcagct tgaaagcatt 1020

attgccattg gccttgttgt tggtcagcgc caaccaagtt gctgcaaaag tccacaaggc 1080

taaaatttat aaacacgagt tgtccgatga gatgaaagaa gtcactttcg agcaacattt 1140

agctcattta ggccaaaagt acttgactca atttgagaaa gctaaccccg aagttgtttt 1200

ttctagggag catcctttct tcactgaagg tggtcacgat gttccattga caaattactt 1260

gaacgcacaa tattacactg acattacttt gggtactcca cctcaaaact tcaaggttat 1320

tttggatact ggttcttcaa acctttgggt tccaagtaac gaatgtggtt ccttggcttg 1380

tttcctacat tctaaatacg atcatgaagc ttcatcaagc tacaaagcta atggtactga 1440

atttgccatt caatatggta ctggttcttt ggaaggttac atttctcaag acactttgtc 1500

catcggggat ttgaccattc caaaacaaga cttcgctgag gctaccagcg agccgggctt 1560

aacatttgca tttggcaagt tcgatggtat tttgggtttg ggttacgata ccatttctgt 1620

tgataaggtg gtccctccat tttacaacgc cattcaacaa gatttgttgg acgaaaagag 1680

atttgccttt tatttgggag acacttcaaa ggatactgaa aatggcggtg aagccacctt 1740

tggtggtatt gacgagtcta agttcaaggg cgatatcact tggttacctg ttcgtcgtaa 1800

ggcttactgg gaagtcaagt ttgaaggtat cggtttaggc gacgagtacg ccgaattgga 1860

gagccatggt gccgccatcg atactggtac ttctttgatt accttgccat caggattagc 1920

tgaaatgatt aatgctgaaa ttggggccaa gaagggttgg accggtcaat atactctaga 1980

ctgtaacacc agagacaatc tacctgatct aattttcaac ttcaatggct acaacttcac 2040

tattgggcca tacgattaca cgcttgaagt ttcaggctcc tgtatctctg caattacacc 2100

aatggatttc ccagaacctg ttggcccact ggccatcgtt ggtgatgcct tcttgcgtaa 2160

atactattct atttacgatt tgggcaacaa tgcggttggt ttggccaaag caatttgagc 2220

taaacttttc ttacttctcc gccctatcct tttctgccat ctagagagct tttataagta 2280

gataacaata aaaaaaacta tagtatattt aaaaaaaaaa aacaagacaa accatcttgt 2340

cctcagtttt agaatccatt gttctatgct gctgcccata atgtcattat atgcgggtag 2400

cccgatgatg cggctcgaga atttccttgt ttatcctttt ccaatagcgg aacaattgat 2460

aataaagcaa tgtaagcaga agcgaaaaat aaaaagaaat aggctgcaga gattcacagg 2520

ctgcgctcta gaaacatttg aaatcaaggc aaacatagaa cacttgataa aattcttacc 2580

ataataccac cattgatgat tcaaaaaatg agcccaagct taaggaggcc atcaacgagg 2640

tctagttctg gttcaagtaa tatcccacaa tcgccctctg tacgatcaac ttcatcgttt 2700

tctaatctga caagaaactc catacggagc acctctaatt cgggttctca gtcgatttct 2760

gcatcttcca ctagaagtaa ctccccacta agatccgtat cagccaaatc cgatcccttc 2820

cttcacccag gtaggataag gatcaggcgg agcgacagta ttaacaacaa ctcgagaaaa 2880

aacgatacat atactgggtc aatcactgtg accatccggc cgaaaccacg gagcgttgga 2940

acttcccgtg accatgtggg gctaaaatcg cccaggtact ctcaaccaag atccaactca 3000

catcacggta gcaatacatt tgttagagac ccctggttta ttactaatga caaaacaata 3060

gtgcatgaag aaattggaga gttcaagttc gatcatgttt ttgcttccca ttgcactaat 3120

ttggaagttt atgaaagaac cagtaaacca atgattgata agttattgat ggggtttaat 3180

gccaccatat ttgcgtacgg tatgaccggg tcaggtaa 3218

<210> 2

<211> 4665

<212> DNA

<213> artificial

<400> 2

gccagttagc gatacaaata ataacggcaa taattcggta ctaaacgact tggtagagtc 60

accgattaat gcgaatacgg ggaacatttt gaagagaata cattcggtaa gtttatcgca 120

atcacaaatt gatcctagta agaaggttaa aagggcaaaa ttggaccaaa cctcaaaagg 180

