CN109609396A

CN109609396A - A kind of genetic engineering bacterium and its construction method and application

Info

Publication number: CN109609396A
Application number: CN201811640121.7A
Authority: CN
Inventors: 黄双成; 何汉平
Original assignee: Boton Shanghai Biotechnology Co ltd
Current assignee: Boton Shanghai Biotechnology Co ltd
Priority date: 2018-12-29
Filing date: 2018-12-29
Publication date: 2019-04-12
Anticipated expiration: 2038-12-29
Also published as: CN109609396B

Abstract

The invention belongs to genetic engineering field, genetic engineering bacterium and its construction method and the application of a kind of high yield 2 phenylethyl alcohol are disclosed.Genetic engineering bacterium of the present invention, the key gene being integrated in strain gene group in 2 phenylethyl alcohol metabolic pathway of synthesizing.Genetic engineering bacterium of the present invention can be used for being converted into 2 phenylethyl alcohol using L-phenylalanine, and 2 phenylethyl alcohol yield height has high commercialization value.Experiment shows that production 2 phenylethyl alcohol can reach 18g/L or more to genetic engineering bacterium CFFSH006 of the present invention under separation and fermentation technique in situ, and higher production intensity is also able to maintain in the case where the usage amount of polypropylene glycol is greatly decreased, effectively accumulation 2 phenylethyl alcohol, improve the yield of 2 phenylethyl alcohol, with extraordinary industrial application prospect, the use cost of original position separation material in 2 phenylethyl alcohol production process can be greatly decreased.

Description

A kind of genetic engineering bacterium and its construction method and application

Technical field

The invention belongs to genetic engineering fields, and in particular to a kind of genetic engineering bacterium and its construction method and application, especially It is to be related to genetic engineering bacterium and its construction method and the application of a kind of high yield 2 phenylethyl alcohol.

Background technique

2 phenylethyl alcohol (2-Phenylethanol, also known as benzyl carbinol) is a kind of aromatic chemistry object with rose fragrance, 2 phenylethyl alcohol is primarily present in the essential oil of gymnosperm and angiosperm and its extraction in nature, which has It is widely applied market.In field of perfumery, 2 phenylethyl alcohol is answered in the production of edible essence extensively frequently as main note or bottom note With.The stability of 2 phenylethyl alcohol under alkaline condition makes it have important application value in washing paint and cosmetic industry. In addition, 2 phenylethyl alcohol is also important medicine intermediate, and important industrial chemicals styrene can be produced by dehydration.2- benzene The source of ethyl alcohol includes or being present in natural plant essential oils (in such as rose ethereal oil using benzene or styrene as raw material chemical synthesis Benzyl carbinol content be close to 60%) and the biosynthesis in the way of biofermentation.Wherein biology is taken using natural material The 2 phenylethyl alcohol product that fermentation method or enzymatic mode produce meets European Union (EUDirective 88/388/CEE) and the U.S. FDA (CFR-21CFR101.22) has good market prospects and high economic value to the legal definition of natural perfume material.

Saccharomyces cerevisiae (Saccharomyces cerevisiae) is just applied to food fermentation for a long time, is U.S.'s food GRAS (the Generally Recognized As Safe) table of product drug surveilance office FDA arranges one of safe bacterial strain, is a kind of state The generally acknowledged safe microorganisms in border.Saccharomyces cerevisiae is one of presently found higher microorganism of 2 phenylethyl alcohol synthesis capability.With it His microbial ratio, saccharomyces cerevisiae has higher tolerance to many Stress Factors, to industrialized environment adaptation with higher Property, and have mature zymotechnique control strategy, therefore be the ideal strain of Production by Microorganism Fermentation 2 phenylethyl alcohol.Though Right saccharomyces cerevisiae is not high to the tolerance of benzyl carbinol, and yield is not also high, but genetic background is clear, therefore it is excellent to construct production performance Different, the engineering bacteria of fermentation stability is the key that improve yield.

Patent CN107177520A and patent CN107164250A discloses the saccharomyces cerevisiae CCTCC of one plant of production 2 phenylethyl alcohol 2016785 bacterial strain of NO:M, can produce 200-450mg/L 2 phenylethyl alcohol, can be used for yellow rice wine, cooking wine, fruit wine, soy sauce, vinegar Fermentation utilizes the fragrant flavor for producing 2 phenylethyl alcohol characteristic and increasing wine, vinegar, fruit wine of bacterial strain.Saccharomyces cerevisiae can utilize central metabolic From the beginning approach can directly be closed via shikimic acid pathway and Emhorn approach (Ehrlich pathway) by the simple substrate such as glucose At 2 phenylethyl alcohol, this is the original that saccharomyces cerevisiae and other yeast strain ferments of part generate a small amount of natural 2-benzyl carbinol in the process Cause.Currently, the yield that bacterial strain produces 2 phenylethyl alcohol, such as Kim base can be increased by the Yeast engineering bacterium strain of metabolic engineering Because engineered kluyveromyces marxianus can use 10g/L glucose production 1.3g/L 2 phenylethyl alcohol (Enzyme& Microbial Technology,2014,61-62:44,doi:10.1016/j.enzmictec.2014.04.011).It is another The mode of kind more convenient efficiently production 2 phenylethyl alcohol is with the intermediate product L-phenylalanine of Emhorn approach directly as substrate, Directly conversion production benzyl carbinol.Eshkol disclose it is a kind of using Wine brewing yeast strain using phenylalanine as substrate, produce 2- benzene Ethyl alcohol technical solution (Journal of Applied Microbiology, 2009,106 (2): 534-542, doi: 10.1111/j.1365-2672.2008.04023.x).In scheme disclosed in Eshkol, have detected from Israel's character used in proper names and in rendering some foreign names Separated tens of plants of Wild Saccharomyces cerevisiae strains and laboratory standard haploid strains Saccharomyces in Mishan national park The yield of the benzyl carbinol of cerevisiae Y103 and Saccharomyces cerevisiae S288C, wherein wild yeasts Ye9-612 is yield highest, and in the case where shaking flask is horizontal, its 2 phenylethyl alcohol yield is reachable under fed batch fermentation up to 0.85g/L 4.5g/L。

Utilize the key enzyme and positive regulating gene in technique for gene engineering enhancing benzyl carbinol metabolic pathway of synthesizing, or truncation Weaken competition metabolic pathway and negative regulator gene, it is considered to be it is effective that acquisition has more excellent S. cervisiae industrial producing strain Strategy.As shown in Figure 1, in Emhorn approach, L-phenylalanine via turn amino, three decarboxylation, reduction steps formed it is corresponding 2 phenylethyl alcohol.Overexpression, which is related to key gene in the approach and positive regulating gene, may can effectively improve benzyl carbinol Yield.(Appl.environ.microbiol, 2008,74 (8): 2259-2266, doi:10.1128/ in Emhorn approach AEM.02625-07): the aromatic amino acid of aro8, aro9, Bat2, Bat1 coded by said gene is transaminase-catalyzed therein Turn deamination step；The encoded pyruvate decarboxylase of pdc1, pdc5, pdc6, aro10, THI3 or 2-ketoacid decarboxylase can be catalyzed Decarboxylation step therein；The encoded alcohol dehydrogenase of adh1, adh2, adh3, adh4, adh5, adh6 and aad3, aad4, The encoded fragrant alcohol dehydrogenase of aad6, aad10, aad14, aad15, aad16 and the encoded formaldehyde dehydrogenase of sfa1 can be with The reduction step being catalyzed in Emhorn approach.In the controlling gene of Emhorn approach: the transcription factor Aro80p of Aro80 gene coding Response is generated to aromatic amino acid, it can be with the expression of activated gene aro9 and aro10；The transcription factor of gene C AT8 coding is not Only it can also promote the growth of cell wall with the expression of controlling gene aro9 and aro10；Gene gap1 and agp1 coding Gap1p and Agp1p is the main permease transported aromatic amino acid and enter cell, and L-phenylalanine is transported to intracellular, ginseng With metabolic activity in cells (Journal of Biotechnology 242 (2017) 83-91, doi:10.1016/ j.jbiotec.2016.11.028).It is not difficult to find that affiliated controlling gene not only includes related to 2 phenylethyl alcohol synthesis path The regulatory factors such as the transcription factor that enzyme directly acts on, while also including turn including the amino acid permease for playing indirectly-acting Transport function element gene.Boer, which discloses more than 3000 controlling genes, may participate in the metabolic regulation of amino acid Emhorn approach, Wherein have confirmed that apparent 23 controlling genes can with the utilization in positive regulation Emhorn approach saccharomyces cerevisiae to amino acid, wherein Bacterial strain can be remarkably reinforced to utilization (the FEMS Yeast Res 7 (2007) of L-phenylalanine in Aro80 and MIP6 controlling gene 604-620, doi:10.1111/j.1567-1364.2007.00220.x).

Patent application CN103409332A discloses one kind using Saccharomyces cerevisiae S288C as starting strain, couples overexpression Aminotransferase gene aro8 and decarboxylase gene aro10 produces 2- benzene second to increase wine brewing engineered strain transforming phenyl alanine The ability of alcohol.

Kim disclose one kind using kluyveromyces marxianus BY25569 as starting strain, heterologous overexpression its from make The Pyruvate Decarboxylase Gene aro10 and alcohol dehydrogenase adh2 of brewer yeast are to enhance bacterial strain Emhorn approach, the 2- of starting strain Benzyl carbinol yield increase 5 times reach 1g/L (Enzyme and Microbial Technology 61-62 (2014) 44-47, doi:10.1016/j.enzmictec.2014.04.011).In technical solution disclosed in Kim, independent overexpression Aro10 gene, or individually overexpression adh2 will not to have the yield of benzyl carbinol it is any improve (page 45, right column the 8th Row).

State-run Seoul National University discloses a kind of common free overexpression tri- gene of aro9, aro10, aro80 raising wine brewing ferment Metabolic engineering scheme (the Biotechnology and of female W303-1B plants of transforming phenyl alanine production benzyl carbinol yield Bioengineering, Vol.111, No.1, January, 2014, doi:10.1002/bit.24993).In Seoul National University's public affairs In the technical solution opened, original strain 2 phenylethyl alcohol energy is improved when saccharomyces cerevisiae W303-1B is individually overexpressed Aro80 transcription factor Power is improved up to 58%, 48h yield from the 110.1mg/L of original strain to 173.8mg/L.Individually it is free be overexpressed aro9 gene or Person individually dissociate expression aro10 gene when can improve the 2 phenylethyl alcohol yield of bacterial strain on a small quantity, but be overexpressed simultaneously aro9 with The yield of bacterial strain is greatly improved to 350mg/L when aro10 is dual-gene, in addition when be overexpressed simultaneously aro9, aro10 and The 2 phenylethyl alcohol of bacterial strain can be further improved to 449.5mg/L when tri- gene of aro80.

Li disclose one kind in saccharomyces cerevisiae (S.cerevisiae) YPH499 be overexpressed Emhorn approach related gene with Increase benzyl carbinol yield (Journal of Bioscience&Bioengineering, 2016,122 (1): 34-39, doi: 10.1016/j.jbiosc.2015.12.022).Its in scheme disclosed in Li has screened 3 kinds of different 2- keto acid decarboxylases (including aro10 and Thi3 from saccharomyces cerevisiae, with the Kivd from Lactococcus lactis) and 6 kinds of alcohol dehydrogenase gene (packets Adh1, adh2, adh5, adh6, adh7 and sfa1 have been included to the enhancing situation of Emhorn approach.Technical solution disclosed in Li In, the yield of the 2 phenylethyl alcohol of the combinational expression bacterial strain of adh1 and aro10 is higher than other assortments of genes and single expression aro10 The 2 phenylethyl alcohol yield of engineered strain.

Although by existing known references, although it can be concluded that key enzyme and just in enhancing benzyl carbinol metabolic pathway of synthesizing Controlling gene may can get the conclusion of the superior strain of benzyl carbinol, however in the actual process, due to the complexity of biological metabolism Property, the result of gene expression can not often be predicted, while being also difficult to select in a manner of the assortment of genes from magnanimity suitable Bacterial strain optimal expression scheme required for it.The complexity of the biological metabolism includes but is not limited to following several points:

(1) suitability of bacterial strain and gene, i.e., its expression has when same gene is expressed in different bacterial strains It has differences, for example, Carreto discloses saccharomyces cerevisiae Lalvin EC-1118, Lalvin ICVD254, S228C, The gene expression dose different strains of its bacterial strain of 06L3FF02,06L6FF20, J940047, different stages of growth exist larger Otherness (BMC Genomics 2011,12:201, doi:10.1186/1471-2164-12-201), sfa1 gene exists Expression in Lalvin EC-1118 is higher, but in the stabilization of bacterial strain and decline phase Lalvin ICV D254 bacterial strain Expression will be more than EC-1118, and S228C bacterial strain and J940047 maintain lower sfa1 gene expression.It is adapted to based on bacterial strain complicated Property, even expresses some identical gene or identical several genes, can also cause because of bacterial strain difference gene expression dose or Expression ratio between several genes of person is different and generates, this will lead to existing technical staff and is difficult to know the base being adapted to bacterial strain Cause.

(2) various isodynamic enzyme and homology enzyme, there are a variety of compensatory mechanisms in intracellular metabolic step, this kind of mechanism is One of the reason of being metabolized complexity, such as restores to be formed in 2 phenylethyl alcohol metabolic process in phenylacetaldehyde, exist including adh1, It is more including adh2, adh3, adh4, adh5, adh6, aad3, aad4, aad6, aad10, aad14, aad15, aad16, sfa1 etc. A coded by said gene enzyme (isoenzymes) can be catalyzed the step.Even for identical enzyme, separate sources species or bacterium The homology enzyme of strain can have the difference in sequence and in structure, and then lead to the difference of its enzymatic activity and function.Meanwhile bacterium in addition Strain is there are Preference (such as codon preference) reason, and there are biggish differences in different strains for the different homology enzyme of sequence. Although complexity based on same enzyme and homology enzyme, those skilled in the art are easy to learn enhancing benzyl carbinol metabolic pathway of synthesizing In key enzyme and positive regulating gene may obtain the superior strain of benzyl carbinol, but which homology enzyme and same work selected actually Enzyme sequence be can really enhance benzyl carbinol yield key gene be still it is difficult and it is difficult to predict.

(3) complicated intergenic compatibility situation, i.e., since metabolic process is related to multiple reactions of multiple nodes, gene is deposited Assist and contact, the optimization of Yao Shixian metabolic function a large amount of, need are multiple be related to it is mutually coordinated between enzyme and controlling element, respectively The expression of gene is strong and weak appropriate, matches with whole metabolism network phase 5, both will not because some gene expression dose it is lower caused by be metabolized Access limitation, will not be excessive because of some gene expression, and aggravates thallus burden or activation inhibition regulation.Identical several bases Because can produce completely different result under different expression ratios (Expression ratio).For example, Latimer is in wine brewing ferment Xylose metabolism approach is constructed in mother, takes different expression starting sub-portfolios to 8 key enzymes involved in xylose metabolism Experience is expressed in various degree, the results showed that the utilization of xylose, there are huge between the bacterial strain of different gene expression ratios Phenotypic difference, while the difference is also influenced (Metab Eng.2014Sep by environmental factor (such as condition of culture)；25:20- 9.doi:10.1016/j.ymben.2014.06.002).Based on this reason, even if one of ordinary skill in the art know enhancing benzene Key enzyme and positive regulating gene in ethyl alcohol metabolic pathway of synthesizing may can get the superior strain of benzyl carbinol, can not also know Should be expressed with which kind of expression and expression ratio gene involved by which actually could make metabolism network optimal Change.

Summary of the invention

In view of this, the purpose of the present invention is to provide the genetic engineering bacteriums and its construction method of a kind of high yield 2 phenylethyl alcohol With application.

To achieve the purpose of the present invention, the present invention adopts the following technical scheme:

The present invention provides a kind of genetic engineering bacterium, it is integrated in strain gene group in 2 phenylethyl alcohol metabolic pathway of synthesizing Key gene.

In some embodiments, the engineering strain is saccharomyces cerevisiae.

Further, in some embodiments, the genetic engineering bacterium is saccharomyces cerevisiae BSH-H9.

Preferably, the key gene in the 2 phenylethyl alcohol metabolic pathway of synthesizing is aro8, aro9, aro10 and sfa1.

It in some embodiments, is saccharomyces cerevisiae CFFSH-006, gene the present invention provides a kind of genetic engineering bacterium Key gene aro8, aro9, aro10 and the sfa1 being integrated in 2 phenylethyl alcohol metabolic pathway of synthesizing in group, can high yield 2- benzene second Alcohol.Saccharomyces cerevisiae CFFSH-006 is deposited in China typical culture collection center, and deposit number is CCTCC NO:M 2018669。

The present invention provides the construction methods of the genetic engineering bacterium, construct in 2 phenylethyl alcohol metabolic pathway of synthesizing respectively Then the common random integration of expression cassette is constructed 2 phenylethyl alcohol in host strain multiple cloning sites by the expression cassette of multiple key genes It is metabolized the random integration expression library of key gene, bacterial strain each in library is tested and screened, obtains 2 phenylethyl alcohol yield High bacterial strain.

In some embodiments, δ-integrations method is integrated into described in the construction method.

In some embodiments, host strain described in the construction method is saccharomyces cerevisiae.Further, one In a little embodiments, the host strain is saccharomyces cerevisiae BSH-H9.

In some embodiments, the key gene in 2 phenylethyl alcohol metabolic pathway of synthesizing described in the construction method For at least one of aro8, aro9, aro10, sfa1.In some embodiments, in the 2 phenylethyl alcohol metabolic pathway of synthesizing Key gene be aro8, aro9, aro10 and sfa1.Wherein the aro8 gene order is described as shown in SEQ ID NO.2 Aro9 gene order is as shown in SEQ ID NO.3, and the gene order of aro10 is as shown in SEQ ID NO.4, and sfa1 gene order is such as Shown in SEQ ID NO.5.

The present invention also provides application of the genetic engineering bacterium in fermenting and producing 2 phenylethyl alcohol.Especially saccharomyces cerevisiae Application of the CFFSH-006 in fermenting and producing 2 phenylethyl alcohol.

Further, the present invention provides a kind of methods for producing 2 phenylethyl alcohol, utilize this using L-phenylalanine as substrate It invents the engineering bacteria fermentation or cell catalysis mode produces 2 phenylethyl alcohol.

In some embodiments, the present invention provides a kind of method for producing 2 phenylethyl alcohol, using L-phenylalanine as Substrate by saccharomyces cerevisiae CFFSH-006 of the present invention ferment or cell catalysis in the way of produce 2 phenylethyl alcohol.

The present invention also provides a kind of methods of screening 2 phenylethyl alcohol metabolism key gene, include the following steps:

(1) it in the expression cassette of free expression plasmid for key gene to be screened being cloned respectively and being connected to host, obtains It is loaded with the free expression plasmid of different key genes to be screened respectively；Wherein the key gene to be screened is 2 phenylethyl alcohol synthesis Enzyme coding gene, controlling gene or auxiliary gene in metabolic pathway.

(2) the free expression plasmid for being loaded with different key genes to be screened respectively is mixed, cotransformation host strain chooses sun Property transformant, obtain the recombinant bacterial strain library for being loaded with the free expression plasmid of combination of different key genes to be screened；

(3) transformant in the recombinant bacterial strain library of acquisition is subjected to fermentation test respectively, screens different conversion bacterial strains 2 phenylethyl alcohol production capacity selects the bacterial strain for wherein capableing of high yield benzyl carbinol, identifies contained in high yield benzyl carbinol recombinant bacterial strain Key gene to be screened and key gene to be screened combination.

Wherein, in some embodiments, wait sieve described in the method for the screening 2 phenylethyl alcohol metabolism key gene Selecting key gene is aro8, aro9, aro10, sfa1, aro80, CAT8, gap1 and agp1.

In some embodiments, step (1) specially will in the method for the screening 2 phenylethyl alcohol metabolism key gene The genetic fragment of a variety of to be screened key genes of the both ends respectively containing promoter and terminator and containing identical promoters and The free expression vector cotransformation host of the linearization for enzyme restriction of terminator.

In some embodiments, promoter described in the method for the screening 2 phenylethyl alcohol metabolism key gene is PGK1 strong promoter, the terminator are CYC1, and the free expression vector is plasmid pCS01.

Further, the present invention provides a kind of method for constructing high yield 2 phenylethyl alcohol engineered strain, the screening 2- is utilized Benzyl carbinol be metabolized key gene method screening confirmation 2 phenylethyl alcohol be metabolized key gene, then respectively building expression cassette jointly with Machine is integrated in the random integration expression library that host's multiple cloning sites obtain 2 phenylethyl alcohol metabolism key gene, to bacterium each in library Strain is tested and is screened, and the high bacterial strain of 2 phenylethyl alcohol yield is obtained.

As shown from the above technical solution, the present invention provides the genetic engineering bacterium of high yield 2 phenylethyl alcohol and its construction method with Using.Genetic engineering bacterium of the present invention, the key gene being integrated in strain gene group in 2 phenylethyl alcohol metabolic pathway of synthesizing. Genetic engineering bacterium of the present invention can be used for being converted into 2 phenylethyl alcohol using L-phenylalanine, and 2 phenylethyl alcohol yield height has pole Height commercialization value.Experiment shows that genetic engineering bacterium CFFSH006 of the present invention its 2 phenylethyl alcohol that ferments in the case where shaking flask is horizontal is dense It spends up to 3.5g/L or more, 2 phenylethyl alcohol is produced under separation and fermentation technique in situ can reach 18g/L or more, and be greatly decreased Also it is able to maintain higher production intensity in the case where the usage amount of polypropylene glycol, effectively accumulation 2 phenylethyl alcohol, improves 2 phenylethyl alcohol Yield, there is extraordinary industrial application prospect, separation material in situ can be greatly decreased in 2 phenylethyl alcohol production process Use cost.

Biological deposits explanation

Saccharomyces cerevisiae CFFSH006 (Saccharomyces cerevisiae CFFSH006), on October 15th, 2018 It is deposited in China typical culture collection center, address is China, and Wuhan, Wuhan University, deposit number is CCTCC NO:M 2018669。

Detailed description of the invention

In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below There is attached drawing needed in technical description to be briefly described.