ccccgagaat ttgcaatttt cgtaaccaag gacaaatacc catagaaaat gctgcccctt 240

tttaagagag aagatggtag ataccaatac tcagaattca tctattcata actttttggg 300

tttttattac atatagagtg acgttttgat acgatttaca ttttgaaata tatagatttt 360

tgtatattaa taagttttga ttttcagttt tagttatgct taatgaattt ttgaatcaga 420

aaaagaagtt ctgaaaaaaa cataatcctg cttgatgtgg tacaacaagc tcataaataa 480

ttttaaaaag tttgttaatc cgttttcaat atcttgagct cctcaattgt atttgctgag 540

gtctgattat ttctataacc aaaagcggtt attgaatcta tggagaggct gtaacccgtc 600

ttatgccttc cgggtactat atttcatttg cgggtgtcga tggattaagg ggcggaggcg 660

gcccttttta ggatttatat aaaaagccat acttccgtac ttcgtaacct cttatcaact 720

ggttaaggga acagagtaaa gaagtttggg taattcgctg ctatttattc attccacctt 780

cttctttttt gagcgaagcc tttataatca aattttagtg gtcttttcta tttttatttg 840

agaagcctac cacgtaaggg aagaataaca aaaagtatat ctcaccctac tgtattcata 900

aaaagttttt tctattagaa ttctataaga aaagaaaaaa aaaaagccta gtgacctagt 960

atttaatcca aataaaattc aaacaaaaac caaaactaac atgttcagct tgaaagcatt 1020

attgccattg gccttgttgt tggtcagcgc caaccaagtt gctgcaaaag tccacaaggc 1080

taaaatttat aaacacgagt tgtccgatga gatgaaagaa gtcactttcg agcaacattt 1140

agctcattta ggccaaaagt acttgactca atttgagaaa gctaaccccg aagttgtttt 1200

ttctagggag catcctttct tcactgaagg tggtcacgat gttccattga caaattactt 1260

gaacgcacaa tattacactg acattacttt gggtactcca cctcaaaact tcaaggttat 1320

tttggatact ggttcttcaa acctttgggt tccaagtaac gaatgtggtt ccttggcttg 1380

tttcctacat tctaaatacg atcatgaagc ttcatcaagc tacaaagcta atggtactga 1440

atttgccatt caatatggta ctggttcttt ggaaggttac atttctcaag acactttgtc 1500

catcggggat ttgaccattc caaaacaaga cttcgctgaa ttccagctga agcttcgtac 1560

gctgcaggtc gacaaccctt aatataactt cgtataatgt atgctatacg aagttattag 1620

gtctagagat ctgtttagct tgcctcgtcc ccgccgggtc acccggccag cgacatggag 1680

gcccagaata ccctccttga cagtcttgac gtgcgcagct caggggcatg atgtgactgt 1740

cgcccgtaca tttagcccat acatccccat gtataatcat ttgcatccat acattttgat 1800

ggccgcacgg cgcgaagcaa aaattacggc tcctcgctgc agacctgcga gcagggaaac 1860

gctcccctca cagacgcgtt gaattgtccc cacgccgcgc ccctgtagag aaatataaaa 1920

ggttaggatt tgccactgag gttcttcttt catatacttc cttttaaaat cttgctagga 1980

tacagttctc acatcacatc cgaacataaa caaccatggg taaggaaaag actcacgttt 2040

cgaggccgcg attaaattcc aacatggatg ctgatttata tgggtataaa tgggctcgcg 2100

ataatgtcgg gcaatcaggt gcgacaatct atcgattgta tgggaagccc gatgcgccag 2160

agttgtttct gaaacatggc aaaggtagcg ttgccaatga tgttacagat gagatggtca 2220

gactaaactg gctgacggaa tttatgcctc ttccgaccat caagcatttt atccgtactc 2280

ctgatgatgc atggttactc accactgcga tccccggcaa aacagcattc caggtattag 2340

aagaatatcc tgattcaggt gaaaatattg ttgatgcgct ggcagtgttc ctgcgccggt 2400

tgcattcgat tcctgtttgt aattgtcctt ttaacagcga tcgcgtattt cgtctcgctc 2460

aggcgcaatc acgaatgaat aacggtttgg ttgatgcgag tgattttgat gacgagcgta 2520

atggctggcc tgttgaacaa gtctggaaag aaatgcataa gcttttgcca ttctcaccgg 2580