Fig. 1 shows that L-phenylalanine is converted into benzyl carbinol process schematic experienced in Emhorn approach；

Fig. 2 shows the flow diagram of the method for 2 phenylethyl alcohol metabolism key gene in quickly screening yeast host bacterial strain；

Fig. 3 shows recombinant bacterium library PCR qualification result figure, and wherein M is Mark control, and 1 is Varo8, and 2 be Varo9, and 3 are Varo10,4 be Vsfa1, and 5 be Vgap1, and 6 be Vagp1, and 7 be Varo80, and 8 be Vcat8；

Fig. 4 shows highest its 2 phenylethyl alcohol yield of 48 plants of monoclonals of OD570 in primary dcreening operation；

Fig. 5 shows minimum 48 plants of monoclonals its 2 phenylethyl alcohol yield of primary dcreening operation time screening OD570；

Fig. 6 shows 48 plants of recombinant bacterium 2 phenylethyl alcohol yield of first round secondary screening；

Fig. 7 shows the second wheel secondary screening 2 phenylethyl alcohol yield result figure；Wherein colony2,4,10,17,18 are first round secondary screening The middle highest five plants of bacterial strains of yield, Host are starting strain BSH-H9；

Fig. 8 shows the free expression plasmid qualification result figure in 5 plants of recombinant bacterial strains, and wherein swimming lane marks: M Mark, C are pair According to bacterial strain BSH-H9,1 is recombinant bacterial strain colony2, and 2 be recombinant bacterial strain colony4, and 3 represent recombinant bacterial strain colony10,4 generations Table recombinant bacterial strain colony17,5 represent recombinant bacterial strain colony18；

Fig. 9 shows the gel electrophoresis proof diagram of Donor DNA fragmentation, and wherein swimming lane M is Mark, and 1 is PGK1p-aro8- CYC1t, 2 be PGK1p-aro9-CYC1t, and 3 be PGK1p-aro10-CYC1t, and 4 be PGK1p-sfa1-CYC1t；

Figure 10 shows that 2 recombinant bacterium library PCR of embodiment identifies gel electrophoresis result figure；

Figure 11 shows that the first round screens 2 phenylethyl alcohol yield result figure；

Figure 12 shows that the second wheel screens 2 phenylethyl alcohol yield result figure；

Figure 13 shows that third round screens each bacterial strain 2 phenylethyl alcohol yield result figure；

Figure 14 shows the dynamic change of each parameter in the fermentation process of embodiment 5；

Figure 15 shows the gel electrophoresis figure of BSH-H9 Yu CFFSH-006 Genomic PCR products, and wherein swimming lane M represents Mark, Aro8 represents the gene expression frame of aro8, and aro9 represents the gene expression frame containing aro9, and aro10 represents the base containing aro10 Because of expression cassette, sfa1 represents the gene expression frame containing sfa1；

Figure 16 shows embodiment 7 with the random integration that Saccharomyces Cerevisiae in S .cerevisiae CEN.PK 2-1C is that host constructs Recombinant bacterium library PCR identify gel electrophoresis result: carried out respectively using recombinant bacterium library total genomic dna as template to aro8, Aro9, aro10, sfa1 carry out PCR identification, the results showed that aro8, aro9 can be detected in the total genomic dna of recombinant bacterium library, Tetra- gene of aro10, sfa1；

Figure 17 shows the yield for each bacterial strain 2 phenylethyl alcohol that the first round screens in embodiment 7；

Figure 18 shows the 2 phenylethyl alcohol yield of each bacterial strain of the second wheel screening in embodiment 7.

Specific embodiment

The invention discloses a kind of genetic engineering bacteriums and the preparation method and application thereof.Those skilled in the art can use for reference this Literary content, is suitably modified realization of process parameters.In particular, it should be pointed out that all similar substitutions and modifications are to art technology It is it will be apparent that they are considered as being included in the present invention for personnel.Method and product of the invention has passed through preferably Embodiment is described, related personnel obviously can not depart from the content of present invention, in spirit and scope to side as described herein Method is modified or appropriate changes and combinations, carrys out implementation and application the technology of the present invention.

In some embodiments, the engineering strain is saccharomyces cerevisiae.

In the present patent application, the quasi- fruit wine saccharomyces cerevisiae BSH-H9 screened with one plant of company of inventor is bacterium germination Strain obtains by screening and wherein plays conspicuousness influence key gene, and taking the mode of proper building up, so that the bacterial strain is able to It is expressed on the genome for being integrated in saccharomyces cerevisiae BSH-H9 bacterial strain with the gene expression ratio of optimization, to be built into one plant The genetic engineering bacterium Accharomyces cerevisiae of high yield 2 phenylethyl alcohol.

In the present patent application, BSH-H9 bacterial strain is the brewer's yeast M15EMPIRE from Mangrove Jack company It is higher to have found that the kind yeast has after being relatively largely commercialized saccharomyces cerevisiae and food industry yeast by ALE YEAST 2 phenylethyl alcohol basal yield and tolerance, therefore renaming number is BSH-H9, as screening crucial base in the application The host strain of cause and the starting strain of transformation.The present invention provides a kind of quickly screening yeast host bacterial strain 2 phenylethyl alcohol generations The method for thanking to key gene.

The key gene of the metabolism of 2 phenylethyl alcohol described in the present patent application refers to those tables in yeast host bacterial strain body Can be significantly improved after reaching the enzyme of thallus 2 phenylethyl alcohol yield encoding gene or controlling gene or other auxiliary genes (such as across Film transporter gene etc.).

The present invention also provides a kind of methods for constructing high yield 2 phenylethyl alcohol engineered strain.

Due to the complexity of biological metabolism, the process that yeast strain produces 2 phenylethyl alcohol needs multiple genes and controlling gene Common participation, therefore which 5 between the mating situation of gene and thallus, gene and gene with situation and selecting actually A gene is to need to solve the problems, such as when obtaining high yield 2 phenylethyl alcohol bacterial strain with which kind of gene expression ratio expression.Therefore it needs Screen the key gene and key controlling gene on the 2 phenylethyl alcohol synthesis path being adapted to bacterial strain.Since 2 phenylethyl alcohol synthesizes road Related gene and controlling gene substantial amounts huge number on diameter, and Strain phenotypes are also by the expression water of each gene Flat and expression ratio influences, and the expression library taken genescreen one by one and construct different genes combination carries out screening technique needs It takes a substantial amount of time and Innovation Input.

Therefore a kind of method that the present invention takes quickly screening yeast host bacterial strain 2 phenylethyl alcohol metabolism key gene, with true Recognize the key gene that 2 phenylethyl alcohol yield is most adapted to and influenced with the wild strain.The quick screening yeast host bacterial strain 2- The method that benzyl carbinol is metabolized key gene is by enzyme coding gene or controlling gene in multiple 2 phenylethyl alcohol metabolic pathways or auxiliary It helps gene in the intracorporal free expression of host, to constitute random free expression strain library at random, screens 2- benzene in library later The bacterial strain that ethanol production greatly improves, then PCR identifies that these yield greatly improve and is loaded on the expression plasmid that dissociates in bacterial strain Gene groups, the free expressing gene detected in the superior strain that yield greatly improves and the assortment of genes are 2 phenylethyl alcohol It is metabolized key gene.Specifically comprise the following steps: key gene on (1) clone 2 phenylethyl alcohol synthesis path (including but not It is limited to aro8, aro9, aro10, sfa1 etc.) and regulation auxiliary gene (including but not limited to aro80, CAT8, gap1 and agp1) As by sieve gene, then gene to be screened is cloned to respectively and is connected to the expression cassette of the free expression plasmid of yeast host It is interior, it is built into a series of free expression plasmids for being loaded with some different gene to be sieved respectively；(2) it will be loaded with constructed by (1) step The free expression plasmid of difference gene to be sieved is mixed, obtain one contain be loaded with different gene plasmids to be sieved plasmid it is mixed It closes；(3) by the free expression plasmid mixed liquor cotransformation S. cervisiae of gene to be sieved, positive transformants therein are therefrom chosen Son, so that construct potential may dissociate the recombinant bacterial strain library of expression containing the difference assortment of genes to be sieved；(4) cotransformation is obtained Recombinant bacterial strain library in transformant fermented respectively test, the 2 phenylethyl alcohol that test screen difference converts bacterial strain produces Ability selects the bacterial strain for wherein capableing of high yield benzyl carbinol；(5) gene to be sieved contained in high yield benzyl carbinol recombinant bacterial strain is identified And the assortment of genes to be sieved, so that being clearly somebody's turn to do gene to be sieved or being somebody's turn to do the assortment of genes to be sieved is that can increase the wild-type strain with conspicuousness The key gene of benzyl carbinol yield.

In (1)-(3) step of the method for the quick screening yeast host bacterial strain 2 phenylethyl alcohol metabolism key gene Substitution being assembled using one-step method gene intracellular, (its method can refer to document Bioengineered 5:4,254-263；DOI: 10.4161/bioe.29167), i.e., it, will in gene expression frame both ends to be expressed design and the matched homology arm of free expression plasmid The genetic fragment to be sieved that homology arm is contained at the free expression vector of linearization for enzyme restriction and both ends is transformed into host strain simultaneously, in bacterium The assembling of expressing gene frame is completed in strain using the homologous recombination of yeast itself into the cell.The digestion line of the free expression vector Contain Yeast promoter and end respectively between plasmid promoter and terminator, can satisfy the both ends in property site Only the genetic fragment of sub enzyme coding gene or controlling gene or auxiliary gene contains identical promoters and terminator with described The free expression vector of linearization for enzyme restriction occur that complete annular free expression plasmid can be formed when homologous recombination assembling.In order to It generates the difference rich in assortment of genes to be sieved and expresses the random recombinant bacterium library of ratio combine, need the trip that will be linearized Cotransformation (as shown in Figure 2) is carried out from the homology arm recombination segment of expression plasmid and multiple genes to be sieved.

In the method for quick screening yeast host bacterial strain 2 phenylethyl alcohol metabolism key gene of the present invention, gene There are randomnesss with conversion process for assembling, therefore produce the conversion results and assortment of genes mode of substantial amounts, construct trip Recombinant bacterium library from expression.In the recombination library of the free expression, theoretically both exists and be only transferred to individually gene to be sieved Recombinant bacterial strain, while there is also the forms of multiple intergenic various combination cotransformations.Simultaneously as free expression vector The quantity being transferred to be entirely it is random, the free expression vector of certain gene to be sieved in be transferred to bacterial strain may be single copy It may be multiple copy numbers.It is each wait sieve since expression of each gene to be sieved in bacterial strain is influenced by copy number is transferred to Intergenic expression ratio be it is random, which reduce those by expression ratio it is bad and influence bacterial strain entirety 2 phenylethyl alcohol produce Amount, the probability that key gene can not be then identified.

It is described in the method for quick screening yeast host bacterial strain 2 phenylethyl alcohol metabolism key gene of the present invention Key gene and regulation auxiliary gene on 2 phenylethyl alcohol synthesis path, can both derive from the genome of yeast host itself Gene is also possible to foreign sources gene.

That is filtered out by described one kind method that quickly screening yeast host bacterial strain 2 phenylethyl alcohol is metabolized key gene It is adapted a bit with host strain, and after the key gene of benzyl carbinol yield can be dramatically increased, in next step by above-mentioned crucial base Because suitably to express on the genome that ratio is integrated in host strain, due to the complexity of metabolism network and regulatory mechanism without Method researcher in this field is difficult to make the more bases for capableing of optimum host strain production 2 phenylethyl alcohol by the prior art Because being overexpressed scheme.Therefore, the present invention provides a kind of method for constructing high yield 2 phenylethyl alcohol engineered strain comprising: (1) respectively The expression cassette of each quasi- expressing gene driven with strong promoter is constructed, the quasi- expressing gene is fast using described one kind Those key genes determined by the method for speed screening Saccharomyces cerevisiae host bacterial strain 2 phenylethyl alcohol metabolism key gene；(2) with place Delta (δ) sequence of main yeast is integration site, each key gene expression cassette component is mixed after merging, using δ-site Key gene random integration to yeast is obtained the recombinant bacterial strain library of integrant expression by integration method.(3) by integrant expression Each bacterial strain in recombinant bacterium library is tested and is screened, and the engineering recombinant bacterial strain for wherein having high yield is obtained.

In a kind of method of building high yield 2 phenylethyl alcohol engineered strain, in (1) step, select in host strain The gene expressed in strain is that quickly screening Saccharomyces cerevisiae host bacterial strain 2 phenylethyl alcohol is metabolized crucial base by described one kind Those of confirmation can increase the bacterial strain of host strain 2 phenylethyl alcohol yield after the method screening of cause, quickly be sieved by the kind The method screening for selecting Saccharomyces cerevisiae host bacterial strain 2 phenylethyl alcohol metabolism key gene, from the sea for being related to 2 phenylethyl alcohol metabolism and regulating and controlling It measures in gene, filters out gene compatible with host strain, reduce doing because of isodynamic enzyme, homology enzyme and regulation metabolism complexity Disturb increase.The another of the construction method be technically characterized in that when carrying out integrant expression using δ-integrations method, it is multiple to Expressing gene be to mix at random after, carry out random integration, this make combination between multiple genes obtained and Expression ratio between each gene is random.Therefore, exist in the recombinant bacterial strain library of integrant expression obtained more A abundant combining form different to table assortment of genes mode and expression ratio.Wherein, theoretically certainly exist certain strain or A few plants of recombinant bacterial strains, the combination and its expression ratio of be integrated into genome are the 2- benzene second for the host strain The metabolism of alcohol be it is more suitable, the benzyl carbinol yield of host strain is greatly improved.The combination side of the gene When formula is referred on multiple gene mixing random integrations to host strain gene group, the issuable assortment of genes side of integrated results Formula, such as have A, B, C carry out random integration, possible assortment of genes mode packet in integrated results after tetra- gene mixing of D It including: only incorporating A gene, integrate A+B gene, incorporate A+C+D gene, tetra- kinds of genes of A+B+C+D are integrated in genome, with And other combinations of four kinds of genes.Theoretically, it is contained in the recombinant bacterial strain library all possible to be expressed The combination of gene.The expression ratio refers to the ratio between the expression of different genes, due to integration process be with Machine, the copy number of the integration of gene in the genome be also it is random, the expressions of different genes is because copy number is different It therefore is also random.The δ-integrations method refers to gene integration and Yeast genome δ-site genetic manipulation side Method, including take by homology arm recombination form by expressing gene random integration in yeast δ-site in a manner of (Nucleic Acids Res.2009Feb；37 (2) .doi:10.1093/nar/gkn991), can also take disclosed in Shuobo with CRISPR-Cas9 mediate by gene integration in mode (the S.Shi et.al.Metabolic of yeast chromosomal group Engineering 33 (2016) 19-27, doi:10.1016/j.ymben.2015.10.011) and fields technology people Other are by gene integration and saccharomyces cerevisiae δ-site genetic manipulation method known to member.

In a kind of method of building high yield 2 phenylethyl alcohol engineered strain, it can also be integrated other than δ-site In other multiple cloning sites of host yeast genome.

The present invention also constructs the engineered strain saccharomyces cerevisiae for the 2 phenylethyl alcohol that one plant can be applied to industrialized production CFFSH006(Saccharomyces cerevisiae CFFSH006).The saccharomyces cerevisiae CFFSH006 is with company's self-sizing The fruit wine of acquisition is the host strain of gene expression with saccharomyces cerevisiae BSH-H9, takes a kind of quickly sieve described herein later The method screening for selecting Saccharomyces cerevisiae host bacterial strain 2 phenylethyl alcohol metabolism key gene, selects key enzyme in 2 phenylethyl alcohol route of synthesis And controlling gene (including aro8, aro9, aro10, sfa1, aro80, CAT8, gap1 and agp1) is carried out as gene to be screened Screening, is integrated using expression vector pCS01 free expression vector and carries out cotransformation after sieving gene expression frame, to be dissociated The recombinant bacterium library of expression.The highest 5 plants of bacterial strains of 2 phenylethyl alcohol yield in the recombinant bacterial strain library of free expression, reflect by PCR It is fixed, wherein containing tetra- kinds of genes of aro8, aro9, aro10, sfa1, thereby confirm that, wait sieve aro8, aro9 in gene, aro10, Sfa1 is the key gene for being adapted with strain Saccharomyces cerevisiae BSH-H9, and capable of significantly improving its yield, and aro80, CAT8, The influence of gap1, agp1 gene pairs saccharomyces cerevisiae BSH-H9 is not significant.

The application using the described building high yield 2 phenylethyl alcohol engineered strain method, by above-mentioned aro8, aro9, aro10, Sfa1, the δ-integrations method mediated using CRISPR-Cas9 is by aro8, aro9, aro10, sfa1 gene random integration in wine It on the genome of brewer yeast BSH-H9, is screened by the recombinant bacterium library to integrant expression, from totally 1037 plants of recons Wherein yield highest is filtered out, one plant of the most stable recombinant strain of phenotype is named as saccharomyces cerevisiae CFFSH006.

The present invention also provides a kind of methods for producing 2 phenylethyl alcohol.Utilize saccharomyces cerevisiae constructed by the present invention CFFSH006 can be used for being converted into 2 phenylethyl alcohol using L-phenylalanine, have high commercialization value.In the method In, with saccharomyces cerevisiae CFFSH006 bacterial strain be production bacterial strain, be inoculated in containing can support saccharomyces cerevisiae growth culture medium in, together When in the medium single be added or in batches be added L-phenylalanine as substrate, utilize the L- phenylpropyl alcohol ammonia of CFFSH006 bacterial strain The L-phenylalanine in culture medium is converted 2 phenylethyl alcohol by sour conversion capability.Saccharomyces cerevisiae CFFSH006 starting strain is quotient Industry fruit wine saccharomyces cerevisiae strain, bacterial strain are cultivated in culture medium that can be common in yeast brewing industry without special nutritional requirement, can also It is often cultivated in culture medium such as yeast extract glucose (YPD) culture medium in Yeast Cultivation.

For a further understanding of the present invention, below in conjunction with the embodiment of the present invention, to the technical side in the embodiment of the present invention Case is clearly and completely described, it is clear that and described embodiments are only a part of the embodiments of the present invention, rather than all Embodiment.Based on the embodiments of the present invention, those of ordinary skill in the art institute without making creative work The every other embodiment obtained, shall fall within the protection scope of the present invention.

Unless otherwise specified, reagent involved in the embodiment of the present invention is commercial product, can pass through business canal Road purchase obtains.

Embodiment 1, quickly screening yeast host bacterial strain 2 phenylethyl alcohol is metabolized key gene

(1) Escherichia coli-Saccharomyces cerevisiae shuttle free expression vector pSC01 is constructed

With Escherichia coli replicon oriE, 2 μ ori of saccharomyces cerevisiae replicon, Kan resistant gene, saccharomyces cerevisiae promoter PGK1p and terminator CYC1t is that primary element constructs Escherichia coli-Saccharomyces cerevisiae shuttle vector pSC01, in saccharomyces cerevisiae In dissociate expression target gene, constructed pSC01 gene order is as shown in gene order SEQ ID NO.1.

(2) key enzyme and controlling gene clone

Design is with the homology arm primer such as table 1 recombinated with promoter PGK1 in expression vector pCS01 and terminator CYC1 It is shown.The genome for extracting saccharomyces cerevisiae BSH-H9 is template, key enzyme and regulation base in PCR amplification 2 phenylethyl alcohol route of synthesis Because (including aro8, aro9, aro10, sfa1, aro80, CAT8, gap1 and agp1) is used as gene to be screened.PCR is public using NEB DepartmentHigh-Fidelity PCR Master Mix with HF Buffer kit, according to specification institute It states PCR reaction system and carries out PCR, used PCR reaction condition are as follows: first in 98 DEG C of initial denaturation 30s；Later using 98 DEG C of guarantors Hold 10s, 50 DEG C of holding 30s, 72 DEG C of holdings, 1 point of 30 seconds three sections of temperature cycling program, cycle-index 3 times；98 DEG C are taken later It is kept for 10 seconds, 55 DEG C of holding 30s, 72 DEG C of holdings, 1 point of 30 seconds three sections of temperature cycling program, cycle-index is 29 times；Then it protects Hold 72 DEG C of 5min；Finally it is cooled to 4 DEG C of end PCR reactions.Promoter PGK1 and termination are contained into the both ends obtained PCR respectively 8 kinds of genetic fragments to be screened of the homology arm of sub- CYC1 recombination, save backup after identification sequencing is errorless.

Primer used in the key enzyme of 1 host of table itself and the clone of controlling gene

(3) recombinant bacterial strain library is constructed

By described saving backup include promoter PGK1 and terminator CYC recombination homology arm aro8, aro9, Linearisation after aro10, sfa1, aro80, CAT8, gap1, agp1 genetic fragment and utilization BamHI digestion with restriction enzyme PCS01 plasmid cotransformation saccharomyces cerevisiae BSH-H9 bacterial strain together, carry out DNA in the cell and quickly assemble, construct recombinant bacterial strain Library (its process refers to Fig. 2).

Its building process is as follows: (1) being inoculated with saccharomyces cerevisiae BSH-H9 single bacterium and fall within YPD fluid nutrient medium, 30 DEG C, 200rpm Cultivating to OD600 is 3~3.5 or so；(2) at 4 DEG C, 4000rpm is centrifuged 5min and collects thallus, and the nothing that 16mL is pre-chilled in advance is added Cell is resuspended in bacterium water, sequentially adds 2mL 10 × TE buffer, mixes, 2mL 1M lithium acetate, mixes；It (3) will be after mixing Cell is resuspended in 30 DEG C, concussion is incubated for 45min under the conditions of 85rpm；(4) 500 μ L 1M DTT are added, mix, 30 DEG C, 85rpm is incubated Educate 15min；(5) plus water complements to final volume 50mL, then at 4 DEG C, 4000rpm low-temperature centrifugation 5min, abandons supernatant, adds The sterile water of 50mL pre-cooling is resuspended；(6) with 4 DEG C, it is sterile that 30mL pre-cooling is added in low-temperature centrifugation 5min, abandoning supernatant to 4000rpm again The rinsing of 1M sorbierite it is primary；(7) again with 4 DEG C, 4000rpm low-temperature centrifugation 5min, supernatant is abandoned, sterile 1M is pre-chilled in addition in right amount Sorbierite is resuspended, and obtains BSH-H9 competent cell；(8) 40 μ LBSH-H9 competent cells are taken, 5 μ L DNA mixtures are added (the pCS01 Plasmid DNA segment after the interior digestion linearisation containing BamHI, aro8, aro9, aro10, sfa1 containing homology arm, 8 kinds of genetic fragments of aro80, CAT8, gap1, agp1), the electrotransformation in 2mm electricity revolving cup (electricity turns voltage 1.5kv)；It (9) will be electric Cell after turning is added 1mL 1M sorbierite and is resuspended, and then dilution spread is in the YPD for containing G418 Geneticin (300 μ g/mL) Agar plate, culture is to single colonie is formed in 30 DEG C of incubators, for further separating the monoclonal colonies in recombinant bacterial strain library It is screened for key gene.Meanwhile part re-suspension liquid is taken, directly it is inoculated in the liquid containing 300 μ g/mL G418 Geneticins Culture medium culture 72h, acquisition contains the mixed culture of whole recombinant bacterium library strains, with the mirror for recombinant bacterium library It is fixed.

(4) identification in recombinant bacterial strain library

The mixed culture in the recombinant bacterium library after taking culture 72h, extracts culture total DNA.Based on carrier pCS01's PGK1p promoter sequence designs the upstream primer CPGK1p-F (sequence is as described in Table 2) of PCR identification, respectively according to each gene Sequence design PCR downstream primer Caro8-R, Caro9-R, Caro10-R, Caro80-R, Csfa1-R, Cgap1-R, Cagp1-R, Ccat8-R, sequence are as shown in table 2.

Using the total DNA of extracted mixed culture as template, with common upstream primer CPGK1p-F and respective gene pairs The downstream primer answered carries out PCR amplification to the quasi- expressing gene of difference respectively as primer pair.PCR uses Shanghai JaRa biology work Journey Co., Ltd instant high-fidelity PCR amplification kit is carried out according to universal method described in its specification, and amplification is with core Acid gel electroresis appraisal.The gel electrophoresis of the amplified production of different primers is as shown in Figure 3.The result shows that expanding starting obtained Sub- PGK1p and quasi- expressing gene series connection clip size are consistent with expected results, should be the result shows that the quasi- gene and pCS01 line expressed Property carrier is assembled into complete plasmid intracellular.The result illustrates all 8 kinds of quasi- tables in constructed recombinant bacterium library simultaneously The assembling intracellular with pCS01 free expression vector is completed up to gene expression frame.Theoretically, the bacterial strain in the recombinant bacterium library It is intracellular that there may be any combination of the free expression plasmid of this 8 kinds of quasi- expressing genes.