attcagtcgt cactcatggt gatttctcac ttgataacct tatttttgac gaggggaaat 2640

taataggttg tattgatgtt ggacgagtcg gaatcgcaga ccgataccag gatcttgcca 2700

tcctatggaa ctgcctcggt gagttttctc cttcattaca gaaacggctt tttcaaaaat 2760

atggtattga taatcctgat atgaataaat tgcagtttca tttgatgctc gatgagtttt 2820

tctaatcagt actgacaata aaaagattct tgttttcaag aacttgtcat ttgtatagtt 2880

tttttatatt gtagttgttc tattttaatc aaatgttagc gtgatttata ttttttttcg 2940

cctcgacatc atctgcccag atgcgaagtt aagtgcgcag aaagtaatat catgcgtcaa 3000

tcgtatgtga atgctggtcg ctatactgct gtcgattcga tactaacgcc gccatccagt 3060

gtcgaaaacg agctctcgag aacccttaat ataacttcgt ataatgtatg ctatacgaag 3120

ttattaggtg atatcagatc cactagtggc ctatgcggta ccctgaaaat ggcggtgaag 3180

ccacctttgg tggtattgac gagtctaagt tcaagggcga tatcacttgg ttacctgttc 3240

gtcgtaaggc ttactgggaa gtcaagtttg aaggtatcgg tttaggcgac gagtacgccg 3300

aattggagag ccatggtgcc gccatcgata ctggtacttc tttgattacc ttgccatcag 3360

gattagctga aatgattaat gctgaaattg gggccaagaa gggttggacc ggtcaatata 3420

ctctagactg taacaccaga gacaatctac ctgatctaat tttcaacttc aatggctaca 3480

acttcactat tgggccatac gattacacgc ttgaagtttc aggctcctgt atctctgcaa 3540

ttacaccaat ggatttccca gaacctgttg gcccactggc catcgttggt gatgccttct 3600

tgcgtaaata ctattctatt tacgatttgg gcaacaatgc ggttggtttg gccaaagcaa 3660

tttgagctaa acttttctta cttctccgcc ctatcctttt ctgccatcta gagagctttt 3720

ataagtagat aacaataaaa aaaactatag tatatttaaa aaaaaaaaac aagacaaacc 3780

atcttgtcct cagttttaga atccattgtt ctatgctgct gcccataatg tcattatatg 3840

cgggtagccc gatgatgcgg ctcgagaatt tccttgttta tccttttcca atagcggaac 3900

aattgataat aaagcaatgt aagcagaagc gaaaaataaa aagaaatagg ctgcagagat 3960

tcacaggctg cgctctagaa acatttgaaa tcaaggcaaa catagaacac ttgataaaat 4020

tcttaccata ataccaccat tgatgattca aaaaatgagc ccaagcttaa ggaggccatc 4080

aacgaggtct agttctggtt caagtaatat cccacaatcg ccctctgtac gatcaacttc 4140

atcgttttct aatctgacaa gaaactccat acggagcacc tctaattcgg gttctcagtc 4200

gatttctgca tcttccacta gaagtaactc cccactaaga tccgtatcag ccaaatccga 4260

tcccttcctt cacccaggta ggataaggat caggcggagc gacagtatta acaacaactc 4320

gagaaaaaac gatacatata ctgggtcaat cactgtgacc atccggccga aaccacggag 4380

cgttggaact tcccgtgacc atgtggggct aaaatcgccc aggtactctc aaccaagatc 4440

caactcacat cacggtagca atacatttgt tagagacccc tggtttatta ctaatgacaa 4500

aacaatagtg catgaagaaa ttggagagtt caagttcgat catgtttttg cttcccattg 4560

cactaatttg gaagtttatg aaagaaccag taaaccaatg attgataagt tattgatggg 4620

gtttaatgcc accatatttg cgtacggtat gaccgggtca ggtaa 4665

<210> 3

<211> 64

<212> DNA

<213> artificial

<400> 3

gtatttaatc caaataaaat tcaaacaaaa accaaaacta acatgcagct gaagcttcgt 60

acgc 64

<210> 4

<211> 66

<212> DNA

<213> artificial

<400> 4

atggcagaaa aggatagggc ggagaagtaa gaaaagttta gctcgcatag gccactagtg 60

gatctg 66

<210> 5

<211> 20

<212> DNA

<213> artificial

<400> 5

aggatttgcc actgaggttc 20

<210> 6

<211> 18

<212> DNA

<213> artificial

<400> 6