Identify primer in 2 recombinant bacterial strain library of table

Primer	Explanation	5'-sequence-3'
			CPGK1p-F	Upstream primer	caacagcctgttctcacaca
Caro8-R	Aro8 downstream primer	CAGCACTGAACCCGTATTGC
			Caro9-R	Aro9 downstream primer	ACTCTCTGTCGAAGGTCAGG
Caro10-R	Aro10 downstream primer	GTACGTCTCCAAGGATCGCA
			Caro80-R	Aro8 downstream primer	ACCTAGTACTAGCCTCTGCC
Csfa1-R	Sfa1 downstream primer	GACGGTTCTTAAGCAATCAC
			Cgap1-R	Gap1 downstream primer	ATCTGGATTATTCTTCTCGTACG
Cagp1-R	Agp1 downstream primer	ACGCACGGCAGAAGTGTTAT
			Ccat8-R	Cat8 downstream primer	TTCTCCAGTTATCCAGTGCG

Using the total DNA in recombinant bacterium library as template, with common upstream primer CPGK1p-F and respective gene it is corresponding under Trip primer is expanded as primer pair, the gel electrophoresis result of pcr amplification product such as Fig. 3.

Promoter PGK1p and the theoretical length of quasi- expressing gene tandem gene segment are shown in Table 3, wherein segment name is with V+ Gene Name indicates.

The theoretical length of table 3 promoter PGK1p and quasi- expressing gene tandem gene segment

No.	Fragments	Size(bp)
			1	Varo8	570
2	Varo9	820
			3	Varo10	1030
4	Vsfa1	1380
			5	Vgap1	300
6	Vagp1	410
			7	Varo80	1240
8	Vcat8	2550

(5) Screening of strain with high productivity in recombinant bacterial strain library

From containing the monoclonal colonies for choosing recombinant bacterium library on G418 Geneticin YPD Agr plate, it is seeded to respectively Primary dcreening operation is carried out in 96 orifice plates.It is to cultivate carrier with 96 orifice plates, the culture medium of 200 μ L of every hole addition, 30 DEG C, 150rpm shake culture 48h.Culture medium composition are as follows: the yeast extract of 10g/L, the glucose of 60g/L, the phenylalanine of 8g/L, the phosphoric acid of 0.5g/L Potassium dihydrogen, the magnesium sulfate of 0.5g/L.This primary dcreening operation chooses 4 × 96 altogether from plate and amounts to 384 monoclonal colonies, with 96 holes Its 2 phenylethyl alcohol yield is measured by sampling with HPLC in plate culture.Wherein most fast 48 plants of biomass growth rate are (with OD570 nephelometry Measurement), 2 phenylethyl alcohol yield is as shown in Figure 4；Wherein, biomass growth rate most slow 48 plants (with OD570 Nephelometric Determinations), Its 2 phenylethyl alcohol yield is as shown in Figure 5.The result shows that a small amount of producing strain is apparently higher than average level, while also there is part bacterial strain Because, there is the case where yield is substantially reduced in not being adapted to for recombinant expression gene.

Then, it chooses in 384 plants of monoclonals of primary dcreening operation, the highest 48 plants of progress first round secondary screening of yield.First round secondary screening side Method are as follows: by the highest monoclonal bacterial strain switching of selected 48 plants of yield in 24 orifice plates, 1mL culture medium is added, cultivates 16h, Culture medium prescription is consistent with condition of culture with primary dcreening operation.Its 2 phenylethyl alcohol content is detected through HPLC, testing result is as shown in Figure 6. The wherein highest 5 plants of recombinant bacterial strains of 2 phenylethyl alcohol yield (Fig. 6, hollow bar shaped column mark) is wherein selected, does further second Take turns secondary screening.

Second wheel secondary screening takes the 2 phenylethyl alcohol yield of shake flask fermentation mode test strain.It will be selected by first round secondary screening 5 plants of highest bacterial strains of yield are transferred into 250mL shaking flask shake culture, 50mL liquid amount, using 30 DEG C of synthetic media, 200rpm concussion fermentation is for 24 hours.Culture medium be the YNB yeast nitrogen of 6.7g/L, the glucose of 60g/L, 8g/L phenylalanine, The potassium dihydrogen phosphate of 0.5g/L, the magnesium sulfate of 0.5g/L, nature pH.First round secondary screening bacterial strain shake flask fermentation 48h result such as Fig. 7 institute Show, 5 plants of recombinant bacterial strain its 2 phenylethyl alcohol yield are above control (original BSH-H9).

(6) the free expression plasmid in 5 plants of recombinant bacterial strains is identified

According to the selection result, by the second wheel secondary screening confirmation yield significantly improve 5 plants of recombinant bacterial strains (colony2, Colony4, colony10, colony17, colony18) for 24 hours (30 are cultivated in the YPD culture medium containing 300 μ g/mL G418 DEG C), the free expression plasmid (ferment produced using green skies biotechnology research institute contained by 5 plants of recombinant bacterial strains is extracted respectively Female small amount plasmid extraction kit (Yeast Plasmid Mini Preparation Kit), according to its side described in the specification Method is implemented).Then the plasmid extracted respectively using 5 plants of bacterial strains is template, with listed in step in the present embodiment (4) table 2 CPGK1p-F is upstream primer, respectively using each gene listed by table 2 identify primer as downstream primer (Caro8-R, Caro9-R, Caro10-R, Caro80-R, Csfa1-R, Cgap1-R, Cagp1-R, Ccat8-R), amplification identification is carried out using PCR method.PCR The gel electrophoresis result of product is as shown in Figure 8.

Fig. 8 result electrophoresis result shows: in recombinant bacterial strain colony2, colony4, colony17 and colony18 Detection is containing the free expression plasmid for being loaded with aro8；It is detected in bacterial strain colony2, colony4, colony17 and colony18 It is loaded with the free expression plasmid of aro9；The free expression plasmid for having aro10 is detected in bacterial strain colony17 and colony18； The free expression plasmid containing sfa1 is detected in bacterial strain colony10 and bacterial strain colony18；Simultaneously bacterial strain colony2, Colony4, colony10, colony17 and colony18 totally 5 plant heights produce recombinant bacterial strain do not detect containing gap1, The free expression plasmid of agp1, aro80, cat8 gene.Any free expression plasmid is not detected in control strain BSH-H9.The knot Fruit show second wheel secondary screening confirmation five plants of highest recombinant bacterial strains of yield in can detecte aro8, aro9, aro10, Sfa1 and the concatenated segment of PGK1 promoter, and and that gap1, agp1, aro80, cat8 and PGK1 promoter is not detected is concatenated Segment.Accordingly, it is shown that the reasonable combination of aro8, aro9, aro10, sfa1 gene and above-mentioned four kinds of genes is in maximum probability Be improve host's wild type Saccharomyces cerevisiae BSH-H9 2 phenylethyl alcohol yield key gene, and in contrast gap1, agp1, The combination of aro80, cat8 gene and its gene is not significant to the 2 phenylethyl alcohol output increased of bacterial strain BSH-H9 bacterial strain.Therefore, It is screened by random conversion and expression with 3 wheels, that can be found from multiple alternative genes and really mutually be fitted with host bacterial Match, and is capable of the key gene of conspicuousness influence 2 phenylethyl alcohol yield promotion.

Embodiment 2, rapid build high yield 2 phenylethyl alcohol engineered strain

Experimental result based on embodiment 1 can confirm that aro8, aro9, aro10, sfa1 and combinations thereof are to improve BSH-H9 bacterium The key gene of strain 2 phenylethyl alcohol yield produces bacterial strain to construct the 2 phenylethyl alcohol of stable hereditary property, needs to close above-mentioned 4 kinds Key gene is integrated in the genome of BSH-H9 bacterial strain with its most suitable combination and expression ratio.The present embodiment uses The delta integrations scheme that Crispr/Cas9 is mediated, used Crispr/Cas9 tool plasmid are pCAS.Utilize pCAS The workflow that plasmid carries out genome conformity has been recorded in open source literature Expresses S.pyogenes Cas9 in detail (eLife.2014 in plus an HDV ribozyme-sgRNA for genome editing in yeast；3:e03703, Doi:10.7554/eLife.03703 specific embodiment), in the present embodiment is as follows:

(1) site delta sgRNA segment is inserted into pCAS plasmid

(Addgene, Plasmid number #60847, plasmid details are derived from pCAS plasmid for the carrier of sgRNA It can be seen that http://www.addgene.org/).Using plasmid pCAS as template, it is with delta-gRNA-F and delta-gRNA-R Primer carries out annular extension PCR and clones (Circular polymerase extension cloning, Method And Principle process It is recorded in PLoS One.2009 in detail；4(7):e6441；Doi:10.1371/journal.pone.0006441).PCR is used NEB companyHigh-Fidelity PCR Kit, PCR reaction condition are as follows: 98 DEG C of holding 1min；Subsequently into Three Duan Xunhuan (98 DEG C of holding 30s → 58 DEG C keep 1min → 72 DEG C to keep 10min, recycle 30 times altogether)；Then 72 DEG C of holdings 10min；Finally cooling is 4 DEG C, and reaction was completed.The gene order of the primer delta-gRNA-F and delta-gRNA-R are such as Shown in lower, the specific sgRNA sequence containing the fracture of the site Yeast genome delta: 5 '-GGAACTGTCATCGAAGTTAG -3。

Delta-gRNA-F:CGGGTGGCGAATGGGACTTTGGAACTGTCATCGAAGTTAGGTT TTAGAGCTAGAA ATAGC,

Delta-gRNA-R:GCTATTTCTAGCTCTAAAACCTAACTTCGATGACAGTTCCAAA GTCCCATTCGCC ACCCG。

The utilization restriction enzyme DpnI digestion 6h of PCR product, digestion products transformed competence colibacillus bacillus coli DH 5 alpha, and It is coated on the kanamycins LB plate separation monoclonal containing 50 μ g/mL.5 monoclonal sequencings of picking, sequence verification is correct, will Constructed plasmid saves, and plasmid obtained is newly named as pCd5.

(2) amplification needs the gene expression frame being overexpressed

Experiment screening according to embodiment 1 is as a result, aro8, aro9, aro10, sfa1 and its assortment of genes are BSH-H9 bacterium Strain improves the key gene of 2 phenylethyl alcohol yield.Utilize " step (2) key enzyme and controlling gene in the present patent application embodiment 1 The both ends that clone " is cloned in step be respectively provided with 4 kinds of promoter PGK1 and CYC1 terminator to genetic fragment (aro8, Aro9, aro10, sfa1) respectively as pcr template, design the primer pair containing saccharomyces cerevisiae genome delta sequence homology arm DeltaHR-F and deltaHR-R carries out PCR amplification.PCR utilizes NEB companyHigh-Fidelity PCR Kit carries out PCR reaction condition are as follows: 98 DEG C of holding 1min；Subsequently into three Duan Xunhuan, (98 DEG C of holding 30s → 58 DEG C keep 1min → 72 DEG C of holding 10min are recycled 30 times altogether)；Then 72 DEG C of holding 10min；Finally cooling is 4 DEG C, and reaction was completed.Described draws Object deltaHR-F and deltaHR-R difference are as follows:

DeltaHR-F:ACTACCAATATATTATCATATACGGTGTTAGACGATGACATAAGAT ACGAactgtaat tgctttta gttgtg；

DeltaHR-R:TTATTCCTCATTCCGTTTTATATGTTTCATTATCCTATTACATTAT CAATaaattaaa gccttcga gcg。

By PCR amplification respectively, obtains and contain saccharomyces cerevisiae genome delta sequence homology arm and to be expressed simultaneously The genetic fragment of gene expression frame, is respectively designated as PGK1p-aro8-CYC1t, PGK1p-aro9-CYC1t, PGK1p-aro10- CYC1tPGK1p-sfa1-CYC1t.Using gel electrophoresis to PGK1p-aro8-CYC1t, PGK1p-aro9-CYC1t, PGK1p- The total 4 kinds of PCR products of aro10-CYC1t, PGK1p-sfa1-CYC1t carry out fragment length verifying.Gel electrophoresis result such as Fig. 9 It is shown, the length of the Donor DNA of design such as table 4.The clip size of acquisition is consistent with expected results.Utilize Shanghai JaRa biology The dedicated Ago-Gel DNA QIAquick Gel Extraction Kit GK2043-50 of Engineering Co., Ltd's scientific research, by glue recycling side described in its specification Method, gel extraction PCR product, and save for use, when next step integrant expression key gene aro8, aro9, aro10, sfa1 As Donor DNA.

The length for the Donor DNA that table 4 designs

No.	Fragments	Size(bp)
			1	PGK1p-aro8-CYClt	2639
2	PGK1p-aro9-CYC1t	2678
			3	PGK1p-sfa1-CYC1t	2297
4	PGK1p-aro10-CYC1t	3044

The random integration in the site delta of (3) 4 kinds of key genes

By 4 kinds of Donor DNA (i.e. PGK1p-aro8-CYC1t, PGK1p-aro9- constructed by the present embodiment (2) step CYC1t, PGK1p-aro10-CYC1 and PGK1p-sfa1-CYC1t) after mixing, together with pCd5 constructed by (1) step, lead to Cross electrotransformation mode cotransformation saccharomyces cerevisiae BSH-H9 bacterial strain.Electricity described in electrotransformation condition and 1 (3) step of embodiment Conversion process is identical as condition.Later, the bacterium solution after electrotransformation is divided into two parts: is coated on after a part dilution and is lost containing G418 It passes on the fixed plate of YPD Agr of chloramphenicol resistance (300 μ g/mL), to separate single conversion daughter colony.Another part culture bacterium Liquid is directly added into the YPD fluid nutrient medium of geneticin resistant containing G418 (300 μ g/mL), and shake culture 72h at 30 DEG C is used for Obtain the recombinant bacterium library for being mixed with all different transformants.

Using pastoris genomic dna extracts kit (Shanghai Jierui Biology Engineering Co., Ltd, GK1901), said according to it Genome DNA extracting method described in bright book extracts the total genomic dna for being mixed with all recombinant bacterium libraries of different transformants.It presses According to PCR identification method described in " identification of recombinant bacterial strain library described in 1 step of embodiment (4) ", using in table 2 CPGK1p-F is upstream primer, respectively using Caro8-R, Caro9-R, Caro10-R, Csfa1-R in table 2 as downstream primer, with Extracting and being mixed with the total genomic dna in all recombinant bacterium libraries of different transformants is pcr template, to strain library genome Identification.The gel electrophoresis result of the PCR product of the total genomic dna in recombinant bacterium library is as shown in Figure 10, the results showed that recombinant bacterium Tetra- kinds of genes of aro8, aro9, aro10, sfa1 can be detected in the total genomic dna in library, it means that aro8, aro9, The gene expression frame of tetra- kinds of genes of aro10, sfa1 has successfully been integrated into certain strain or a few plants of conversions in recombinant bacterium library On the genome of son.

(4) screening of integrant expression strain library

Separated integrant expression recombination on the fixed plate of the YPD Agr of picking G418 geneticin resistant (300 μ g/mL) The transformant single colonie in bacterium library.First round screening has chosen 1056 plants of transformant single colonies in total, is inoculated in 11 group 96 respectively It is cultivated in the hole of orifice plate, the fermentation of 300 μ L complex mediums is added in every hole, and (culture medium is the yeast extract of 10g/L, 60g/L Glucose, the phenylalanine of 8g/L, 0.5g/L potassium dihydrogen phosphate, the magnesium sulfate of 0.5g/L, pH 6.5), sent out in 30 DEG C of concussions Ferment 40h, sampling detect the content of wherein 2 phenylethyl alcohol with HPLC.1056 plants of strain benzyl carbinol yield results of first round screening are such as Shown in Figure 11, by the gene groups integrated on the genome of different transformants and number of copies be it is random, no The gene groups integrated with transformant, quantity, expression ratio have differences, so that it is with the level that is adapted to of host, there are larger Difference, having differences property of 2 phenylethyl alcohol actual production between 1056 plants of transformants.

The highest 95 plants of bacterium of picking 2 phenylethyl alcohol yield carry out the second wheel screening, sieve from the transformant that the first round screens Choosing method is identical as the first round, 2 phenylethyl alcohol yield result as shown in figure 12 (totally 96 plants, wherein number 1-95 bacterial strain be convert Son；It is control group BSH-H9 that number, which is the 96th plant, and rightmost side light bars column marks).The result shows that part bacterial strain 2 phenylethyl alcohol Yield is apparently higher than control group, however also has part recombinant bacterial strain 2 phenylethyl alcohol yield increased group low.Selection the second wheel screening Middle 10 plants of bacterial strains of 2 phenylethyl alcohol yield highest (Figure 12, light whippletree bar shaped column mark) carry out the screening of third round shaking flask.

Shaking flask training method is taken in third round screening, by bacterial strain switching in SC complete medium, shakes and trains in 250mL shaking flask Support (liquid amount 50mL, 30 DEG C, 200rpm, for 24 hours).The SC complete medium ingredient are as follows: the YNB yeast nitrogen of 6.7g/L, The glucose of 60g/L, the phenylalanine of 8g/L, the potassium dihydrogen phosphate of 0.5g/L, 0.5g/L magnesium sulfate.Fermentation results such as Figure 13 Shown, 10 plants of producing strains are above starting strain BSH-H9.Wherein, number is No. 978 (H9-978) bacterial strain benzyl carbinol yield For highest, saccharomyces cerevisiae CFFSH-006 bacterial strain is named as (in preservation on October 15 in 2018 and China typical culture collection The heart, CCTCC NO:M 2018669).

Embodiment 3 produces 2 phenylethyl alcohol using strain Saccharomyces cerevisiae CFFSH-006

Fermentation medium used by the present embodiment are as follows: sucrose 60g/L, yeast extract 35g/L, magnesium sulfate 0.5g/L, phosphorus Acid dihydride potassium 4g/L, L-phenylalanine 8g/L.Its fermentation process is to be inoculated in saccharomyces cerevisiae CFFSH-006 to ferment equipped with 50mL The 250mL shaking flask of culture medium shakes fermentation 72h (30 DEG C, 200rpm) in constant-temperature table, detects its 2 phenylethyl alcohol with HPLC and produces Amount, strain Saccharomyces cerevisiae CFFSH-006 ferments its 2 phenylethyl alcohol concentration in the case where shaking flask is horizontal up to 3.85g/L after measured.

4 saccharomyces cerevisiae CFFSH-006 of embodiment produces 2 phenylethyl alcohol under separation and fermentation technique in situ

Separation method in situ is that 2 phenylethyl alcohol fermentation expands industrial conventional means.The present embodiment is according to open source literature 《An aqueous-organic two-phase bioprocess for efficient production of the natural aroma chemicals 2-phenylethanol and 2-phenylethylacetate with yeast》 (Etschmann,M.M.W.&Schrader,J.Appl Microbiol Biotechnol(2006)71:440.https:// Doi.org/10.1007/s00253-005-0281-6 the two-phase original position separation system fermentation process disclosed in), with CFFSH- 006 is fermentation strain, formulates fermentation process.Its detailed fermentation process is as follows: the Liquid Culture based formulas that the present embodiment uses for 60g/L molasses (wherein 73% be glucose and 27% be sucrose) are carbon source, while 6.2g/l KH is added₂PO₄、0.8g/L K₂HPO₄, 50g/L L-phenylalanine；It is added in 10L fermentor according to volume ratio 1:1.By saccharomyces cerevisiae CFFSH-006 bacterial strain It is first seeded to the shaking flask shake culture 18h equipped with YPD culture medium, as seed liquor.Then it is accessed with the inoculum concentration of 6% (v/v) Fermentor, in 18h in fermentation process, after glucose solution (sugared concentration is 600g/L) is added with the speed stream of 10mL/h.Fermentation is extremely Terminate to ferment when 66h, 2 phenylethyl alcohol content of the sampling in HPLC measurement fermentation liquid (210nm is detected, C-18 column).As a result table Bright, 2 phenylethyl alcohol volumetric production (Product related to total volume) reaches 26g/ under these experimental conditions L, be far more than the production capacity of documents bacterial strain K.marxianus CBS 600 and S.cerevisiae Giv 2009.

Embodiment 5, saccharomyces cerevisiae CFFSH-006 produce 2 phenylethyl alcohol under separation and fermentation technique in situ

A large amount of uses (such as PPG1500, macroporous absorbent resin) of low 2 phenylethyl alcohol tolerance and high cost original position separation material It is an important factor for restricting the industrialization of 2 phenylethyl alcohol fermenting and producing.Reduce the separation material in situ in expensive separation process in situ It uses, is to realize 2 phenylethyl alcohol industrialization production, reduces the key of cost.The present embodiment investigates strain Saccharomyces cerevisiae CFFSH- 006 in the case where being greatly decreased separation material dosage in situ, the yield of 2 phenylethyl alcohol.By experiment item as described in example 4 Part ferments, and uniquely the experiment condition different from embodiment 4 is culture medium and polypropylene glycol 1500 (PPG1500) to the present embodiment Volume ratio be changed to 7:1, i.e. culture medium 7L, PPG1500 1L.Its fermentation process curve is as shown in figure 14.

The result shows that saccharomyces cerevisiae CFFSH-006 is also able to maintain in the case where the usage amount of polypropylene glycol is greatly decreased Higher production intensity, total volume yield (Product related to total volume) reach 18.4g/L, L- phenylpropyl alcohol ammonia The transformation efficiency of acid is 78%.This shows that saccharomyces cerevisiae CFFSH-006 bacterial strain has extraordinary industrial application prospect, energy The use cost of original position separation material in 2 phenylethyl alcohol production process is enough greatly decreased.

The identification of contained gene in embodiment 6, saccharomyces cerevisiae CFFSH-006 genome

Using pastoris genomic dna extracts kit (Shanghai Jierui Biology Engineering Co., Ltd, GK1901), said according to it The genomic DNA of the extraction of genome DNA extracting method described in bright book original strain BSH-H9 and CFFSH-006 bacterial strain.According to " real Apply recombinant bacterial strain library described in 1 step of example (4) identification " described in PCR identification method, be using the CPGK1p-F in table 2 Upstream primer, respectively using Caro8-R, Caro9-R, Caro10-R, Csfa1-R in table 2 as downstream primer, respectively with BSH-H9 Genome with CFFSH-006 is pcr template, carries out PCR identification.The gel electrophoresis result of PCR product is as shown in figure 15.

The results show that BSH-H9 genome does not detect any gene expression frame, detect in CFFSH-006 containing aro8 Gene expression frame (PGK1p-aro8-CYC1t) and aro10 gene expression frame (PGK1p-aro10-CYC1t).

The expression of embodiment 7, key gene in other yeast

It can confirm that aro8, aro9, aro10, sfa1 and combinations thereof are to improve BSH-H9 bacterial strain 2 phenylethyl alcohol by embodiment 1 The key gene of yield.It is also other to verify aforementioned four key gene aro8, aro9, aro10, sfa1 and combinations thereof The key gene of Wine brewing yeast strain 2 phenylethyl alcohol yield, need by above-mentioned 4 kinds of key genes with its most suitable combination, Expression ratio is integrated on the genome of bacterial strain to be adapted to.