tcaccgaggc agttccat 18

<210> 7

<211> 19

<212> DNA

<213> artificial

<400> 7

ctatggaact gcctcggtg 19

<210> 8

<211> 22

<212> DNA

<213> artificial

<400> 8

cgcttctgct tacattgctt ta 22

<210> 9

<211> 27

<212> DNA

<213> artificial

<400> 9

ggggtaccgg ggcggtgttg acaatta 27

<210> 10

<211> 26

<212> DNA

<213> artificial

<400> 10

cagattgtac tgagagtgca ccatat 26

<210> 11

<211> 30

<212> DNA

<213> artificial

<400> 11

gggaattcgc tctagtacgg attagaagcc 30

<210> 12

<211> 25

<212> DNA

<213> artificial

<400> 12

cggtatcgat aagcttgata tcgaa 25

<210> 13

<211> 35

<212> DNA

<213> artificial

<400> 13

gggagctcta ggtctagaga tctgtttagc ttgcc 35

<210> 14

<211> 32

<212> DNA

<213> artificial

<400> 14

ggggtaccgg ttgtttatgt tcggatgtga tg 32

<210> 15

<211> 24

<212> DNA

<213> artificial

<400> 15

ggatttgcca ctgaggttct tctt 24

<210> 16

<211> 28

<212> DNA

<213> artificial

<400> 16

cacatacgat tgacgcatga tattactt 28

<210> 17

<211> 28

<212> DNA

<213> artificial

<400> 17

gcgggatcct ggccttgttg ttggtcag 28

<210> 18

<211> 30

<212> DNA

<213> artificial

<400> 18

gcggaattcg cgaagtcttg ttttggaatg 30

<210> 19

<211> 28

<212> DNA

<213> artificial

<400> 19

gcgggtaccc tgaaaatggc ggtgaagc 28

<210> 20

<211> 32

<212> DNA

<213> artificial

<400> 20

gcggtcgact tgcccaaatc gtaaatagaa ta 32

<210> 21

<211> 56

<212> DNA

<213> artificial

<400> 21

cattccaaaa caagacttcg cgaattcccg cggtaccctg aaaatggcgg tgaagc 56

<210> 22

<211> 28

<212> DNA

<213> artificial

<400> 22

gcggaattcc agctgaagct tcgtacgc 28

<210> 23

<211> 31

<212> DNA

<213> artificial

<400> 23

gcgggtaccg cataggccac tagtggatct g 31

<210> 24

<211> 19

<212> DNA

<213> artificial

<400> 24

tggccttgtt gttggtcag 19

<210> 25

<211> 23

<212> DNA

<213> artificial

<400> 25

ttgcccaaat cgtaaataga ata 23

<210> 26

<211> 14

<212> DNA

<213> artificial

<400> 26

aaggggcgga ggcg 14

<210> 27

<211> 19

<212> DNA

<213> artificial

<400> 27

gtctgtgagg ggagcgttt 19

<210> 28

<211> 20

<212> DNA

<213> artificial

<400> 28

cgtatgtgaa tgctggtcgc 20

<210> 29

<211> 19

<212> DNA

<213> artificial

<400> 29

cctgggtgaa ggaagggat 19

Claims (4)

1. The application of the saccharomyces cerevisiae strain with high organic acid tolerance in industrial production is characterized in that the saccharomyces cerevisiae strain is constructed by the following construction steps:

On the basis of knocking out one allele PEP4 encoding PrA of the initial Saccharomyces cerevisiae, carrying out sequence modification on a specific part of the other allele PEP4 encoding PrA; the nucleotide sequence of the knock-out allele PEP4 is shown as SEQ ID NO: 1 is shown in the specification; the nucleotide sequence of the modified allele PEP 4' is shown as SEQ ID NO: 2, respectively.

2. The use of a high organic acid tolerance Saccharomyces cerevisiae strain in industrial production according to claim 1, wherein the starting Saccharomyces cerevisiae is yellow wine yeast.