The present embodiment is using the integrant expression method in embodiment 2, with the type strain of commercialization S.cerevisiae CEN.PK 2-1C is host strain (German EUR0SCARF Culture Collection Center), obtains recombinant bacterial strain library. Concrete outcome in the present embodiment is as follows:

According to total genome in the recombinant bacterium library of the random integration of 4 key genes of 2 the method for embodiment building The gel electrophoresis result of the PCR product of DNA is as shown in figure 16.The result shows that aro8 in the total genomic dna in recombinant bacterium library, Tetra- kinds of genes of aro9, aro10, sfa1 can be detected, it means that the gene of tetra- kinds of genes of aro8, aro9, aro10, sfa1 Expression cassette has successfully been integrated into recombinant bacterium library on the genome of certain plant or a few plants transformant.

According to method described in (4) in embodiment 2.To 48 plants of strain benzyl carbinol yield knots of the first round obtained screening Fruit is as shown in figure 17 (totally 48 plants, higher 6 plants of yield are marked with brace).By being integrated on the genome of different transformants Gene groups and number of copies be random, therefore the gene groups integrated of different transformant, quantity, expression ratio exist Difference, so that it is adapted to level there are larger difference with host, 2 phenylethyl alcohol actual production is had differences between 48 plants of transformants Property.

The highest 6 plants of bacterium of picking 2 phenylethyl alcohol yield carry out the second wheel screening, sieve from the transformant that the first round screens Choosing method is identical as the first round, and 2 phenylethyl alcohol yield result is as shown in figure 18, control group (S.cerevisiae CEN.PK 2- 1C is abbreviated as CEN) it is marked with slash.The result shows that recombinant bacterial strain 2 phenylethyl alcohol yield is apparently higher than control group several times.

This is the result shows that be equally applicable to other saccharomycete using the key gene that BSH-H9 bacterial strain is confirmed by host strain Strain.Using random integration scheme provided by present patent application, it can be quickly obtained high yield saccharomyces cerevisiae engineered yeast strain, and can be with Be rapidly achieved polygenic expression ratio and combination optimal 5 match.

Sequence table

<110>Bowden (Shanghai) Bioisystech Co., Ltd

<120>a kind of genetic engineering bacterium and its construction method and application