3. The application of the saccharomyces cerevisiae strain with high organic acid tolerance in industrial production according to claim 1, wherein the saccharomyces cerevisiae strain is constructed by the following construction steps:

(1) PrA coding sequence is amplified by PCR with Saccharomyces cerevisiae genome DNA as templatePEP4A specific upstream segment DNA fragment 'U-PO' and a downstream segment DNA fragment 'D-PO' are connected to obtain a DNA fragment 'PO';

(2) connecting the DNA fragment 'PO' to a vector pMD19, inserting the DNA fragment 'Kan' between the upstream and downstream of the 'PO' sequence, replacing part of the original PrA coding ORF sequence to obtain a recombinant plasmid, using the recombinant plasmid as a template, obtaining a recombinant DNA fragment by PCR amplification, converting the recombinant DNA fragment into a strain with a protease A coding sequence allele knockout function, and obtaining the strain with a PrA allele PEP4Knockout and another PrA allele coding sequence are engineeredPEP4’The recombinant strain of (4).

4. The application of the saccharomyces cerevisiae strain with high organic acid tolerance in industrial production according to claim 3, wherein the saccharomyces cerevisiae strain is constructed by the following construction steps:

(1) construction of recombinant plasmid

Firstly, the gene group DNA of the saccharomyces cerevisiae is taken as a template and is obtained by PCR amplificationPEP4The gene encodes the upstream segment "U-PO" of the ORF sequence; using Saccharomyces cerevisiae genome DNA as template, and obtaining the product by PCR amplificationPEP4The gene encodes the downstream segment "D-PO" of the ORF sequence; then connecting the DNA fragment 'U-PO' and the 'D-PO' to obtain a DNA fragment 'PO', and introducing 2 enzyme cutting sites into a connection product; cloning the DNA fragment 'PO' into a vector pMD19 to obtain a recombinant plasmid;

secondly, obtaining a DNA fragment Kan by PCR amplification by taking the plasmid pUG6 as a template, and directionally inserting the obtained DNA fragment into a cloning site introduced by the PO segment of the plasmid obtained in the step I to obtain a recombinant plasmid;

(2) sequence modification of a second allele of a PrA coding sequence

Taking the recombinant plasmid constructed in the step (1) as a template, and obtaining a recombinant DNA fragment 'REC-PO' used and substituted for the middle section of the ORF sequence of the PrA coding part by PCR amplification;

Secondly, an electric shock transformation method is used, the recombinant DNA fragment REC-PO is transformed to complete the strain with the first PrA coding sequence allele knockout, and a recombinant strain with one PrA allele knockout and the other PrA allele coding sequence modification is obtained.

Images