<130> MP1828951

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4005

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

gtcgactttc cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca 60

gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct 120

cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc 180

gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt 240

tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc 300

cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc 360

cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg 420

gtggcctaac tacggctaca ctagaaggac agtatttggt atctgcgctc tgctgaagcc 480

agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag 540

cggtggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga 600

tcctttgatc ttttctacac tagtcgaagc atctgtgctt cattttgtag aacaaaaatg 660

caacgcgaga gcgctaattt ttcaaacaaa gaatctgagc tgcattttta cagaacagaa 720

atgcaacgcg aaagcgctat tttaccaacg aagaatctgt gcttcatttt tgtaaaacaa 780

aaatgcaacg cgagagcgct aatttttcaa acaaagaatc tgagctgcat ttttacagaa 840

cagaaatgca acgcgagagc gctattttac caacaaagaa tctatacttc ttttttgttc 900

tacaaaaatg catcccgaga gcgctatttt tctaacaaag catcttagat tacttttttt 960

ctcctttgtg cgctctataa tgcagtctct tgataacttt ttgcactgta ggtccgttaa 1020

ggttagaaga aggctacttt ggtgtctatt ttctcttcca taaaaaaagc ctgactccac 1080

ttcccgcgtt tactgattac tagcgaagct gcgggtgcat tttttcaaga taaaggcatc 1140

cccgattata ttctataccg atgtggattg cgcatacttt gtgaacagaa agtgatagcg 1200

ttgatgattc ttcattggtc agaaaattat gaacggtttc ttctattttg tctctatata 1260

ctacgtatag gaaatgttta cattttcgta ttgttttcga ttcactctat gaatagttct 1320

tactacaatt tttttgtcta aagagtaata ctagagataa acataaaaaa tgtagaggtc 1380

gagtttagat gcaagttcaa ggagcgaaag gtggatgggt aggttatata gggatatagc 1440

acagagatat atagcaaaga gatacttttg agcaatgttt gtggaagcgg tattcgcaat 1500

gagctcgaca tggaggccca gaataccctc cttgacagtc ttgacgtgcg cagctcaggg 1560

gcatgatgtg actgtcgccc gtacatttag cccatacatc cccatgtata atcatttgca 1620

tccatacatt ttgatggccg cacggcgcga agcaaaaatt acggctcctc gctgcagacc 1680

tgcgagcagg gaaacgctcc cctcacagac gcgttgaatt gtccccacgc cgcgcccctg 1740

tagagaaata taaaaggtta ggatttgcca ctgaggttct tctttcatat acttcctttt 1800

aaaatcttgc taggatacag ttctcacatc acatccgaac ataaacaacc atgggtaagg 1860

aaaagactca cgtttcgagg ccgcgattaa attccaacat ggatgctgat ttatatgggt 1920

ataaatgggc tcgcgataat gtcgggcaat caggtgcgac aatctatcga ttgtatggga 1980

agcccgatgc gccagagttg tttctgaaac atggcaaagg tagcgttgcc aatgatgtta 2040

cagatgagat ggtcagacta aactggctga cggaatttat gcctcttccg accatcaagc 2100

attttatccg tactcctgat gatgcatggt tactcaccac tgcgatcccc ggcaaaacag 2160

cattccaggt attagaagaa tatcctgatt caggtgaaaa tattgttgat gcgctggcag 2220

tgttcctgcg ccggttgcat tcgattcctg tttgtaattg tccttttaac agcgatcgcg 2280

tatttcgtct cgctcaggcg caatcacgaa tgaataacgg tttggttgat gcgagtgatt 2340

ttgatgacga gcgtaatggc tggcctgttg aacaagtctg gaaagaaatg cataagcttt 2400

tgccattctc accggattca gtcgtcactc atggtgattt ctcacttgat aaccttattt 2460

ttgacgaggg gaaattaata ggttgtattg atgttggacg agtcggaatc gcagaccgat 2520

accaggatct tgccatccta tggaactgcc tcggtgagtt ttctccttca ttacagaaac 2580

ggctttttca aaaatatggt attgataatc ctgatatgaa taaattgcag tttcatttga 2640

tgctcgatga gtttttctaa tcagtactga caataaaaag attcttgttt tcaagaactt 2700

gtcatttgta tagttttttt atattgtagt tgttctattt taatcaaatg ttagcgtgat 2760

ttatattttt tttcgcctcg acatcatctg cccagatgcg aagttaagtg cgcagaaagt 2820

aatatcatgc gtcaatcgta tgtgaatgct ggtcgctata ctgctcgaga ctgtaattgc 2880

ttttagttgt gtatttttag tgtgcaagtt tctgtaaatc gattaatttt tttttctttc 2940

ctctttttat taaccttaat ttttatttta gattcctgac ttcaactcaa gacgcacaga 3000

tattataaca tctgcataat aggcatttgc aagaattact cgtgagtaag gaaagagtga 3060

ggaactatcg catacctgca tttaaagatg ccgatttggg cgcgaatcct ttattttggc 3120

ttcaccctca tactattatc agggccagaa aaaggaagtg tttccctcct tcttgaattg 3180

atgttaccct cataaagcac gtggcctctt atcgagaaag aaattaccgt cgctcgtgat 3240

ttgtttgcaa aaagaacaaa actgaaaaaa cccagacacg ctcgacttcc tgtcttccta 3300

ttgattgcag cttccaattt cgtcacacaa caaggtccta gcgacggctc acaggttttg 3360

taacaagcaa tcgaaggttc tggaatggcg ggaaagggtt tagtaccaca tgctatgatg 3420

cccactgtga tctccagagc aaagttcgtt cgatcgtact gttactctct ctctttcaaa 3480

cagaattgtc cgaatcgtgt gacaacaaca gcctgttctc acacactctt ttcttctaac 3540

caagggggtg gtttagttta gtagaacctc gtgaaactta catttacata tatataaact 3600

tgcataaatt ggtcaatgca agaaatacat atttggtctt ttctaattcg tagtttttca 3660

agttcttaga tgctttcttt ttctcttttt tacagatcat caaggaagta attatctact 3720

ttttacaaca aatataaaac agatggggga tccactagtg tcatgtaatt agttatgtca 3780

cgcttacatt cacgccctcc ccccacatcc gctctaaccg aaaaggaagg agttagacaa 3840

cctgaagtct aggtccctat ttattttttt atagttatgt tagtattaag aacgttattt 3900

atatttcaaa tttttctttt ttttctgtac agacgcgtgt acgcatgtaa cattatactg 3960

aaaaccttgc ttgagaaggt tttgggacgc tcgaaggctt taatt 4005

<210> 2

<211> 1503

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

atgactttac ctgaatcaaa agacttttct tacttgtttt cggatgaaac caatgctcgt 60

aaaccatccc cattgaaaac ctgcatccat cttttccaag atcctaacat tatctttttg 120

ggtggtggcc tgccattaaa agattatttc ccatgggata atctatctgt agattcaccc 180

aagcctcctt ttccccaggg tattggagct ccaattgacg agcagaattg cataaaatac 240

accgtcaaca aagattacgc tgataaaagt gccaatcctt ccaacgatat tcctttgtca 300

agagctttgc aatacgggtt cagtgctggt caacctgaac tattaaactt cattagagat 360

cataccaaga ttatccatga tttgaagtat aaggactggg acgttttagc cactgcaggt 420

aacacaaatg cctgggaatc tactttaaga gtcttttgta accgaggtga tgtcatctta 480

gttgaggcac attctttttc ctcttcattg gcttctgcag aggctcaagg tgtcattacc 540

ttccccgtgc caattgacgc tgatggtatc attcctgaaa aattagctaa agtcatggaa 600

aactggacac ctggtgctcc taaaccaaag ttgttataca ctattccaac gggccaaaat 660

ccaactggta cttccattgc agaccataga aaggaggcaa tttacaagat cgctcaaaag 720

tacgacttcc taattgtgga agatgaacct tattatttct tacaaatgaa tccctacatc 780

aaagacttga aggaaagaga gaaggcacaa agttctccaa agcaggacca tgacgaattt 840

ttgaagtcct tggcaaacac tttcctttcc ttggatacag aaggccgtgt tattagaatg 900

gattcctttt caaaagtttt ggccccaggg acaagattgg gttggattac tggttcatcc 960

aaaatcttga agccttactt gagtttgcat gaaatgacga ttcaagcccc agcaggtttt 1020

acacaagttt tggtcaacgc tacgctatcc aggtggggtc aaaagggtta cttggactgg 1080

ttgcttggcc tgcgtcatga atacactttg aaacgtgact gtgccatcga tgccctttac 1140

cagtatctac cacaatctga tgctttcgtg atcaatcctc caattgcagg tatgtttttc 1200

accgtgaaca ttgacgcatc tgtccaccct gagtttaaaa caaaatacaa ctcagaccct 1260

taccagctag aacagagtct ttaccacaaa gtggttgaac gtggtgtttt agtggttccc 1320

ggttcttggt tcaagagtga gggtgagacg gaacctcctc aacccgctga atctaaagaa 1380

gtcagtaatc caaacataat tttcttcaga ggtacctatg cagctgtctc tcctgagaaa 1440

ctgactgaag gtctgaagag attaggtgat actttatacg aagaatttgg tatttccaaa 1500

tag 1503

<210> 3

<211> 1542

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

atgactgctg gttctgtccc ccctgttgat tacgcttcct taaagaagaa cttccaaccg 60

tttctctcca gaagagtaga aaatagatct ctgaaaagct tttgggatgc ttctgacatc 120

tcagatgacg tcattgagct agctggtgga atgccaaacg agagattttt tcctatcgaa 180

tctatggatt tgaaaatatc aaaagttcct tttaatgata acccaaaatg gcatgattcg 240

tttaccacgg cgcatttgga cttgggatcc cccagtgagc tacccattgc acgttctttc 300

caatacgcag aaaccaaggg tttaccccct ctcttacatt ttgttaaaga ttttgtgtcc 360

agaattaatc gcccagcctt ttccgatgag acggagtcta actgggatgt catcctttct 420

ggcgggtcca acgattcaat gtttaaggtt tttgaaacaa tttgcgacga atcaaccact 480

gtgatgattg aagagtttac tttcaccccg gctatgtcca atgtggaggc tacaggagca 540

aaagtcatcc ccatcaagat gaacctgacc ttcgacagag agtcccaggg tattgatgtc 600

gaatatctaa cccagttgct cgataattgg tcaactggac catacaaaga cttaaacaag 660

ccaagggtcc tatataccat tgcaacgggc caaaatccta ccgggatgtc tgtccctcag 720

tggaaaagag agaaaattta ccagttggcc caaagacacg atttcctcat tgttgaagat 780

gatccctacg gttatctgta ctttccttcc tataatccgc aagagccatt agaaaaccct 840

taccattcta gcgacctgac tactgaacgg tatttgaatg attttttaat gaaatcattc 900

ttgactttgg atacagatgc ccgtgtcatc cgtttggaga ctttttctaa aatttttgct 960

cctggattaa ggttatcctt catcgttgct aataaattcc ttttgcaaaa aatcttggat 1020

ttggccgaca ttactacaag ggcccccagt ggtacctcac aagctattgt ttattctaca 1080

ataaaggcaa tggctgagtc caacttatcg tcctctcttt ctatgaaaga agcaatgttt 1140

gagggttgga taagatggat aatgcagatt gcttctaaat acaatcatag gaaaaatctt 1200

actttgaaag ccttatacga aacagaatct taccaagctg gtcagtttac cgttatggaa 1260

ccctccgcgg gtatgttcat cattattaaa atcaattggg ggaatttcga taggcctgac 1320

gatttgccgc aacagatgga tattttagat aagttcttgg tgaagaatgg tgttaaacta 1380

gtgcttggtt ataaaatggc tgtttgccca aattattcaa agcagaattc agattttcta 1440

agactcacca tcgcctatgc aagggatgat gatcagttga ttgaagcttc caaaagaatc 1500

ggtagtggca taaaagaatt ttttgacaac tataaaagtt ga 1542

<210> 4

<211> 1908

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

atggcacctg ttacaattga aaagttcgta aatcaagaag aacgacacct tgtttccaac 60

cgatcagcaa caattccctt tggtgaatac atattcaaaa gattgttgtc catcgatacg 120

aaatcagttt tcggtgttcc tggtgacttc aacttatctc tattagaata tctctattca 180

cctagtgttg aatcagctgg cctaagatgg gtcggcacgt gtaatgaact gaacgccgct 240

tatgcggccg acggatattc ccgttactct aataagattg gctgtttaat aaccacgtat 300

ggcgttggtg aattaagcgc cttgaacggt atagccggtt cgttcgctga aaacgtcaaa 360

gttttgcaca ttgttggtgt ggccaagtcc atagattcgc gttcaagtaa ctttagtgat 420

cggaacctac atcatttggt cccacaacta catgattcaa attttaaagg gccaaatcat 480

aaagtatatc atgatatggt aaaagataga gtcgcttgct cggtagccta cttggaggat 540

attgaaactg catgtgacca agtcgataat gttatccgcg atatttacaa gtattctaaa 600

cctggttata tttttgttcc tgcagatttt gcggatatgt ctgttacatg tgataatttg 660

gttaatgttc cacgtatatc tcaacaagat tgtatagtat acccttctga aaaccaattg 720

tctgacataa tcaacaagat tactagttgg atatattcca gtaaaacacc tgcgatcctt 780

ggagacgtac tgactgatag gtatggtgtg agtaactttt tgaacaagct tatctgcaaa 840

actgggattt ggaatttttc cactgttatg ggaaaatctg taattgatga gtcaaaccca 900

acttatatgg gtcaatataa tggtaaagaa ggtttaaaac aagtctatga acattttgaa 960

ctgtgcgact tggtcttgca ttttggagtc gacatcaatg aaattaataa tgggcattat 1020

acttttactt ataaaccaaa tgctaaaatc attcaatttc acccgaatta tattcgcctt 1080

gtggacacta ggcagggcaa tgagcaaatg ttcaaaggaa tcaattttgc ccctatttta 1140

aaagaactat acaaacgcat tgacgtttct aaactttctt tgcaatatga ttcaaatgta 1200

actcaatata cgaacgaaac aatgcggtta gaagatccta ccaatggaca atcaagcatt 1260

attacacaag ttcacttaca aaagacgatg cctaaatttt tgaaccctgg tgatgttgtc 1320

gtttgtgaaa caggctcttt tcaattctct gttcgtgatt tcgcatttcc ttcgcagtta 1380

aaatatatat cgcaaggatt tttcctttcc attggcatgg cccttcctgc cgccctaggt 1440

gttggaattg ccatgcaaga ccactcaaac gctcacatca atggtggcaa cgtaaaagag 1500

gactataagc caagattaat tttgtttgaa ggtgacggtg cagcacagat gacaatccaa 1560

gaactgagca ccattctgaa gtgcaatatt ccactagaag ttatcatttg gaacaataac 1620

ggctacacta ttgaaagagc catcatgggc cccaccaggt cgtataacga cgttatgtct 1680

tggaaatgga ccaaactatt tgaagcattc ggagacttcg acggaaagta tactaatagc 1740

actctcattc aatgtccctc taaattagca ctgaaattgg aggagcttaa gaattcaaac 1800

aaaagaagcg ggatagaact tttagaagtc aaattaggcg aattggattt ccccgaacag 1860

ctaaagtgca tggttgaagc agcggcactt aaaagaaata aaaaatag 1908

<210> 5

<211> 1161

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

atgtccgccg ctactgttgg taaacctatt aagtgcattg ctgctgttgc gtatgatgcg 60

aagaaaccat taagtgttga agaaatcacg gtagacgccc caaaagcgca cgaagtacgt 120

atcaaaattg aatatactgc tgtatgccac actgatgcgt acactttatc aggctctgat 180

ccagaaggac ttttcccttg cgttctgggc cacgaaggag ccggtatcgt agaatctgta 240

ggcgatgatg tcataacagt taagcctggt gatcatgtta ttgctttgta cactgctgag 300

tgtggcaaat gtaagttctg tacttccggt aaaaccaact tatgtggtgc cgttagagct 360

actcaaggga aaggtgtaat gcctgatggg accacaagat ttcataatgc gaaaggtgaa 420

gatatatacc atttcatggg ttgctctact ttttccgaat atactgtggt ggcagatgtc 480

tctgtggttg ccatcgatcc aaaagctccc ttggatgctg cctgtttact gggttgtggt 540

gttactactg gttttggggc ggctcttaag acagctaatg tgcaaaaagg cgataccgtt 600

gcagtatttg gctgcgggac tgtaggactc tccgttatcc aaggtgcaaa gttaaggggc 660

gcttccaaga tcattgccat tgacattaac aataagaaaa aacaatattg ttctcaattt 720

ggtgccacgg attttgttaa tcccaaggaa gatttggcca aagatcaaac tatcgttgaa 780

aagttaattg aaatgactga tgggggtctg gattttactt ttgactgtac tggtaatacc 840

aaaattatga gagatgcttt ggaagcctgt cataaaggtt ggggtcaatc tattatcatt 900

ggtgtggctc ccgctggtgg agaaatttct acaaggccgt tccagctggt cactggtaga 960

gtgtggaaag gctctgcttt tggtggcatc aaaggtagat ctgaaatggg cggtttaatt 1020

aaagactatc aaaaaggtac cttaaaagtc gaagaattta tcactcacag gagaccattc 1080

aaagaaatca atcaagcctt tgaagatttg cataacggtg attgcttaag aaccgtcttg 1140

aagtctgatg aaataaaata g 1161

Claims

1. a kind of genetic engineering bacterium, the key gene that is integrated in strain gene group in 2 phenylethyl alcohol metabolic pathway of synthesizing.

2. genetic engineering bacterium according to claim 1, the bacterial strain is saccharomyces cerevisiae.

3. genetic engineering bacterium according to claim 1, the key gene in the 2 phenylethyl alcohol metabolic pathway of synthesizing be aro8, Aro9, aro10 and sfa1.

4. being according to claim 1 genetic engineering bacterium, the genetic engineering bacterium is deposited in China typical culture collection The heart, deposit number are CCTCC NO:M 2018669.

5. the construction method of genetic engineering bacterium described in claim 1-4 any one constructs 2 phenylethyl alcohol anabolism way respectively Then the common random integration of expression cassette is constructed 2- in host strain multiple cloning sites by the expression cassette of multiple key genes in diameter Benzyl carbinol is metabolized the random integration expression library of key gene, and bacterial strain each in library is tested and screened, and obtains 2- benzene second The high bacterial strain of alcohol yield.

6. construction method according to claim 5, described to be integrated into δ-integrations method.

7. construction method according to claim 5, the host strain is saccharomyces cerevisiae BSH-H9.

8. construction method according to claim 5, the key gene in the 2 phenylethyl alcohol metabolic pathway of synthesizing be aro8, At least one of aro9, aro10, sfa1.

9. application of the genetic engineering bacterium in fermenting and producing 2 phenylethyl alcohol described in claim 1-4 any one.

10. a kind of method for producing 2 phenylethyl alcohol, using L-phenylalanine as substrate using described in claim 1-4 any one Engineering bacteria fermentation or cell catalysis mode produce 2 phenylethyl alcohol.

11. a kind of method of screening 2 phenylethyl alcohol metabolism key gene, includes the following steps:

(1) in the expression cassette of free expression plasmid for key gene to be screened being cloned respectively and being connected to host, distinguished It is loaded with the free expression plasmid of different key genes to be screened；Wherein the key gene to be screened is 2 phenylethyl alcohol anabolism Enzyme coding gene, controlling gene or auxiliary gene in approach；

(2) the free expression plasmid for being loaded with different key genes to be screened respectively is mixed, cotransformation host strain, chooses positive turn Beggar obtains the recombinant bacterial strain library for being loaded with the free expression plasmid of combination of different key genes to be screened；

(3) transformant in the recombinant bacterial strain library of acquisition is subjected to fermentation test respectively, screens the 2- benzene of different conversion bacterial strains Ethanol production, selects the bacterial strain for wherein capableing of high yield benzyl carbinol, identify contained in high yield benzyl carbinol recombinant bacterial strain to Screen key gene and key gene to be screened combination.

12. according to the method for claim 11, the key gene to be screened be aro8, aro9, aro10, sfa1, Aro80, CAT8, gap1 and agp1.

13. according to the method for claim 11, the step (1) is specially that promoter and terminator are contained in both ends respectively A variety of key genes to be screened genetic fragment and the linearization for enzyme restriction containing identical promoters and terminator free table Up to carrier cotransformation host.

14. according to the method for claim 13, the promoter is PGK1 strong promoter, the terminator is CYC1, the free expression vector are plasmid pCS01.

15. a kind of method for constructing high yield 2 phenylethyl alcohol engineered strain, utilizes method described in claim 11-14 any one Screening confirmation 2 phenylethyl alcohol is metabolized key gene, and then the building common random integration of expression cassette is obtained in host's multiple cloning sites respectively The random integration expression library for obtaining 2 phenylethyl alcohol metabolism key gene, is tested and is screened to bacterial strain each in library, and 2- is obtained The high bacterial strain of benzyl carbinol yield.